Hsa-miR-11181 regulates Wnt signaling pathway ...

Download PDF
2 downloads 0 Views 597KB Size Report
Comment
Oct 27, 2017 - intended to investigate hsa-miR-11181 (a novel miRNA located in TrkC gene) effect on Wnt signaling pathway in. SW480 cell ... One family of growth factors that is important for cellular differ- entiation .... Transfection and overexpression of hsa-mir-11181 precursor ..... Curr. Cancer Drug Targets 4, 653–671.
Gene 641 (2018) 297–302

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Research paper

Hsa-miR-11181 regulates Wnt signaling pathway through targeting of APC2 transcripts in SW480 cell line

MARK

Sadat Dokanehiifard, Bahram M. Soltani⁎ Department of Molecular Genetics, Faculty of Biological Sciences, Tarbiat Modares University, Tehran, Iran

A R T I C L E I N F O

A B S T R A C T

Keywords: hsa-miR-11181 Wnt signaling pathway APC1 APC2 Axin1

Wnt signaling plays important roles in differentiation, morphogenesis and development. This signaling pathway is highly regulated at all levels and microRNAs are small noncoding RNAs regulating Wnt signaling. Here, we intended to investigate hsa-miR-11181 (a novel miRNA located in TrkC gene) effect on Wnt signaling pathway in SW480 cell line. TOP/FOP flash assay indicated up-regulation of Wnt signaling, following the overexpression of hsa-miR-11181, verified through RT-qPCR. Bioinformatics analysis predicted APC1, APC2 and Axin1 might be targeted by hsa-miR-11181. Then, RT-qPCR analysis indicated that APC2 and Axin1 have been significantly down-regulated following the hsa-miR-11181 overexpression. However dual luciferase assay analysis supported only APC2 3′-UTR is directly targeted by this miRNA. Then, treatment of SW480 cells with Wnt-inhibitory small molecules supported the effect of hsa-miR-11181 at the inhibitory complex level containing APC2 protein. Consistently, viability of SW480 cells overexpressing hsa-miR-11181 was significantly elevated, measured through MTT assay. Overall, these results suggest that hsa-miR-11181 may play a crucial role in Wnt signaling regulation and confirmed that APC2 3′-UTR is targeted by hsa-miR-11181 and propose the presence of its recognition sites in the promoter or coding regions of Axin1 gene.

1. Introduction Dis-regulation of intracellular signal transduction can lead to particular diseases in the adult and developmental defects during embryogenesis. Knowledge of growth factor signaling during differentiation will allow for improvement of targeted differentiation of embryonic or adult stem cells (Rao and Kühl, 2010). One family of growth factors that is important for cellular differentiation, tissue morphogenesis, and tissue homeostasis is given by the Wnt proteins. Wnts by interaction with Fz receptor have particularly important functions in aging, stem cell biology, angiogenesis, cardiac development and differentiation, and also cardiac failure and hypertrophy (McKoy et al., 2000; Garcia-Gras et al., 2006; Tzahor, 2007; Rao and Kühl, 2010). The major signaling branches downstream of the Fz receptor in Wnt signaling, are a non-canonical (or β-catenin independent pathway) and a canonical (or Wnt/β-catenin dependent pathway) pathway (Mao et al., 2001). In the canonical pathway, following the Wnt stimulation, a signaling triggers translocation of a protein complex containing Axin and Dsh to the cell membrane. This complex induces the stabilization of

β-catenin. Β-catenin then translocate into the nucleus where it complexes with TCF/LEF family members and mediate induction of target genes transcription. However, in the absence of Wnt ligand, an inhibitory complex including APC, Axin, CK1, GSK3-β, and β-catenin induce Wnt signaling down-regulation following β-catenin degradation by the proteosomal machinery (Mao et al., 2001; He et al., 2004; Gordon and Nusse, 2006). Wnt signaling pathway is well studied however, many of the molecular mechanisms that regulate the pathway are poorly understood (Kunttas-Tatli et al., 2012). Here, we introduce hsa-miR-11181, a newly discovered miRNA (Dokanehiifard et al., 2015), as a regulator of intracellular Wnt-mediated signaling network. This miRNA was predicted to target over 700 mRNAs in the cell. In between, the genes which are involved in Wnt signaling, had a high score to be targeted by this miRNA. In particular, we provide evidences that this miRNA downregulates APC2 and consequently up-regulates the Wnt signaling pathway.

Abbreviations: Wnt, wingless-type; APC, adenomatosis polyposis coli; Axin, axis inhibition protein; FZ, frizzled; LEF, lymphoid enhancer binding factor; TCF, T-cell-specific factor; GSK3β, glycogen synthase kinase 3-beta; TRE, transcriptional response element; Dsh, dishevelled; luc, luciferase; TK, thymidine kinase; GAPDH, glyceraldehyde-3phosphate dehydrogenase; MFE, minimum free energy; MRE, miRNA recognition site; c-myc, myelocytomatosis ⁎ Corresponding author. E-mail address: [email protected] (B.M. Soltani). http://dx.doi.org/10.1016/j.gene.2017.10.075 Received 12 June 2017; Received in revised form 28 September 2017; Accepted 26 October 2017 Available online 27 October 2017 0378-1119/ © 2017 Published by Elsevier B.V.

Gene 641 (2018) 297–302

S. Dokanehiifard, B.M. Soltani

2. Material and methods

24 h post transfection, GFP microscopy (by Nikon eclipse Te2000-s) ensured successful transfection.

2.1. Bioinformatics analysis 2.7. RNA extraction and cDNA synthesis

The 3′-UTR sequence of the genes involved in human Wnt signaling pathway were retrieved using Entrez (http://www.ncbi.nlm.nih.gov/ Entrez/). Prediction of miRNA targets conducted using RNAHybrid (https://bibiserv2.cebitec.uni-bielefeld.de/rnahybrid) and miRmap (http://mirmap.ezlab.org/app/) online tools. These programs predict sequence complementation, minimum free energy (MFE), conservation status of the MREs, and structure of miRNA::target sites interaction. Also, Blat search by UCSC genome browser (https://genome.ucsc.edu/) was used for evaluation of microRNA recognition elements (MREs) conservation in different organisms.

Total RNA was isolated using Trizol reagent (Invitrogen Life Technologies, USA), and the RNA quality and quantity were measured using a NanoDrop ND-1000 spectrophotometer. After DNaseI treatment, target cDNA was synthesized according to the manufacture applied by Fermentas Company. 2.8. Quantitative real-time PCR To validate the initial results detected by Top/Fop flash assay and dual luciferase assay in this study, the genes involved in Wnt signaling pathway were selected for an additional RT-qPCR analysis in SW480 cell line. The RT-qPCR reactions for GAPDH and other genes were performed using a Real-time PCR System (Applied Biosystems, StepOne) under the following conditions: 95 °C for 15 min, followed by 45 PCR cycles (95 °C 15 s for stage 1, stage 2; 60 °C for 20 s and then stage 3; 72 °C for 30 s). Each sample analyzed in experimental duplicates. The relative expression level for each miRNA was calculated using the comparative cycle threshold (CT) method (2− ΔΔCT) (Livak and Schmittgen, 2001).

2.2. Cell culture SW480 and HEK293T cell lines were cultured in DMEM-HG media (Invitrogen) supplemented with 100 U/mL penicillin and 100 μg/mL streptomycin (Sigma), and with 10% fetal bovine serum (FBS) (Invitrogen), and incubated in 37 °C with 5% CO2. The cell lines were obtained from Pasteur Institute/Iran. 2.3. DNA constructs The region corresponding to hsa-miR-11181 sense and antisense sequences was PCR amplified and cloned into pEGFP-C1 expression vector (Clontech) downstream of GFP sequence, both in sense and antisense directions as previously described (Dokanehiifard et al., 2015). As scrambled control, a previously described hairpin structure sequence (Xu et al., 2009) was cloned into pEGFP-C1 vector. All recombinant vectors were sequenced for verification of correct insert. We successfully constructed an ideal vector for monitoring of the Wnt signaling pathway regulation after transfection of SW480 cells with vector containing hsa-miR-11181. Further construct was the inclusion of chimeric region of each of the 3′-UTR of APC2, APC1 and AxinI genes to downstream of the Renilla luciferase gene into psiCHECK2 vector for studding the direct interaction of hsa-miR-11181 with 3′-UTR of APC2, APC1 and AxinI genes by using dual luciferase assay.

2.9. MTT assay SW480 cells (8000 cells/well) were plated in 96-well plates in tetraplicate. After 24 h, they were transfected by interested constructs engulfed with lipofectamine 2000. 20 μL of 5 mg/mL MTT (Sigma) was added to each well at 2 days and also 5 days' time points post-transfection, followed by further culture for 4 h in 37 °C with 5% CO2 incubator, after which the culture medium was discarded and 100 μL DMSO (Sigma) was added to each well. After the crystals dissolved, OD570 was measured with an ELISA Microplate Reader (Biotek). The formula: rate of growth in here studied cells = (average OD490 in test groups / average OD490 in control groups). 2.10. Small molecules treatment

2.4. Dual luciferase assay analysis For IWP-2, PNU-74654 and XAV-932 binding studies in order to Wnt signaling inhibition and also study of co-treatment of cells with small molecules and interested constructs, SW480 cells were seeded in 48 well plates, and 30 h after it treated with these small molecules in concentrations 5, 6 and 5 μM, respectively. Eighteen hours after drug treatment, the cells were co-transfected with TOP construct separately with mock, scrambled or hsa-mir-11181 vectors. Drug treatment was continued to 48 h after transfection. Then the cells were lysed and used for TOP/Flash assay analysis.

3′-UTRs of APC2, APC1 and AxinI were cloned in psiCHECK2 vector downstream of luciferase gene for dual luciferase assay analysis in HEK293T cell line, according to the manufacture's instruction (using Promega kit). 2.5. Top/Fop flash assay Top/Fop flash assay was used for Wnt signaling pathway activity analysis and to this aim, the TCF/LEF-responsive luciferase construct was made under the control of minimal TK promoter and tandem repeats of the TCF/LEF transcriptional response element (TRE) in pGL4.14 [luc2/Hygromycin] vector (Promega, Madison, WI). The cells were plated in 48-well plates and transfected with 400 ng miRNA-encoding vector and with 200 ng of luciferase-encoding vector. The cells were harvested 48 h post-transfection, and luciferase activity was measured by using the luciferase assay kit (Promega). All vectors were sequenced to verify the presence of correct insert.

2.11. Primer designing Related primers (Table 1) were designed using IDT oligo analyzer (https://www.idtdna.com/analyzer/Applications/OligoAnalyzer/), NCBI Primer-blast (http://www.ncbi.nlm.nih.gov/tools/primer-blast/), and MWG online PCR primer design tools. 2.12. Statistical analysis

2.6. Transfection and overexpression of hsa-mir-11181 precursor Using DataAssist software V3.0, RT-qPCR data were analyzed. Other statistical analysis was performed with GraphPad Prism 5.04 (GraphPad, San Diego, CA) by using t-test and one way ANOVA analysis.

The pEGFP-C1 expression vector containing hsa-mir-11181 precursor was engulfed in lipofectamin 2000 (Invitrogen) and used for transfection of SW480 and HEK293T cell lines, 24 h after cell seeding. 298

Gene 641 (2018) 297–302

S. Dokanehiifard, B.M. Soltani

3.2. Hsa-miR-11181 overexpression effect on Wnt signaling pathway

Table 1 Primer and oligo sequences that were used in the study. Primer name

Primer sequence, 5′ to 3′

Amplicon size (base pairs)

c-Myc-real time B-cat-real time APC2-real time APC1-real time Axin1-real time GAPDH

Forward: CTCCTACGTTGCGGTCACAC Reverse: CGGGTCGCAGATGAAACTCT Forward: AGAACAGAGCCAATGGCTTG Reverse: CCTGGCCATATCCACCAGAG Forward: TCCCAGCTCCCTGCCTCTGT Reverse: AGCCAGCCAGACCCAAGTTCT F: TATTACGGAATGTGTCCAGCTTG R: CCACATGCATTACTGACTATTGTC Forward: ATGCAGGAGAGCGTGCAGGTC Reverse: TGACGATGGATCGCCGTCCTC Forward: GCCACATCGCTCAGACAC Reverse: GGCAACAATATCCACTTTACCAG Forward: AAGGTGGACTGATAGGCTGGT Reverse: AGAAGACACACCACAGCCAGG Forward: GGGCGAAGCCTGTAATCACTGC Reverse: GAGTCGGACAGCTGACGGTG Forward: TGGAACCCAAAGTCCTAAGC Reverse: CTGGGAAAACAACAGAAGTAG

142

Axin1-3′UTR APC2-3′UTR APC1-3′UTR

RT-qPCR analysis indicated that expression levels of hsa-miR-111815p and -3p in SW480 (grade III colorectal cancer) cells were higher than HCT116 (grade II colorectal cancer) and HT29 (grade I colorectal cancer) cells (Fig. 2A). Then, successful transfection of recombinant vector overexpressing hsa-miR-11181 and GFP (Fig. 2B) in SW480 cells, resulted in upregulation of Wnt signaling pathway detected through TOP flash assay (Fig. 2C) and confirmed through RT-qPCR against downstream genes of this pathway (Fig. 2D). RT-qPCR results indicated that following the hsa-miR-11181 overexpression, c-Myc has been significantly upregulated while, APC2 and Axin1 have been downregulated, compared to the mock (empty vector) control. Meanwhile, the expression alteration for APC1 and B-catenin has not been significant (Fig. 2D). SW480 cells were also treated with PNU-74654, IWP-2 and XAV932 small molecules to inhibit Wnt signaling at different steps of the pathway via inhibiting of β-catenin and TCF interaction, LRP inhibition and increasing AxinI expression, respectively. Then, these cells were cotransfected with pGL4-TOP and hsa-miR-11181 overexpressing vectors and result were compared to the situation that pGL4-TOP was cotransfected with scrambled or mock constructs. Luciferase activity in SW480-TOP cells which were treated with PNU-74654 and IWP-2 was significantly increased when hsa-miR-11181 was overexpressed compared to the mock and scrambled negative vectors (P < 0.05). However, the result was not significant in the cells treated with XAV932 (Fig. 2E).

130 129 133 237 115 715 2515 2140

3. Results 3.1. Prediction of hsa-miR-11181 target genes which are involved in Wnt signaling In order to find Wnt signaling pathway critical genes which are targeted by hsa-miR-11181, RNAHybrid and miRmap software were applied. These tools predicted highly conserved miRNA recognition elements (MREs) in APC2 as a bona fide target of hsa-miR-11181 (Fig. 1A). One of these MREs (for hsa-miR-11181-5p) had MFE: − 32.1 kcal/mol and the other one (for hsa-miR-11181-3p) had MFE: − 28.5 kcal/mol. These software, also predicted APC1 (Fig. 1B) and Axin1 (Fig. 1C) as target genes for hsa-miR-11181 with lower scores (MFE: − 22 kcal/mol and MFE: − 25 kcal/mol), respectively. Other Wnt signaling pathway genes were not predicted as target of hsa-miR11181.

3.3. Direct interaction of hsa-miR-11181 with APC2 3′-UTR sequence PEGFP-C1 vector overexpressing hsa-miR-11181 and psiCHECK2 vector containing 3′-UTR sequences of APC2, APC1 or AxinI fused to the Renilla luciferase, were introduced to HEK293T cell line, in order to perform dual luciferase assay. Renilla luciferase activity of HEK293T cells co-transfected with hsa-miR-11181 precursor and APC2 3′-UTR was significantly lowers (P < 0.05) than negative control cells cotransfected with mock and scrambled controls along with APC2 3′-UTR (Fig. 3A). However, no significant alteration of luciferase activity was detected when APC1 (Fig. 3B) and AxinI (Fig. 3C) 3′-UTRs were used in this assay.

Fig. 1. Hsa-miR-11181::target sequences interactions predicted by RNAHybrid software. Pairing status of hsa-miR-11181-5p and hsa-miR-11181-3p with their predicted target sequences in APC2 (A), APC1 (B) and Axin1 (C) transcripts are illustrated. MiRNA sequences are shown in red, and the predicted MREs in the 3′-UTR sequences of target genes are shown in black. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

299

Gene 641 (2018) 297–302

S. Dokanehiifard, B.M. Soltani

Fig. 2. Evidences for the involvement of hsa-miR-11181 in Wnt signaling pathway. A) Endogenous expression of hsa-miR-11181 in HT29, HCT116, SW480 (colorectal cancer originated) cell lines. Data shows higher expression of this miRNA in SW480 cells originated from higher grads of colorectal cancer tissues. B) GFP expression status of transfected cells implicates successful transfection of recombinant vector carrying hsa-miR-11181 precursor. C) Shows, Wnt signaling upregulation following hsa-miR-11181 overexpression SW480 cells were co-transfected with FOP- or TOP-flash vectors along with hsa-miR-11181 precursor overexpressing vector or empty (mock) and scrambled vectors, and relative luciferase activity (RLU: relative light units) was measured. Luciferase activity has been significantly increased in the cells overexpressing hsa-miR-11181 precursor compared to the negative control cells. Error bars indicate SD of triplicate repeats, *P < 0.05. D) RT-qPCR analysis of hsa-miR-11181 overexpression effect on different genes of Wnt signaling pathway. The expression level of the c-Myc gene was elevated, and APC2 and AxinI expression were significantly decreased following hsa-miR-11181 overexpression in SW480 cells. However, APC1 and B-Catenin expression levels were not significantly changed. E) Co-treatment effect of Wnt inhibitory small molecules and hsa-miR-11181, is shown through TOPflash assay in SW480 cell line. While, Wnt signaling has been down-regulated following the PNU-74654 and IWP-2 small molecules application, this downregulation has been attenuated when hsa-miR-11181 has been overexpressed, compared to the mock and scrambled negative controls. When the cells were treated with XAV-932 small molecule, significant Wnt signaling alteration was not detected with or without hsa-miR-11181 overexpression. Error bars indicate SD of three experiments, *P < 0.05.

significant survival rate elevation was observed (Fig. 4).

3.4. Survival effect of hsa-miR-11181 in SW480 cells Overexpression of hsa-miR-11181 in SW480 cells resulted in no significant survival rate alteration of transfected cells two days post transfection, detected by MTT assay and crystal violet staining. However, in the cells which were harvested 5 days after transfection, a

4. Discussion Although the Wnt signaling pathway is well known (Luu et al., 2004; Gordon and Nusse, 2006; Liu et al., 2007; Tzahor, 2007), 300

Gene 641 (2018) 297–302

S. Dokanehiifard, B.M. Soltani

Fig. 3. Dual luciferase analysis of hsa-miR-11181 direct interaction with 3′-UTR sequences of APC1, APC2 and AxinI genes. A) Compared to the mock and scrambled controls, lower luciferase activity of hsa-miR-11181 overexpressing cells, supported direct interaction of hsa-miR-11181 with APC2 3′-UTR sequence. B) & C) These sections do not support direct interaction of hsa-miR-11181 with APC1 or AxinI 3′-UTR sequences, respectively. All assays were performed 48 h post-transfection and Luciferase activity was normalized to Renilla activity; *P < 0.05.

Fig. 4. Cell survival analysis for the cells overexpressing hsa-miR-11181. A) Represents MTT analysis 2 days after transfection of SW480 cells in which hsa-miR-11181 has been overexpressed or downregulated. No significant alteration was detected in these cells. B) Represents MTT analysis 5 days after transfection of SW480 cells in which hsa-miR-11181 has been overexpressed or downregulated. Significant increased viability was detected in these cells, compared to the related controls. Error bars indicate SD of duplicated experiments. C) Represents crystal violet assay against SW480 cells under hsa-miR-11181 expression alteration. No significant cell survival alteration was calculated, 2 days post transfection.

c-Myc oncogene expression level was increased in the same cells, showing Wnt signaling has been induced (Fig. 2D). Wnt signaling was manipulated using small molecules and contemporary, hsa-miR-11181 was overexpressed in these cells, and activity of the pathway was measured through Top flash assay system. In the cells treated with IWP-2 which blocks Wnt signaling via inhibition of LRP receptor (Chen et al., 2009), hsa-miR-11181 overexpression resulted in Wnt signaling upregulation compared to the related controls (Fig. 2E). Therefore, hsa-miR-11181 has caused activation of Wnt signaling somewhere downstream of LRP receptor. On the other hand PNU-74654 blocks Wnt signaling via inhibition of β-catenin and TCF transcription factor interaction (Demilly et al., 2013; Kahn, 2014; Dokanehiifard et al., 2017; Najafi et al., 2017). Since, hsa-miR-11181 overexpression resulted in a significant upregulation of Wnt signaling in the cells treated with PNU-74654, it is concluded that hsa-miR-11181 may also activate this pathway somewhere downstream to β-catenin and TCF interaction level, as well. RT-qPCR indicated APC2 and Axin1 downregulation following hsa-miR-11181 overexpression (Fig. 2D) and dual luciferase assay suggested that hsa-miR-11181 induces Wnt signaling through the interaction with APC2 3′-UTR sequence (Fig. 3A). However, dual luciferase assay result indicated that 3′-UTR of Axin1 transcript was not directly targeted by hsa-miR-1118 (Fig. 3C). These

molecular mechanisms that regulate this signaling pathway are still poorly understood (Kunttas-Tatli et al., 2012). Therefore, finding a new modulator that is capable of regulating this pathway is beneficial. Wnt/ β-catenin signaling plays an important role in SW480 cell proliferation (Luu et al., 2004; Herbst et al., 2014). Therefore, SW480 is a proper cell line for monitoring Wnt signaling activity alteration (Chen et al., 2009) following the application of potential regulators of this pathway. On the other hand, the TOP/flash assay reports overall activity of the Wnt signaling (Molenaar et al., 1996), regardless of the status of individual components of this pathway. We have recently introduced hsa-miR11181 which affects TGFb signaling pathway through targeting TGFbR1 transcripts (Dokanehiifard et al., 2015). Also, hsa-miR-11181 overexpression increased survival rate in the neural origin U87 cell line while resulted in apoptosis induction in HEK293T cells (Dokanehiifard et al., 2015). Recognition site for hsa-miR-11181 on some of the Wnt signaling pathway components were predicted (Fig. 1). Also, pathway analysis online tools predicted Wnt signaling as one of the main pathways to be targeted by this miRNA. Accordingly, here we examined hsamiR-11181 overexpression effect on Wnt signaling activity using Top/ flash assay (Fig. 2C). Consistently, RT-qPCR analysis against the genes which are involved in canonical Wnt signaling pathway indicated the reduction of APC2 and Axin1 tumor suppressor genes expression. Also, 301

Gene 641 (2018) 297–302

S. Dokanehiifard, B.M. Soltani

Mol. Vis. 21, 1024. Chen, J.-s., Liang, Q.-m., Li, H.-s., Yang, J., Wang, S., Long, J.-w., 2009. Octreotide inhibits growth of colonic cancer SW480 cells by modulating the Wnt/β-catenin pathway. Pharmazie 64, 126–131. Demilly, A., Steinmetz, P., Gazave, E., Marchand, L., Vervoort, M., 2013. Involvement of the Wnt/β-catenin pathway in neurectoderm architecture in Platynereis dumerilii. Nat. Commun. 4, 1915. Dokanehiifard, S., Soltani, B.M., Parsi, S., Hosseini, F., Javan, M., Mowla, S.J., 2015. Experimental verification of a conserved intronic microRNA located in the human TrkC gene with a cell type-dependent apoptotic function. Cell. Mol. Life Sci. 1–13. Dokanehiifard, S., Yasari, A., Najafi, H., Jafarzadeh, M., Nikkhah, M., Mowla, S.J., Soltani, B.M., 2017. A novel microRNA located in TrkC gene regulates Wnt signaling pathway and is differentially expressed in colorectal cancer specimens. J. Biol. Chem. http://www.jbc.org/content/early/2017/01/18/jbc.M116.760710. Garcia-Gras, E., Lombardi, R., Giocondo, M.J., Willerson, J.T., Schneider, M.D., Khoury, D.S., Marian, A.J., 2006. Suppression of canonical Wnt/β-catenin signaling by nuclear plakoglobin recapitulates phenotype of arrhythmogenic right ventricular cardiomyopathy. J. Clin. Investig. 116, 2012. Gordon, M.D., Nusse, R., 2006. Wnt signaling: multiple pathways, multiple receptors, and multiple transcription factors. J. Biol. Chem. 281, 22429–22433. He, X., Semenov, M., Tamai, K., Zeng, X., 2004. LDL receptor-related proteins 5 and 6 in Wnt/β-catenin signaling: arrows point the way. Development 131, 1663–1677. Herbst, A., Jurinovic, V., Krebs, S., Thieme, S.E., Blum, H., Göke, B., Kolligs, F.T., 2014. Comprehensive analysis of β-catenin target genes in colorectal carcinoma cell lines with deregulated Wnt/β-catenin signaling. BMC Genomics 15, 74. Kahn, M., 2014. Can we safely target the WNT pathway? Nat. Rev. Drug Discov. 13, 513–532. Korswagen, H.C., 2002. Canonical and non-canonical Wnt signaling pathways in Caenorhabditis elegans: variations on a common signaling theme. BioEssays 24, 801–810. Kunttas-Tatli, E., Zhou, M.-N., Zimmerman, S., Molinar, O., Zhouzheng, F., Carter, K., Kapur, M., Cheatle, A., Decal, R., McCartney, B.M., 2012. Destruction complex function in the Wnt signaling pathway of Drosophila requires multiple interactions between Adenomatous polyposis coli 2 and Armadillo. Genetics 190, 1059–1075. Liu, H., Fergusson, M.M., Castilho, R.M., Liu, J., Cao, L., Chen, J., Malide, D., Rovira, I.I., Schimel, D., Kuo, C.J., 2007. Augmented Wnt signaling in a mammalian model of accelerated aging. Science 317, 803–806. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2− ΔΔCT method. Methods 25, 402–408. Luu, H.H., Zhang, R., Haydon, R.C., Rayburn, E., Kang, Q., Si, W., Park, J.K., Wang, H., Peng, Y., Jiang, W., 2004. Wnt/β-catenin signaling pathway as novel cancer drug targets. Curr. Cancer Drug Targets 4, 653–671. Mao, J., Wang, J., Liu, B., Pan, W., Farr, G.H., Flynn, C., Yuan, H., Takada, S., Kimelman, D., Li, L., 2001. Low-density lipoprotein receptor-related protein-5 binds to Axin and regulates the canonical Wnt signaling pathway. Mol. Cell 7, 801–809. McKoy, G., Protonotarios, N., Crosby, A., Tsatsopoulou, A., Anastasakis, A., Coonar, A., Norman, M., Baboonian, C., Jeffery, S., McKenna, W.J., 2000. Identification of a deletion in plakoglobin in arrhythmogenic right ventricular cardiomyopathy with palmoplantar keratoderma and woolly hair (Naxos disease). Lancet 355, 2119–2124. Molenaar, M., van de Wetering, M., Oosterwegel, M., Peterson-Maduro, J., Godsave, S., Korinek, V., Roose, J., Destrée, O., Clevers, H., 1996. XTcf-3 transcription factor mediates β-catenin-induced axis formation in Xenopus embryos. Cell 86, 391–399. Najafi, H., Soltani, B.M., Dokanehiifard, S., Nasiri, S., Mowla, S.J., 2017. Alternative splicing of the OCC-1 gene generates three splice variants and a novel exonic microRNA, which regulate the Wnt signaling pathway. RNA 23, 70–85. Rao, T.P., Kühl, M., 2010. An updated overview on Wnt signaling pathways a prelude for more. Circ. Res. 106, 1798–1806. Tzahor, E., 2007. Wnt/β-catenin signaling and cardiogenesis: timing does matter. Dev. Cell 13, 10–13. Xu, N., Papagiannakopoulos, T., Pan, G., Thomson, J.A., Kosik, K.S., 2009. MicroRNA-145 regulates OCT4, SOX2, and KLF4 and represses pluripotency in human embryonic stem cells. Cell 137, 647–658. Xu, W., San Lucas, A., Wang, Z., Liu, Y., 2014. Identifying microRNA targets in different gene regions. BMC Bioinf. 15, S4.

result suggest that hsa-miR-11181 directly targets APC2 transcript at 3′UTR sequence while interacts with other Axin1 regions such as its promoter and coding region (Xu et al., 2014). It is also remained to be examined if hsa-miR-11181 could affect Wnt signaling pathway via noncanonical pathway (independent Wnt/B-catenin) (Korswagen, 2002). When, Wnt signaling was downregulated in SW480 cells using XAV-932 small molecule that induces AxinI induction (Bao et al., 2012; Cammarata et al., 2015), downregulation of APC2 and AxinI gene through hsa-miR-11181 overexpression (Fig. 2D) did not significantly alter the Wnt activity in these cells (Fig. 2E). That might be due to the opposite effect of hsa-miR-11181 and XAV-932 against AxinI transcript and protein, respectively. Once again this experiment emphasizes on the effect of hsa-miR-11181 on the Wnt signaling at the inhibitory complex components (APC2 and AxinI) level. Induction of Wnt signaling following the overexpression of hsa-miR-11181 (Fig. 2) suggested it as an inducer of Wnt signaling consistent to its oncogenic effect in colorectal cancer specimens. It remains to be tested if this miRNA is overexpressed in tumor samples. Overexpression of hsa-miR-11181 in SW480 cells was not significantly elevated the proliferation rate of these treated cells 2 days after transfection. However, when MTT assay was measured 5 days post transfection, a significant elevation in cell survival rate was observed that might be attributed to the normal low growth of these cells (Fig. 4). 4.1. Conclusion In conclusion our study suggests that hsa-miR-11181 is one of the modulators of Wnt signaling pathway and also is a potent agonist of Wnt signaling. Acknowledgements The authors thank Mr. Hadi Najafi and Mr. Ali Fasihi for their kind advice. This work was supported by Iran National Science Foundation (INSF) (95/47014) and Tarbiat Modares University financial aids Conflict of interest The authors declare that there are no conflicts of interest with any financial organization regarding the material discussed in the manuscript. References Bao, R., Christova, T., Song, S., Angers, S., Yan, X., Attisano, L., 2012. Inhibition of tankyrases induces Axin stabilization and blocks Wnt signalling in breast cancer cells. PLoS One 7, e48670. Cammarata, P.R., Neelam, S., Brooks, M.M., 2015. Inhibition of hypoxia inducible factor1α downregulates the expression of epithelial to mesenchymal transition early marker proteins without undermining cell survival in hypoxic lens epithelial cells.

302