human immunodeficiency virus type 1

2 downloads 20 Views 1MB Size Report
ROBERTO PATARCA*, JOEL SCHWARTZ*, RAJESH P. SINGH*, QuI-TONG KONG*, ELIZABETH MURPHY*,. YVONNE ANDERSON*, FENG-YI WEI SHENG*, ...

Proc. Nati. Acad. Sci. USA Vol. 85, pp. 2733-2737, April 1988

Immunology

rpt-1, an intracellular protein from helper/inducer T cells that regulates gene expression of interleukin 2 receptor and human immunodeficiency virus type 1 (T-cell activation/acquired immunodeficiency syndrome/mouse lymphocytes)

ROBERTO PATARCA*, JOEL SCHWARTZ*, RAJESH P. SINGH*, QuI-TONG KONG*, ELIZABETH MURPHY*, YVONNE ANDERSON*, FENG-YI WEI SHENG*, PRATIMA SINGH*, KAREN A. JOHNSON*, SHEILA M. GUARNAGIA*, TIMOTHY DURFEEt, FRED BLATTNERt, AND HARVEY CANTOR* *Laboratory of Immunopathology, Dana-Farber Cancer Institute, Department of Pathology, Harvard Medical School, Boston, MA; and tUniversity of Wisconsin, Madison, WI

Communicated by Frank Lilly, December 9, 1987

simian virus 40 (SV40)-transformed monkey kidney epithelial cell line (12). Production of a T-Cell Probe. Poly(A)+ RNA from L cells (a fibroblast tumor) and from 2PK3 (a B-cell lymphoma) was prepared and hybridized to 32P-labeled cDNA obtained from Cl.Lyl-T1 cells (22 hr after activation) as described (13, 14). The remaining single-stranded cDNA, purified by hydroxyapatite chromatography, was hybridized with poly(A) + RNA from MOPC 315 (a B-cell myeloma) and the singlestranded fraction was again isolated by hydroxyapatite chro-

ABSTRACT The Rpt-1 (for regulatory protein, T-lymphocyte, 1) gene, selectively expressed by resting but not by activated CD4+ inducer T cells, encodes an intracellular protein (rpt-1, Mr 41,000) that down-regulates gene expression directed by the promoter region of the gene encoding interleukin 2 receptor a chain and by the long terminal repeat of human immunodeficiency virus type 1. The data reported here suggest that rpt-1 levels may be inversely correlated with activation of CD4 + T cells and human immunodeficiency virus replication leading to clinical symptoms of the acquired immunodeficiency syndrome.

matography. Construction of a T-Celi cDNA Library. Poly(A)+ RNA from Cl.Lyl-T1 (22 hr after activation) was used to prepare a cDNA library of 3.8 x 105 independent clones in the pcD vector (12, 15). Approximately 11,300 colonies from a sizeselected [0.5- to 20-kilobase (kb)] cDNA-insert sublibrary (19) were sparsely plated on nitrocellulose and then probed with the T-cell-specific probe described above (16). Positively hybridizing colonies were picked for further analysis. Nucleic Acid Blot Hybridization and Protein Immunoblotting. RNA slot and gel blots and DNA (Southern) blots were prepared as described (15, 17). Extracts of 107-10' mouse spleen cells were analyzed by electrophoresis and immunoblotting as described (18). Plasmids. pcD-rptl was obtained from the T-cell cDNA sublibrary. pcD-rptlfs is a frameshift mutant obtained by digesting pcD-rptl with the restriction enzyme BstEII, bluntending the restriction fragments with bacteriophage T4 polynucleotide kinase, and religating. pSV2cat contains the SV40 enhancer/promoter region upstream of the bacterial chloramphenicol acetyltransferase (CAT) gene (20). The plasmid IL2RpCAT, containing the human IL-2Ra promoter region upstream of CAT was kindly provided by W. Leonard (21). The plasmid pLTR-1CAT, containing the U3 and R regions of the HIV-1 LTR (nucleotides -463 to +80) (6, 22), and pSV7fdtat, an expression vector for the tat-encoded protein of HIV-1 (6, 22), were kindly provided by P. Luciw. Transfection and CAT Assays. Adherent cells (106 per transfection) and cells grown in suspension (107 per transfection) were transfected by the DEAE-dextran technique (23). CAT assays were performed 48 hr after transfection (20). Experiments were done in the linear range of the assay

Analysis of cellular and viral proteins produced by clones of inducer, cytotoxic, and suppressor T lymphocytes has shown that each T-cell subset is genetically programmed to specify particular patterns of protein synthesis before and after activation by antigen (1-3). For instance, the levels of expression of human immunodeficiency virus type 1 (HIV1), the retrovirus associated with the acquired immunodeficiency syndrome, are markedly increased upon activation of inducer T cells (3-6). Insight into the molecular basis of cellular and retroviral gene expression requires a description of the intracellular proteins that regulate genes expressed in resting and activated T cells (e.g., ref. 5). The studies reported here define a recombinant intracellular product, termed rpt-1,f that is selectively expressed by resting inducer T cells and affects gene expression directed by the long terminal repeat (LTR) promoter region of HIV-1 or by the promoter region of the gene encoding the a chain of the interleukin 2 receptor (IL-2Ra).

MATERIALS AND METHODS Cells. All cells were of murine origin unless otherwise indicated. Cl.Lyl-T1 and CI.Lyl-N5 are helper/inducer T-cell clones (7, 8), Cl.NK-11 is a natural killer cell clone (9), and Cl.Ly23.4 is a suppressor T-cell clone (10). Ar-5 is an arsonate-reactive helper/inducer T-cell clone (11). Ar-5v is a variant of Ar-5 that constitutively expresses high levels of IL-2Ra. Ar-5v, but not Ar-5, is activated by recombinant IL-2 (Genzyme, Norwalk, CT) in the absence of antigen, and this activation is completely blocked by anti-IL-2R monoclonal antibody AMT-13 (Boehringer Mannheim). Ar-5v does not produce detectable levels of IL-2 unless activated by IL-2 or antigen and I-Ad macrophages. Jurkat (5) and EL-4 are human and murine T-cell lines, and COS-7m6 is a

Abbreviations: CAT, chloramphenicol acetyltransferase; HIV-1, human immunodeficiency virus type 1; IL-2, interleukin 2; IL-2Ra, a chain (p55/Tac) of the IL-2 receptor; LTR, long terminal repeat; SV40, simian virus 40. tThe rpt-1 sequence reported in this paper has been deposited in the EMBL/GenBank data base (Bolt, Beranek, and Newman Laboratories, Cambridge, MA, and Eur. Mol. Biol. Lab., Heidelberg) (accession no. J03776).

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

2733

-~

Proc. Natl. Acad. Sci. USA 85 (1988)

Immunology: Patarca et al.

2734

C B FIG. 1. (A) Expression of Rpt-J in lymphocyte clones. Five A rpt -1 micrograms of poly(A) + RNA from each cell type was analyzed by a b a b C d e f g h electrophoresis in a 1.5% agarose gel, transferred to nitrocellulose, 0 4 8 12 16 20 24 and hybridized with a 2P-labeled probe prepared by nick-translation of the 3.7-kb cDNA insert of pcD-rptl. Cell types were as follows: MOPC 315, a murine myeloma (lane a); Cl.NK1.1, a Thy-i+ natural killer cell clone (lane b); Cl.Ly23.4, a suppressor T-cell clone with _ (lane c) or without (lane d) Con A; Cl.Lyl-T1, a helper T-cell clone without (lane e) or with (lane f) Con A; and Cl.Lyl-N5, a helper was T-cell clone without (lane g) or with (lane h) Con A. RNAhelpe IF I obtained 15 hr after activation with Con A at 5 ,ug/ml. When normalized against actin mRNA, the intensity of the radioactive 0 4 8 12 16 2024 signal in lanes f and h is -50% of that in lanes e and g, respectively. Size markers at left correspond to 6000, 1765, 1426, and 920 bases. 3 (B) Expression of Rpt-1 in heterogeneous lymphocyte populations. _ Five micrograms of poly(A)+ RNA from splenocytes (lane a) or thymocytes (lane b) was hybridized with the Rpt-1 insert as described above. (C) Time course of Rpt-1 expression upon activation of the T-cell clone Cl.Lyl-T1. Five micrograms of total RNA was obtained from Cl.Lyl-T1 at the indicated times (hours) after stimulation by antigen (trinitrophenylated bovine gamma globulin) and splenic adherent cells (7-10). After electrophoresis and transfer, blots were hybridized with a nick-translated probe corresponding to the 5' 1.3-kb Rsa I-Xba I fragment (coding region) of Rpt-I (Upper) or to the coding region of y-interferon (Lower).

and 6). Where indicated, cells were visualized by a fluorescence photomicroscope (Olympus IMT2) with barrier filters of 420-490 nm for fluorescein and 500-590 nm for rhodamine.

and were repeated 3-5 times with different batches of purified DNA. Immunofluorescence. To detect rpt-1, cells were placed on coverslips and incubated consecutively with glutaraldehyde (0.5%; 30 sec), the IgG fraction of a rabbit anti-Lys-Lys-GluLys-Lys-Glu (anti-KKEKKE) antiserum (1:200 final dilution; 4°C, 40 min), and a rhodamine-conjugated goat antirabbit IgG (1:100; Cooper Biomedicals, Malvern, PA). To detect cell surface antigens, Thy-1 + and Ig+ spleen cells (2, 8, 10) were incubated with either AMT-13, L3T4, or Ly-2 monoclonal antibodies (Becton Dickinson), washed thrice, and incubated with fluorescein isothiocyanate-conjugated goat anti-rat IgG (1:200; Cooper Biomedicals). For each cell population analyzed by flow cytofluorimetry with the fluorescence-activated cell sorter (FACS), the intensity of fluorescence is presented on a base-10 logarithmic scale (Figs. 4 0

1000 =

,L4~,

L--

-a

=

=_--

-v -ab 0

:

-

250bp

27 54

80

107 134

160

187

214 240

267 294 320

347

After activation by antigen or by the T-cell mitogen concanavalin A (Con A), the T-cell clone Cl.Lyl-T1 undergoes one or two rounds of division and secretes inducer-specific proteins (1, 8). Of the 11,300 colonies from a size-selected Cl.Lyl-T1 pcD cDNA library, 230 hybridized to a cDNA probe enriched for genes expressed in T cells (see Materials and Methods). One of these inserts, termed Rpt-l (regulatory protein, T-cell), hybridized to a 3.7-kb mRNA present in helper/inducer T-cell clones (Fig. 1A, lanes e-h), but not

x-

_

I

*p

0

O.

O

3800

3000

2000 0

=

I I I

I

I

I

** polyAI

*

ORF 353 AA o.

RESULTS

'. ' : ,' ,'.'' :,I F----------

--4---

TR7-X

--

-----

RTR7- F2

--

TR7-D

CTGCAGGGGGGGGGGGGGTCTTCACAGATCCTGAGTCTCTTGGTTGGTATCTGAAGATGTGAGCCAATTTCCAACGCAGA

80

GTTTGGAGGAATTTAGAAAAAGGCACAGTCTTTGCTCTGCAGTGTGAGGAGTCAGGACAGGCAGACACAGGATCACAGCA

160

G

V

R

T

G

R

H

R

I

T

A

ACTATGGCCTCATCAGTCCTGGAGATGATAAAGGAGGAAGTAACCTGTCCTATCTGTTTGGAGCTCCTGAAGGAACCTGT A S S V L E M I K E E V T © P I © L E L L K E P V T ( GAGTGCTGATTGTAACCACAGCTTCTGCAGAGCCTGCATCACACTGAATTATGAGTCCAACAGAAACACAGACGGGAAGG S A D C N H S F ©) R A ©) I T L N Y E S N R N T D G K G GCAACTGCCCTGTATGCCGAGTTCCTTACCCATTTGGGAATCTGAGGCCTAATCTACATGTGGCCAACATAGTAGAGAGG N ) P V © R V P Y P F G N L R P N L H V A N I V E R CTCAAGGGATTCAAGTCCATTCCAGAGGAGGAGCAGAAGGTGAATATCTGTGCACAACATGGAGAGAAACTCCGGCTCTT L K G F K S I P E E E 0 K V N I C A Q H G E K L R L F CTGTAGGAAGGACATGATGGTCATCTGCTGGCTTTGTGAGCGATCTCAGGAGCACCGTGGTCACCAAACAGCTCTCATTG C R K D M H V ' C W L © E R S Q E 9 R G 9 Q T A L I E AAGAGGTTGACCAAGAATACAAGGAGAAGCTGCAGGGAGCTCTGTGGAAGCTGATGAAAAAGGCAAAAATATGTGATGAA E V D Q E Y K E K L 0 G A L W K L H K K A K I C D E TGGCAGGATGACCTTCAACTGCAGAGAGTTGACTGGGAGAACCAAATACAGATCAATGTAGAAAATGTTCAGAGACAGTT W Q D D L Q L 0 R V D W E N 0 I Q I N V E N V 0 R 0 F TAAAGGACTAAGAGACCTCCTGGACTCCAAGGAGAATGAGGAGCTGCAGAAGCTGAAGAAAGAGAAGAAAGAGGTTATGG S K E N E E L 0 K L IK K E K K E V H E K Q L R D L L D AAAAGCTGGAAGAGTCTGAAAATGAGCTGGAGGATCAGACAGAGTTGGTGAGAGACCTCATCTCAGATGTGGAACATCAT K L E E S E N E L E D 0 T E L V R D L I S D V E H H TTGGAGCTCTCAACCTTAGAAATGCTGCAGGGTGCAAATTGTGTCCTGAGAAGGAGTCAGTCCTTAAGCCTGCAACAGCC L E L S T L E H L 0 G A N C V L R R S 4 S L S L Q 0 P CCAAACTGTCCCCCAAAAGAGAAAAAGAACATTCCAAGCTCCAGATCTGAAAGGCATGCTGCAAGTGTATCAAGGACTCA Q UT V P Q K R K R Tl F 0 A P D L K G M L Q V Y 0 G L M TGGATATCCAGCAATACTGGGTGCATATGACTCTACATGCAAGGAACAATGCAGTCATTGCCATTAACAAAGAAAAAGAC D I Q Q Y W V H H T L H A R N N A V I A I N K E K D AAATACAGTATAGAAGTTACAATACGGTTCCAGTTTCTGAGATCTACCATTTGGGTGTCCTGGGATATCCAGCTCTTTCC K Y S I E V T I R F Q F L R S T I W V S W D I Q L F P TCAGGGAAGCATTACTGGGAAGTAGACATATCTAGAAGTGATGCCTGGCTCCTCGGATTAAATGACGGAAAGTGTGCTCA Q G S I T G K * ACCCCAACTTCACTCAAAGGAAGAAATGGGCATCAAAAAAAACCTTCATTCTCAGATCAAACAAAATGTATTGTTTCAGC

240

320 400

480

560 640

720 800 880 960

1040 1120

FIG. 2. Restriction map of the insert of sequence of the coding region. The sequence was determined by the method of Maxam and Gilbert (24) and was confirmed in its entirety on both strands. The restriction map includes arrows to indicate the extent and direction of sequence determined and asterisks to denote potential polyadenylylation sites. pcD-rptl and

open reading frame encoding the 353 amino acid rpt-1 protein (ORF 353 AA) is indicated. TR7-D and TR7-F2 are partial cDNA clones and TR7-X is a full-length cDNA clone. The predicted amino acid sequence is given in one-letter symbols below the nucleotide sequence. Cysteine and histidine residues that may be involved in metal-finger for-

The position of the

mation are circled. The first methionine,

1280

the predicted most hydrophilic region (amino acids 205-210), and the putative nuclear localization signal (amino acids

1360

268-276) are boxed.

Proc. Natl. Acad. Sci. USA 85 (1988)

Immunology: Patarca et A -

ulLo Co Ma) _

ma

2735

W- _ 2~cxi cuj oj N 0 N CjN~ CNJ F4 to) tq) m cx F

A~~~COS-rpt-l+

_ | - 58,000

-48,500

.WO'T§

Mean Fluorescence Intensity

- 36,500

'IW f .;

..

C C-

FIG. 3. (A) Immunoblot of mouse spleen-cell extracts. Blot was probed with a rabbit IgG (1:200 dilution) obtained after immunization with keyhole limpet hemocyanin conjugated to a synthetic peptide corresponding to the most hydrophilic portion of the rpt-1 protein (KKEKKE; see Fig. 4). Bound IgG was visualized by incubation with 1251I-labeled goat anti-rabbit antibody and autoradiography. Molecular weight markers (Sigma) correspond to Mr 58,000, 48,500, and 36,500. Background bands are nonspecific, since they also appeared in the marker lane. (B) COS-7m6 cells were transfected with 6 jig of either pcD-rptl (COS-rpt-1 +) or pcD-rptlfs (COS-rpt-lfs). The FACS profile of an aliquot of each cell population after incubation with the anti-KKEKKE antibody is shown. Slot blot analysis of RNA from both groups of COS-7m6 cells indicated equal amounts of mRNA that hybridized to the Rpt-1 probe. (C) Immunofluorescence of a COS-rpt-1 + transfectant. Predominantly nuclear fluorescence was seen in the COS-rpt-1 population. Immunofluorescence was not detectable in the COS-rpt-lfs cells.

in a suppressor T-cell clone (lanes c and d), a natural killer cell clone (lane b), or a murine myeloma cell line (lane a). Expression was not dependent on long-term growth of T-cell clones, since the Rpt-J probe hybridized to a 3.7-kb RNA from freshly explanted lymphoid cells in spleen and thymus (Fig. 1B). Resting inducer T cells (Fig. 1A, lanes e and g) showed higher levels of Rpt-1 RNA than activated inducer T cells (lanes f and h). Analysis of the time course of Rpt-1 expression during activation of Cl.Lyl-T1 showed that Rpt-1 transcription was not detectable 4-8 hr after activation (Fig. 1C Upper). Expression of other genes we have studied, including T-cell-specific genes, is either unchanged (data not shown) or, more commonly, increased after activation (Fig. 1C Lower). The complete nucleotide sequence of the full-length Rpt-1 clone cDNA insert [3700 base pairs (bp)] was determined

cc cc cc I I I

CCHH II

agarose gel, blotted onto a Zeta-Probe membrane (Bio-Rad), and was hybridized with a 32P-labeled probe prepared by nicktranslation of the 5' 1.3-kb Rsa I-Xba I fragment (coding region) of pcD-rptl. The B-strain DNA digest shows a major band at 10 kb and minor bands at 9.5, 4, 2, 1, and 0.8 kb, whereas the D strain DNA shows a major band at 9 kb and minor bands at 12, 10, and 1 kb.

(24) and found to contain an open reading frame 353 amino acids long (nucleotides 165-1226; Fig. 2), followed by a very long 3' untranslated region (2466 bp; sequence to be published elsewhere) with several potential polyadenylylation signals. The subsequence that includes the first methionine codon fits the consensus for eukaryotic translation initiation signals (25). The predicted protein (rpt-1) has a molecular weight of 41,330, is relatively neutral in charge (pI of 6.29), and includes a potential N-linked glycosylation site (amino acid 31). However, the lack of an obvious signal sequence or membrane-spanning region (26) makes it unlikely to be a membrane-bound protein. Immunoblot analysis of mouse spleen cell extracts revealed a protein of the expected molecular weight (Fig. 3A). Immunofluorescence analysis of different lymphoid lineages showed that

Suggest Documents