Horizontal and Vertical Transmission of Human Immunodeficiency ...

JID 1998;177 (January)

Concise Communications

We.B.3167]. In: Program and abstracts: XI International Conference on AIDS (Vancouver, Canada, 7 – 12 July 1996). Vol 2. Vancouver: XI International Conference on AIDS Society, 1996. 9. Behets FMT, Liomba G, Lule G, et al. Sexually transmitted diseases and human immunodeficiency virus control in Malawi: a field study of genital ulcer disease. J Infect Dis 1995; 171:451 – 5. 10. Mole L, Ripich S, Margolis D, Holodniy M. Plasma HIV RNA levels are increased during active herpes simplex virus infection. In: Program and abstracts: 2nd Conference on Retroviruses and Opportunistic Infections (Washington, DC). Alexandria, VA: Infectious Disease Society of America, 1995:98. 11. Tyndall M, Malisa M, Plummer FA, Ombetti J, Ndinya-Achola JO, Ronald AR. Ceftriaxone no longer predictably cures chancroid in Kenya. J Infect Dis 1993; 167:469 – 71.

227

12. Vernazza PL, Gilliam BL, Dyer JR, et al. Quantification of HIV in semen: correlation with antiviral treatment and immune status. AIDS 1997; 11: 987 – 93. 13. Lee TH, Sakahara N, Fiebig E, Busch MP, O’Brien TR, Herman SA. Correlation of HIV-1 RNA levels in plasma and heterosexual transmission of HIV-1 from infected transfusion recipients [letter]. J Acquir Immune Defic Syndr Hum Retrovirol 1996; 12:427 – 8. 14. Fang G, Burger H, Grimson R, et al. Maternal plasma human immunodeficiency virus type 1 RNA level: a determinant and projected threshold for mother-to-child transmission. Proc Natl Acad Sci USA 1995; 92: 12,100 – 4. 15. Busch MP, Operskalski EA, Mosley JW, et al. Factors influencing human immunodeficiency virus type 1 transmission by blood transfusion. J Infect Dis 1996; 174:26 – 33.

Horizontal and Vertical Transmission of Human Immunodeficiency Virus Type 1 Dual Infections Caused by Viruses of Subtypes B and C Luiz M. Janini, Amilcar Tanuri, Mauro Schechter, Jose M. Peralta, Ana C. P. Vicente, Nick Dela Torre, Norman J. Pieniazek, Chi-cheng Luo, Artur Ramos, Vincent Soriano, Gerald Schochetman, Mark A. Rayfield, and Danuta Pieniazek

Division of AIDS, STD, TB, Laboratory Research, and Division of Parasitic Disease, Centers for Disease Control and Prevention, Atlanta, Georgia; Instituto de Microbiologia and Biologia, and Programa SIDA/ AIDS, Hospital Clementino Fraga Filho, Universidade Federal do Rio de Janeiro, and Instituto Oswaldo Cruz, Rio de Janeiro, Brazil; Instituto de Salud Carlos III, Madrid, Spain

This article describes a case of horizontal (heterosexual) and subsequent vertical (mother to infant) transmission of 2 human immunodeficiency viruses type 1 (HIV-1) subtypes. Dual infection in a husband, his wife, and their child was initially detected by use of a restriction fragment length polymorphism assay of the proviral protease in peripheral blood mononuclear cells. The simultaneous presence of highly similar sets of HIV-1 subtypes B and C infecting the 3 family members was confirmed by DNA sequence analysis of pol, gag, and env genes. These data, together with available epidemiologic information, may indicate that the husband’s high-risk sexual behavior was the source of dual infections. Because his wife did not report such activities, it was likely that he passed HIV1 strains to his spouse, who subsequently transmitted them to their child.

The human immunodeficiency virus type 1 (HIV-1) pandemic is now recognized as consisting of many separate epidemics caused by 10 viral subtypes [1]. With an estimated 15 million HIV-1 – infected persons, the geographic distribution of viral clades is becoming more dispersed, and the simultaneous presence of multiple subtypes in certain regions has become more common. Population migration and international travel

Received 10 April 1997; revised 7 August 1997. Presented in part: 4th Conference on Retroviruses and Opportunistic Infections, Washington DC, 22 – 27 January 1997 (abstract 29). Informed consent was obtained from human subjects. Sequences have been submitted to GenBank under accession nos. U19432, U19433, U19437, U19438, U19450, U19451, and U83689-U83700. Reprints or correspondence: Dr. Danuta Pieniazek, HIV/Retrovirus Diseases Branch, Division of AIDS, STD, TB, Laboratory Research, CDC, 1600 Clifton Rd., Mail Stop G19, Atlanta, GA 30333. The Journal of Infectious Diseases 1998;177:227–31 q 1998 by The University of Chicago. All rights reserved. 0022–1899/98/7701–0035$02.00

are considered responsible for the spreading of diverse HIV-1 subtypes into regions previously affected by HIV-1 strains of 1 subtype. As a consequence, the potential for HIV-1 mixed infections and genetic recombination involving strains of distinct subtypes in an infected individual has increased [2, 3]. The development of specific genetic methods has enabled identification of dual HIV-1 infections caused by subtypes B and E in Thailand [4], as well as by subtypes D and F, and subtypes B and F in Brazil [5]. Detection of naturally occurring HIV-1 multiple infections has important implications for vaccine development because it suggests that infection with 1 HIV-1 subtype may not fully protect against subsequent superinfection with distinct HIV-1 strains. Although dual HIV-1 infections caused by viruses of distinct subtypes have been documented, the transmission of 2 HIV-1 subtypes from 1 dually infected person to another has not been reported. Materials and Methods Specimens. Two Brazilian specimens were from a married couple (Br19 and Br20), and 1 was from their child (Br30). The

228


parents were HIV-1–seropositive and had persistent generalized lymphadenopathy as their only symptom during clinical followup. The child, however, had a history of opportunistic infections (recurrent pneumonia) since the age of 1 month, and her positive HIV-1 serology led to initial testing of the parents. A similar clinical status was observed in all of these patients at the time of the second blood sample, which was collected 6 months later. The father reported sexual contacts with homosexual males in his youth and with female prostitutes before and during his marriage. His wife did not report such activities. None of them reported using drugs. Polymerase chain reaction (PCR). Isolation of patients’ peripheral blood mononuclear cells (PBMC), the processing of the viral DNA, conditions for nested PCR, and the set of primers for PCR amplification of the entire (297 bp) protease gene (prt) and of a 311-bp p24 gag fragment have been described [6]. The outer primers for amplification of Ç678 bp of the env C2-V3 region were 650A: 5*-AATGTCAGCACAGTACAATGTAC; nucleotide position: 6538–6560, HIV-1LAI , and 1099A: 5*-TTCTCCAATTGTCCCTCATATCTCCTCC; nucleotide position: 7230–7258. The inner primers were JH33: 5*CTGTTAAATGGCAGTCTAGC; nucleotide position: 6580–6609 and 1099A. Restriction fragment length polymorphism analysis (RFLP). The restriction enzyme digestions consisted of 8 mL of nested prt or gag PCR products, 5–10 U of either AluI or DraI restriction enzymes, and 1 mL of a specific enzyme buffer supplied by manufacturer as previously described [6]. After incubation overnight of the enzyme reactions at 377C, the entire restriction digest reaction was electrophoresed in a 10% polyacrylamide gel and visualized by ethidium bromide staining. Positive controls representing distinct HIV-1 subtypes were included for the restriction enzyme digest to confirm the activity of the restriction enzyme and to provide expected restriction fragment patterns. Cloning and sequencing. The PCR-amplified viral prt, gag, and env sequences were cloned into pBluescript vector using the pCR-Script SK(/) cloning kit (Stratagene, La Jolla, CA). DNA from 50 clones of each viral region was screened for distinct HIV1 strains by the RFLP assay within prt and gag regions [6] and by heteroduplex mobility assay in the env region [7]. Doublestranded viral DNA from selected clones was cycle-sequenced in both directions with fluorescent dye-labeled sequencing terminators [8]. Sequencing reactions were run in an automated DNA sequencer (Applied Biosystems, Foster City, CA). A consensus sequence based on three clones was used for analysis. Phylogenetic analysis. The sequences were aligned using the CLUSTAL multiple sequence alignment program [9]. The aligned sequences, after elimination of regions containing gaps, were analyzed by the maximum likelihood method using the fastDNAml [10] and with distance methods using the neighbor-joining method [11]. The SIV-cpz sequences (GenBank accession no. X52154) were used as outgroups.

Results Brazil has been selected as a World Health Organization field site for HIV-1 vaccine evaluation programs. Thus, a huge priority has been given to extensive molecular examination of the prevalence of the major HIV-1 strain(s) circulating in the


country and analysis of HIV-1 genetic diversity, including dual infections caused by virus strains of distinct subtypes and recombinants. From December 1992 to April 1993, 21 HIV-1 specimens were collected at the Hospital Universitario Clementino Fraga Filho of Universidade Federal do Rio de Janeiro. Eighteen of these specimens have been previously molecularly characterized, and the first evidence of HIV-1 dual infection caused by subtype F and D viruses in Brazil was documented among these patients [6]. The remaining 3 specimens are the subject of this study. AluI restriction site polymorphism in prt from prototypic isolates of particular HIV-1 clades results in three distinctive patterns (figure 1A). Pattern 1 is characteristic of subtypes A, C, and F viruses, whereas patterns 2 and 3 are typical of HIV-1 subtypes B and D. The simultaneous presence of AluI digestion patterns 1 with 2 or 3 in the infected patient is indicative of a dual infection caused by viral subtypes A, C, or F with subtypes B or D. By using this assay, the simultaneous presence of two different AluI digestion patterns (1 and 2, figure 1B) has been found for the viral prt in PBMC of a couple (Br19 and Br20) and their child (Br30). These data suggested that each of the 3 individuals could be multiinfected with distinct HIV-1 subtypes. Since nucleotide substitution can either generate or eliminate a restriction site, sequence analysis remains the definitive tool for identifying variants of dual infections. Thus, PCR-amplified HIV-1 prt, the p24 gag fragment, and the C2-V3 domain of patients Br19, Br20, and Br30 were cloned and sequenced. Sequence analysis of pol, gag, and env regions revealed the presence of 2 distinct HIV-1 variants in each patient. The viral nucleotide divergence was 9.1% (8.7% – 9.7%) between two prt, 8.3% (7.7% – 9.0%) between two gag, and 21.5% (21% – 22%) between two env sequences. Moreover, when pairwise analysis was done on viral DNA isolated from the parents and their child, the range of divergence was 0.6% (0.3% – 0.9%) for both prt and gag and 2.2% (1.3% – 3.3%) within env. These values implied that HIV-1 variants were closely related in the father, the mother, and their child. The phylogenetic analysis demonstrated that two divergent HIV-1 prt, gag, and env sequences found in a couple and their child segregated into subtypes B and C (figure 2). Obtaining essentially identical topologies of phylogenetic trees with both maximum-likelihood and neighbor-joining methods additionally validated the reliability of these phylogenetic results. Furthermore, the topology of the final tree was found to be stable before and after bootstrapping with 100 rounds of replication. These results clearly indicate that 2 HIV-1 variants of distinct subtypes were indeed present in the parents and the child, as suggested by AluI restriction analysis of the viral protease gene. Finally, the sequence data showing a 99% similarity between viral sequences from the first and second blood sample exclude the possibility that these results occurred through laboratory contamination. Also, viral sequences from these patients were distinct from those of HIV-1 laboratory strains (those with



229

Figure 1. Distinct AluI digestion patterns of HIV-1 protease gene. A, Restriction pattern 1 represents single infections with subtypes A, C, and F viruses; patterns 2 and 3 represent viruses of subtype B or D. B, Simultaneous presence of AluI digestion patterns 1 and 2 represents potential dual infection in Brazilian patients Br19, Br20, and Br30. First lane in A and B presents molecular weight marker-FX174 RF DNA, HaeIII digest.

prefixes BR and 855M, 89867, and 90011; figure 2), which were commonly used as standards in different procedures. Contamination during blood collection was also unlikely because a disposable vacutainer system was used to obtain each blood sample, and the second blood sample from each of the patients was collected on a different day.

Discussion The results presented in this report provide the first evidence of both horizontal and vertical transmission of 2 distinct HIV1 subtypes from 1 dually infected person to another. This is confirmed by the simultaneous presence of pol (prt), gag (p24 gag fragment), and env (C2-V3) sequences of subtypes B and C in a married couple and their child. The use of comparative phylogenetic analysis of three independent viral gene regions enabled discrimination between the presence of a dual HIV-1 infection and a possible mosaic viral genome. The simultaneous presence in each patient of two distinct protease genes, two p24 gag regions, and two C2-V3 domains is indicative of HIV1 mixed infection within the family rather than infection with a mosaic viral DNA. Sequence similarities of 99% in the protease gene and the p24 gag region found between HIV-1 variants of each subtype in the parents and their child strongly indicate the same viruses. However, since analyses of C2-V3 sequences have been used almost exclusively in previous studies to either support or disprove epidemiologic linkage among cases [7, 12, 13], we also analyzed this env domain in PBMC of the 3 patients. Genetic distance analysis of env sequences showed strong similarities

between viral strains of all 3, with the percentages of sequence divergence for the comparable viruses from these individuals being from 1.3% to 3.3% for both subtypes B and C. These genetic distances were similar to those reported for known epidemiologically linked infections [7, 12, 13]. Although these results support the heterosexual HIV-1 transmission from 1 adult partner to another, we do not have direct evidence (i.e., negative HIV serology status at least in 1 of the adult patients) identifying the source of dual infection and the direction of HIV-1 transmission. Nevertheless, epidemiologic findings may indicate that the father was the primary source of the HIV-1 infection in this family because of his high-risk sexual activities. The wife reported no activities that would have put her at risk for HIV-1 infection. Therefore, it was likely that the husband passed the subtype B and C mixed strains to his spouse, and she subsequently transmitted both subtypes vertically to the child. Infection by 2 HIV-1 strains must occur either sequentially (superinfection) or simultaneously. Sequential HIV infection in humans has not been documented. It is considered to be rare due to suppression of the superinfecting strain by an active immune response in the host to the primary strain [14]. This report does not confirm whether the acquisition of mixed strains was sequential (at the different period of time) or simultaneous (at the same time) during horizontal or vertical transmission. In conclusion, we found that the RFLP assay provides a powerful screening tool for identifying HIV-1 mixed infections caused by subtypes A, C, or F with subtypes B or D viruses. Detection of dual infections involving other combinations of viral subtypes is also feasible [4 – 6]. The concordance of the

230



Figure 2. Phylogenetic classification of HIV-1 strains in dually infected Brazilian family (indicated by arrows): Br19 (father), Br20 (mother), and Br30 (child). Distinct HIV-1 subtypes are delineated. Trees were constructed on the basis of DNA sequences of prt (A), gag (B), and env (C) by using maximum-likelihood method. Numbers at branch nodes connected with subtypes indicate bootstrap values. Scale bar indicates evolutionary distance of 0.10 nucleotides per position in sequence.

complex RFLP patterns in the couple and their child provides the first evidence for the horizontal and vertical transmission of HIV-1 dual infections with subtypes B and C. Moreover, no differential transmission of B or C viruses was found within the family. This is noteworthy because there was suggestive evidence for differential transmissibility of HIV-1 subtypes B and E through sexual contact [15]. Clearly, transmission of dual HIV-1 infections and the potential for recombinants between transmitted strains provides another mechanism for increasing the genetic diversity of HIV-1.

Acknowledgment

We thank Francesca McKenzie for critical review of the manuscript. References 1. Myers G, Korber B, Vain-Hobson S, Smith RF, Pavlakis GN, eds. Human retroviruses and AIDS. Los Alamos, NM: Los Alamos National Laboratory, 1995. 2. Robertson DL, Sharp PM, McCutchan FE. Recombination in HIV-1. Nature 1995; 374:124 – 6.



3. Sabino EC, Shpaer EG, Morgado MG, et al. Identification of human immunodeficiency virus type 1 envelope genes recombinant between subtypes B and F in two epidemiologically linked individuals from Brazil. J Virol 1994; 68:6340 – 6. 4. Artenstein AW, VanCott TC, Mascola JR, et al. Dual infection with human immunodeficiency virus type 1 of distinct envelope subtypes in humans. J Infect Dis 1995; 171:805 – 10. 5. Pieniazek D, Janini LM, Ramos A, at al. HIV-1 patients may harbor viruses of different phylogenetic subtypes: implication for the evolution of the HIV/AIDS pandemic. Emerg Infect Dis 1995; 1: 86 – 8. 6. Janini LM, Pieniazek D, Peralta JM, et al. Identification of single and dual infections with distinct subtypes of human immunodeficiency virus type 1 by using restriction fragment length polymorphism analysis. Virus Genes 1996; 13:69 – 81. 7. Delwart EL, Shpaer EG, Louwagie J, et al. Genetic relationships determined by a DNA heteroduplex mobility assay: analysis of HIV-1 env genes. Science 1993; 262:1257 – 61.

231

8. Ou CY, Ciesielski C, Myers G, et al. Molecular epidemiology of HIV transmission in a dental practice. Science 1992; 256:1165 – 71. 9. Higgins DG, Sharp PM. Fast and sensitive multiple sequence alignment on a microcomputer. Comput Appl Biosci 1989; 5:151 – 3. 10. Larsen N, Olsen GJ, Maidak BN, et al. The ribosomal database project. Nucleic Acids Res 1993; 21:3021 – 3. 11. Felsenstein J. PHYLIP-phylogeny interference package (version 3.2). Cladistics 1989; 5:164 – 6. 12. Holmes EC, Zhang LQ, Robertson P, et al. The molecular epidemiology of human immunodeficiency virus type 1 in Edinburgh. J Infect Dis 1995; 171:45 – 53. 13. Centers for Disease Control and Prevention. HIV transmission between two adolescent brothers with hemophilia. MMWR Morb Mortal Wkly Rep 1993; 42:948 – 51. 14. Subbarao S, Schochetman G. Genetic variability of HIV-1. AIDS 1996; 10(suppl A):S13 – 23. 15. Kunanusont C, Foy HM, Kreiss JK, et al. HIV-1 subtypes and male-tofemale transmission in Thailand. Lancet 1995; 345:1078 – 83.

A Placebo-Controlled Trial of Ranitidine in Patients with Early Human Immunodeficiency Virus Infection John A. Bartlett, Paul S. Berry, K. Wayne Bockman, Allan Stein, Judy Johnson, Shannon Graham, Joseph Quinn, Ralph DeMasi, and W. James Alexander

Duke University Medical Center, Durham, and Glaxo Wellcome, Inc., Research Triangle Park, North Carolina; N2 Research, Inc., Jackson Hole, Wyoming; Houston Clinical Research Network, Houston, Texas; Community Research Initiative of South Florida, Coral Gables, Florida

Previous uncontrolled reports have suggested that H2-antagonists may possess immunomodulatory activity in human immunodeficiency virus (HIV) – infected patients. Such trials reported improvements in HIV-related symptoms, increased absolute CD4 cell numbers, and improvements in other measures of host immunity. The present trial was a randomized, placebo-controlled, double-blind trial of ranitidine 300 mg (orally twice daily) in subjects with early HIV infection (absolute CD4 cells, 400 – 700/mm3). Eighty-one subjects entered the trial and 73 completed 16 weeks on study medications. There were no significant differences in the time-weighted average change from baseline between the 2 treatment groups in absolute CD4 cell number, plasma HIV RNA level, or most other surrogate markers of HIV infection. Serum b2-microglobulin levels were significantly lower in placebo than ranitidine recipients. Ranitidine should not be recommended for the treatment of HIVinfected patients unless it is used for established indications.

The pathogenesis of progressive human immunodeficiency virus (HIV) infection is intimately related to a massive, widespread infection of lymphoid tissue that is chronically active [1, 2]. Antiretroviral drugs can provide potent suppression of HIV activity [3], modest increases in absolute CD4 lymphocyte counts [3], and a temporary delay in the clinical progression of HIV disease [4, 5]. However, currently available antiretroviral

Received 10 April 1997; revised 20 August 1997. This study was approved by each site’s Institutional Review Board, and informed consent was obtained from all subjects. Financial support: Glaxo-Wellcome, Research Triangle Park, NC. Reprints or correspondence: Dr. John A. Bartlett, Box 3238, Duke University Medical Center, Durham, NC 27710 ([email protected]). The Journal of Infectious Diseases 1998;177:231–4 q 1998 by The University of Chicago. All rights reserved. 0022–1899/98/7701–0036$02.00

drugs have been unable to offer dramatic and enduring immunorestoration by themselves [6]. New strategies are needed to accomplish the complementary goals of potent viral suppression and meaningful immunologic reconstitution. Cimetidine and ranitidine, both histamine H2-receptor antagonists, can increase the cell-mediated cytotoxicity and lymphocyte proliferative responses of human lymphocytes in vitro and in vivo [7]. The spectrum of their activities includes inhibition of the regulatory functions of T suppressor cells [8], enhancement of delayed-type hypersensitivity (DTH) responses [9, 10], and increases in NK cell activity in patients with B cell chronic lymphocytic leukemia [11]. These observations suggest that H2 antagonists may offer important immunomodulatory effects for therapeutic uses. Three trials have evaluated the use of cimetidine and ranitidine in the treatment of HIV-infected subjects [12 – 14]. The first, an uncontrolled trial of cimetidine, suggested improved