ISSN 00062979, Biochemistry (Moscow), 2013, Vol. 78, No. 2, pp. 204211. © Pleiades Publishing, Ltd., 2013. Published in Russian in Biokhimiya, 2013, Vol. 78, No. 2, pp. 276285.
Human Neuromodulator SLURP1: Bacterial Expression, Binding to MuscleType Nicotinic Acetylcholine Receptor, Secondary Structure, and Conformational Heterogeneity in Solution M. A. Shulepko1,2, E. N. Lyukmanova1*, A. S. Paramonov1, A. A. Lobas1, Z. O. Shenkarev1, I. E. Kasheverov1, D. A. Dolgikh1,2, V. I. Tsetlin1, A. S. Arseniev1, and M. P. Kirpichnikov1,2 1
Shemyakin and Ovchinnikov Institute of Bioorganic Chemistry, Russian Academy of Sciences, ul. MiklukhoMaklaya 16/10, 117997 Moscow, Russia; fax: (495) 3306983; Email: ekaterina
[email protected] 2 Biological Faculty, Lomonosov Moscow State University, 119991 Moscow, Russia Received September 3, 2012 Revision received October 22, 2012
Abstract—Human protein SLURP1 is an endogenous neuromodulator belonging to the Ly6/uPAR family and acting on nicotinic acetylcholine receptors. In the present work, the gene of SLURP1 was expressed in E. coli. The bacterial systems engineered for SLURP1 expression as fused with thioredoxin and secretion with leader peptide STII failed in the produc tion of milligram quantities of the protein. The SLURP1 was produced with highyield in the form of inclusion bodies, and different methods of the protein refolding were tested. Milligram quantities of recombinant SLURP1 and its 15Nlabeled analog were obtained. The recombinant SLURP1 competed with 125Iαbungarotoxin for binding to muscletype Torpedo californica nAChR at micromolar concentrations, indicating a partial overlap in the binding sites for SLURP1 and αneu rotoxins on the receptor surface. NMR study revealed conformational heterogeneity of SLURP1 in aqueous solution, which was associated with cistrans isomerization of the Tyr39–Pro40 peptide bond. The two structural forms of the protein have almost equal population in aqueous solution, and exchange process between them takes place with characteristic time of about 4 ms. Almost complete 1H and 15N resonance assignment was obtained for both structural forms of SLURP1. The secondary structure of SLURP1 involves two antiparallel βsheets formed from five βstrands and closely resembles those of threefinger snake neurotoxins. DOI: 10.1134/S0006297913020090 Key words: nicotinic acetylcholine receptor, bacterial expression, Lynx, conformational exchange, threefinger snake neu rotoxin, NMR spectroscopy
Nicotinic acetylcholine receptors (nAChRs) are lig andgated ion channels [1]. Depending on localization, nAChRs are subdivided into two main classes, neuronal and muscular [1]. Neuronal nAChRs were found also in nonneuronal tissues, such as epithelial cells and pul monary and other tissues and are involved in functioning of the immune and endocrine systems [2]. Dysfunctions of nAChRs have been proposed to contribute to a number Abbreviations: αBgtx, αbungarotoxin; nAChR, nicotinic acetylcholine receptor; STII, signal peptide of E. coli heatsta ble enterotoxin II; TRX, thioredoxin; wsLynx1, watersoluble domain of human Lynx1. * To whom correspondence should be addressed.
of disorders of the central and peripheral nervous systems such as Alzheimer disease, Parkinsonism, myasthenia, epilepsy, depression, nicotinic and alcohol addiction, and probably to some cancer diseases and diseases of the immune and endocrine systems [3]. Endogenous Lynx (Lynx1, Lynx2) and SLURP (SLURP1, SLURP2) proteins discovered in higher ani mals belong to the Ly6/uPAR family and modulate nAChRs [47]. Due to the conserved disposition of Cys residues forming disulfide bonds (Fig. 1), all these pro teins are expected to share structural homology with threefinger snake αneurotoxins, highly potent and spe cific inhibitors of nAChRs [8]. Possible structural homol ogy and the presence of the same targets of these distant
204
HUMAN NEUROMODULATOR SLURP1
205 homology
loop I
loop II
loop III
Fig. 1. Amino acid sequence alignment of human SLURP1, SLURP2, wsLynx1, long αneurotoxin (αcobratoxin from Naja kaouthia, α Cbtx), short αneurotoxin (neurotoxin II from Naja oxiana, NTII), and nonconventional toxin WTX from N. kaouthia. Cysteine residues are labeled in gray, and the disulfide linkages are shown; additional Nterminal Met residues are underlined. The similarity of SLURP1 and other peptide amino acid sequences was calculated using EMBOSS Stretcher (EMBLEBI).
ly related molecules explain great interest in the role of Lynx and SLURP in the functioning of the nervous sys tem. The conservative core of threefinger proteins con sists of several antiparallel βsheets and is stabilized by a system of four disulfide bonds (Fig. 1) [8]. This folding is present in shortchain αneurotoxins, e.g. in neurotoxin II from Naja oxiana venom. Socalled longchain αneu rotoxins (e.g. αcobratoxin from Naja kaouthia) contain an additional fifth disulfide bond in the tip of the central loop (loop II). Also, Ly6/uPAR proteins (including Lynx and SLURP) and nonconventional αneurotoxins (e.g. WTX from N. kaouthia) contain a fifth disulfide bond in the Nterminal loop (loop I) (Fig. 1) [8]. Lynx proteins are tethered to the membrane by GPI anchor and are colocalized with nAChRs in the brain [9]. It was recently reported that the watersoluble domain of human Lynx1 (wsLynx1, not containing a GPI anchor), potentiates or inhibits α4β2, α7, and α3β2 neuronal nAChRs in a concentrationdepended manner [10]. In contrast to Lynx, SLURP1 and SLURP2 are secreted proteins [6, 11]. It was shown that human SLURP1 is a nonglycosylated protein and enhances acetylcholineevoked macroscopic currents in Xenopus oocytes expressing neuronal α7 nAChRs [12]. Mutations in the SLURP1 gene cause the autosomal skin disease Mal de Meleda [13]. SLURP1 and SLURP2 partici pate in the regulation of keratinocyte proliferation and differentiation, apoptosis, and malignant transformation [11, 14, 15]. It was demonstrated that SLURP1 and SLURP2 interact with neuronal nAChRs expressed in human keratinocytes [11, 14]. Moreover, SLURP1 and SLURP2 are expressed in immune cells and might be involved in the regulation of lymphocyte function [16]. SLURP1 probably also participates in pain signal trans mission within the spinal cord [17]. Although some biological properties of the SLURP proteins have been characterized, the structure–func tional relationships in this neuromodulator family are still BIOCHEMISTRY (Moscow) Vol. 78 No. 2 2013
obscure. Here an effective E. coli expression system of human SLURP1 was developed to study spatial structure of the protein and its interaction with nAChRs. The observed competition with 125Iαbungarotoxin (αBgtx) for binding to muscletype Torpedo californica nAChRs revealed a new target for neuromodulator action and a partial overlap in the binding sites for recombinant SLURP1 and αneurotoxin on the receptor. NMR structural study of 15Nlabeled SLURP1 revealed the β structural threefinger fold characteristic for snake α neurotoxins. The observed SLURP1 conformational heterogeneity is associated with cistrans isomerization of the Tyr39–Pro40 peptide bond located in the central loop of the threefinger structure. These structural properties resemble those of the nonconventional snake αneuro toxin WTX from N. kaouthia [18].
MATERIALS AND METHODS Cloning and bacterial expression of SLURP1. The human slurp1 gene encoding 81 amino acids of human SLURP1 protein (Fig. 1) was constructed from six over lapping synthetic oligonucleotides (table) using a three stage PCR. The slurp1 gene was cloned into expression vectors pET32a(+) (Novagen, USA) (Fig. 2a), pET 22b(+)/STII [19] (Fig. 2b), and pET22b(+) (Novagen) (Fig. 2c). Preparative expression of SLURP1 was done using the pET22b(+)/slurp1 construction. Escherichia coli BL21(DE3) cells transformed with pET 22b(+)/slurp1 vector were grown at 37°C on TB medium using a Bioflow 3000 fermenter (New Brunswick Scientific, USA) under automatic maintenance of oxygen content in the system at the level of 30%. Gene expression was induced by IPTG addition to final concentration 0.025 mM at OD600 = 1.0, and then the cells were grown additionally for 8 h. For production of 15Nlabeled SLURP1, trans formed cells were grown on TB medium (1 liter) in flasks
206
SHULEPKO et al.
a His6 thrombin site
b
c
Fig. 2. Genetic constructs used for the SLURP1 bacterial expres sion.
until OD600 = 1.0. The cells were harvested (1000g for 20 min) and resuspended in an equal volume of minimal medium M9 containing 15NH4Cl (CIL, USA) as a nitro gen source, transferred into the fermenter, and afterwards the gene expression was induced. Purification and renaturation of recombinant SLURP1. Inclusion bodies containing SLURP1 were extracted and washed as described for WTX and wsLynx1
[10, 20, 21]. The washed inclusion bodies containing SLURP1 were dissolved in 50 mM TrisGly, pH 9.2, 8 M urea, 0.4 M Na2SO3, 0.15 M Na2O6S4 (10 ml of buffer per gram of inclusion bodies), disintegrated by ultrasound (Branson Digital Sonifier, USA) at 50 W and 4°C during 1 min, and incubated for 8 h with gentle mixing at room temperature. Then the suspension was centrifuged at 36,000g and 4°C for 30 min. The supernatant was diluted 10fold with 2 M urea and applied on a DEAP SpheroniteOH column (joint development of the State Scientific and Research Institute of Especially Pure Biopreparations, St. Petersburg, and the Institute of Bioorganic Chemistry, Russian Academy of Sciences; manufactured by Yarsintez Company, Russia) equilibrat ed with 30 mM TrisHCl, pH 8.0 (buffer A). Then the column was washed with buffer A, buffer A containing 1 M NaCl, and buffer A containing 8 M urea. Protein fractions containing SLURP1 were eluted with buffer A containing 8 M urea and 0.5 M NaCl, and then 1000fold molar excess of DTT (relative to the SLURP1 concen tration) was added. Reduced SLURP1 was additionally purified on a 10 × 250mm Jupiter A300 C4 HPLC col umn (Phenomenex, USA) by elution in 1045% acetoni trile gradient for 30 min in the presence of 0.1% trifluo roacetic acid and then lyophilized. For refolding, reduced SLURP1 was diluted with the renaturation buffer (50 mM TrisHCl, pH 7.0, 2 M urea, 0.5 M Larginine, 4 mM GSH, 1 mM GSSG) to final protein concentration 0.1 mg/ml and incubated dur ing 6 days at 4°C. Refolded SLURP1 was purified on a 4.6 × 250mm Jupiter A300 C4 HPLC column by the elu
Oligonucleotides used for SLURP1 cloning S1, direct primer for slurp1 cloning into pET22b(+)
GAGATATACATATGCTGAAGTGCTACACTTGCAAAGAACCGATGACTAGCGCTTCC NdeI
S2
GCAAGCGGTGTCTTCCGGTTTGCAACGGGTGATGGTACGGCAGGAAGCGCTAGT
S3
GACACCGCTTGCATGACCACCCTGGTTACCGTTGAAGCTGAGTACCCGTCCAAC
S4
AACACAAGAGGAAGAACAGGAACGGGTTACAACCGGGGACTGGTTGAACGGGTA
S5
TCCTCTTGTGTTGCTACTGACCCAGATTCCATCGGCGCAGCGCACCTCATCTTC
S6, reverse primer for slurp1 cloning into pET22b(+), pET22b(+)/STII, and pET32a(+)
GGCTCGGATCCCTATCACAGTTCAGAGTTGCACAGGTCGCGGAAACAGCAGAAGATGAGGTG BamHI
S7, direct primer for slurp1 cloning into pET32a(+)
GATCTGGGTACCGGTTCTGGTTCTGGTCTGGTGCCGCGTGGTTCTCTGAAGTGCTACACTTG KpnI CAAAGAAC
S8, direct primer for slurp1 cloning into pET22b(+)/STII
ACAAATGCGTACGCACTGCTACACTTGCAAAGAAC BsiWI
Note: Endonuclease restriction sites are underlined. BIOCHEMISTRY (Moscow) Vol. 78 No. 2 2013
HUMAN NEUROMODULATOR SLURP1 tion in 1045% acetonitrile gradient for 50 min in the presence of 0.1% trifluoroacetic acid and then lyophilized. Binding of SLURP1 to nAChRs. Binding of SLURP1 to membranebound muscletype nAChRs from T. californica was carried out as described in [10]. Competition data were fitted using ORIGIN 7.5 (OriginLab Corporation, USA) to a onesite dose– response curve using the Hill equation. NMR spectroscopy. NMR investigation was done using 0.5 mM samples of 15Nlabeled or unlabeled SLURP1 in 5% or 100% D2O at pH 4.7 and 37°C. NMR spectra were acquired on an Avance 700 spectrometer (Bruker, Germany) equipped with a cryoprobe. 1H and 15 N resonance assignment was obtained by a standard procedure using the combination of 2D and 3D TOCSY and NOESY spectra and also 2D DQFCOSY spectra [22]. The 3JHNHα coupling constants were determined using a 3D HNHA experiment. Temperature coefficients of amide protons (∆δ1HN/∆T) were measured over the temperature range 1545°C using 2D 15NHSQC spectra. To identify slowly exchanging amide protons, 15Nlabeled SLURP1 was lyophilized and dissolved in 100% D2O, pH 4.7. The H–D exchange kinetics was measured using 2D 15NHSQC spectra.
production of threefinger proteins as fusions with thioredoxin (TRX) (Fig. 2a) [24]. Hybrid protein TRX SLURP1 expressed into the soluble fraction of cyto plasm was purified on a Ni2+column and treated with thrombin (Fig. 3a, lanes 1 and 2). The product of hydrol ysis was purified by subtracting Ni2+affinity chromatog raphy and anion chromatography on QSepharose (GE Healthcare, Sweden) (Fig. 3a, lanes 3 and 4). However, HPLC analysis revealed inhomogeneity of the SLURP1 sample, which probably points to incomplete renatura tion of the protein (Fig. 3b, profile 1). Another system utilized the secretion mechanism with the signal peptide of E. coli heatstable enterotoxin II (STII) [19, 25]. The secretion of SLURP1 (Fig. 2b) was also unsuccessful. Cell lysis was observed after the transformation with the vector pET22b(+)/STII/slurp1 independently of the cultivation media (TB, LB, M9) or cell strain used (BL21, BL21(DE3), BL21(DE3)pLysS), and it occurred even in the absence of IPTG. In contrast, direct expression of the slurp1 gene resulted in the production of the protein in the form of cytoplasm inclusion bodies (Fig. 2c). However, the refolding protocols developed previously for WTX and wsLynx1 [10, 20, 21] were ineffective. The method based on the use of Ssulfitized intermediate [26, 27] was applied for extracting and refolding of recombinant SLURP1 from inclusion bodies. The resulting sulfitized SLURP1 sample was treated with reducing agent DTT and purified by HPLC. The final yield of reduced SLURP1 and its 15Nlabeled analog was ~50 and 10 mg per liter of bacterial culture, respectively. Screening of the pH value (6.011.0), concentrations of GSH and GSSG (mM) (4 : 1, 4 : 2, 2 : 2, 3 : 0.3) and
RESULTS Bacterial expression and refolding of SLURP1. For recombinant SLURP1 production, the three E. coli expression systems previously applied for production of snake αneurotoxins and wsLynx1 [10, 1921, 2325] were tested (Fig. 2). The first system was developed for
a 3
4
c
5
8975 2
Intensity ×108
2
b Absorbance at 230 nm
1
207
1.0
0.5
1
20
30 Elution time, min
0.0 8000
8500
9000
9500
m/z
Fig. 3. a) SDSPAGE analysis of SLURP1 purification: 1) TRXSLURP1 purified on Ni2+chromatography; 2) TRXSLURP1 after thrombin cleavage; 3) SLURP1 purified on subtracting Ni2+chromatography after thrombin cleavage; 4) SLURP1 purified on Q Sepharose after thrombin cleavage; 5) SLURP1 refolded from inclusion bodies and purified on HPLC. b) HPLC analysis of SLURP1 puri fied on QSepharose after thrombin cleavage (1) and SLURP1 refolded from inclusion bodies (2). c) Massspectrum of refolded SLURP1.
BIOCHEMISTRY (Moscow) Vol. 78 No. 2 2013
208
SHULEPKO et al.
100
Specific binding, %
80
60 40
20 0 6
5
4
–Iog[SLURP1, M] Fig. 4. Competition of SLURP1 with 125Ilabeled αBgtx for binding to T. californica nAChRs. Each point is mean ± S.E.M. of triplicates. The Hill equation: y = 100/{1 + ([toxin]/IC50)n } was fitted to normalized data (% of control binding). The calculated IC50 and nH values were 40 ± 10 µM and 1.1, respectively. H
urea (02 M), composition of the refolding buffer (Tris HCl, NaPi), and refolding time (36 days) was carried out. Moreover, addition of Larginine in the concentra tion range 00.7 M was tested. The yield of refolded SLURP1 and its 15Nlabeled analog under the optimal conditions (see “Materials and Methods”) was 5.0 and 0.5 mg per liter of bacterial culture, respectively. The homogeneity of refolded SLURP1 was confirmed by SDSPAGE (Fig. 3a, lane 5), analytical HPLC (Fig. 3b, profile 2), and mass spectrometry (Fig. 3c). The molecu lar mass of the recombinant protein (8975 Da) within experimental error coincided with the calculated one for human SLURP1 having five closed disulfide bridges and an additional Met residue at the Nterminus (8974 Da). Formation of the disulfide bonds was additionally con firmed using Ellman’s reagent. CD spectroscopy of refolded SLURP1 revealed a preferentially βstructural organization (data not shown). SLURP1 binding to T. californica nAChRs. Previous studies demonstrated SLURP1 effects on the acetyl cholineevoked currents in Xenopus oocytes expressing neuronal α7 nAChRs [12]. Moreover, the competition of SLURP1 with 3Hnicotine and 3Hepabitidine for bind ing with human keratinocytes nAChRs was reported [14]. Here for the first time we measured the binding parame ters for the interaction of SLURP1 with muscletype nAChRs from T. californica. The competition experiments with SLURP1 and 125Ilabeled αBgtx on nAChRs from T. californica gave IC50 ~ 40 ± 10 µM (Fig. 4). Resonance assignment, conformational heterogene ity, and secondary structure of SLURP1. Ninetytwo spin systems were identified in the 3D 15NTOCSY
HSQC spectrum of SLURP1 instead of the 76 expected (Fig. 5). Doubling observed for some of the backbone HN resonances revealed the presence of two structural forms of the protein in solution (form I and form II). Cross peak intensities in the HSQC spectrum revealed equal population of these two forms. Homogeneity of the SLURP1 preparation proved by biochemical methods (see above) indicated that the observed effect is caused by a conformational exchange process, which is slow (mss) on the NMR timescale. Almost complete 1H and 15N resonance assignment was obtained for both structural forms of SLURP1 (Fig. 5). Spin systems of Pro residues and some side chain resonances remain unassigned due to signal overlap in the 2D TOCSY and DQFCOSY spec tra. The maximal differences in chemical shifts between the two SLURP1 conformations (Fig. 6a) were observed in the vicinity of the Pro40 residue, indicating that the conformational exchange is probably caused by cistrans isomerization of the Tyr39–Pro40 peptide bond. Due to the significant overlap in 2D spectra, the isomerization of this peptide bond could not be directly proved by the analysis of NOE connectivities. Observation of the exchange crosspeaks in the 3D 15NNOESYHSQC spectra of SLURP1 (τm 80 ms) permitted estimation of the rate of the exchange process (KEX ~ 250 s–1, charac teristic time ~ 4 ms). The NMR data analysis revealed the SLURP1 sec ondary structure (Fig. 6b). Both forms of the protein involve two antiparallel βsheets, one consisting of two strands (Leu1Thr5 and Thr17Cys21), and the other of three strands (Ala27Val33, Val46Ser52, and Leu68 Phe73). The arrangement of the βstrands was deter mined from the NOE connectivities (Fig. 6b). The inter actions between the first βstrand (residues Lys2Tyr4) and Cterminal fragment (Leu76 residue) were also observed. The βstructural core of SLURP1 is stabilized by the net of backbone–backbone hydrogen bonds, which are manifested in the slowly exchanging amide protons (Fig. 6). Overall topology of the SLURP1 βstructure closely resembles the spatial organization of threefinger snake αneurotoxins and others Ly6/uPAR proteins.
DISCUSSION The present results together with the results of previ ous studies [20, 21] reveal that the additional disulfide bond in loop I complicates in vitro folding of the three finger proteins. Indeed, fusion expression with TRX and secretion were successfully applied for recombinant pro duction of shortchain neurotoxin II from N. oxiana, containing four disulfide bonds [24, 25], and its chimera variants with an additional disulfide bond in the central loop [19]. However, these approaches did not result in the production of folded wsLynx1 [21] and WTX [20], which similar to SLURP1 contain an additional disulfide bond BIOCHEMISTRY (Moscow) Vol. 78 No. 2 2013
HUMAN NEUROMODULATOR SLURP1
209
108
15
116
N, ppm
112
120
124
128
9.5
9.0
8.5
8.0
7.5
7.0
1
Н, ppm
Fig. 5. 15NHSQC spectrum of 0.5 mM SLURP1 (5% D2O, pH 4.7, 37°С). The resonance assignments for both structural forms (I and II) of the protein are shown. Resonances of form II are marked with stars and italic. Reciprocal crosspeaks from both forms of SLURP1 are connected by gray lines. Resonances of side chain groups are marked with superscript “s”. Resonances of Asn and Gln NH2 groups are con nected by dotted lines. “Folded” resonances are underlined.
in the Nterminal loop. Probably, expression in the form of cytoplasm inclusion bodies with subsequent refolding is the optimal way for production of such proteins. This conclusion is confirmed by the results of other investiga tions. Thus, SLURP1 production in the form of hybrid protein with SUMO failed to produce the target protein in quantities sufficient for physicochemical studies [14]. The presented data on the competition of SLURP1 and αBgtx for the interaction with nAChRs from T. cal BIOCHEMISTRY (Moscow) Vol. 78 No. 2 2013
ifornica revealed new details of the action of the neuro modulator: (i) targeting of muscletype nAChRs, and (ii) possible overlap in SLURP1 and αneurotoxin binding sites on the receptor surface. Similar phenomena were demonstrated earlier for human wsLynx1, thus empha sizing common functional features of these neuromodu lators [10]. The results of NMR study revealed the homology of the SLURP1 structure and threefinger structures of
210
SHULEPKO et al.
a ∆δ, ppm
1.2 0.8 0.4 0.0
b
Fig. 6. NMR data define SLURP1 secondary structure and conformational heterogeneity in solution. a) Net differences in 15NH, 1HN, and 1Hα chemical shifts for the two structural forms of SLURP1 (∆δ), 1Hα chemical shift indices (CSIs), 3JHNHα coupling constants, H–D exchange rates for HN protons (H/DEX), and temperature coefficients of amide protons (∆δ1HN/∆T) are shown versus the protein sequence. Differences in the 15 H N chemical shifts were scaled by 0.2 upon ∆δ calculation. Positive and negative values of CSIs denote βstrand and αhelical propensity, respectively. Large (>8.5 Hz), small (30 h), slow–inter mediate (halfexchange time >2 h), and intermediate (halfexchange time >20 min) H/DEX, respectively. Blackfilled stars denote amide pro tons with temperature gradients less than 4.5 ppb/K. Since the NMR data for the two SLURP1 structural forms are different, the encoding sym bol splits up vertically into the two parts. The first and second parts of the symbol correspond to forms I and II, respectively. Elements of the sec ondary structure are shown on a separate line; βstrands are designated by arrows. b) Identification of the pairing scheme of the βstrands and overall topology of SLURP1. The strong, weak, and possibly overlapped NOE contacts observed in the 80 ms NOESY spectrum are shown by solid, open, and dashed arrows, respectively. Amide protons with slow and slow–intermediate H/DEX are surrounded by solid circles. Amide pro tons with intermediate H/DEX are surrounded by dotted circles. Hydrogen bonds stabilizing the βstructure are shown by wavy lines.
snake αneurotoxins and other proteins from the Ly 6/uPAR family such as human wsLynx1 [10]. The con formational exchange in the SLURP1 molecule caused by cistrans isomerization of the Tyr39–Pro40 peptide
bond located in the tip of the central loop (loop II) of the threefinger structure was observed (Fig. 6). It should be noted that the similar conformational heterogeneity asso ciated with cistrans isomerization of the Arg32–Pro33 BIOCHEMISTRY (Moscow) Vol. 78 No. 2 2013
HUMAN NEUROMODULATOR SLURP1 peptide bond also situated in the tip of loop II (Fig. 1) was observed earlier in the nonconventional αneurotoxin WTX [18]. In other words, human SLURP1 demon strates common scaffold and similar dynamic properties with some nonconventional snake αneurotoxins. In summary, the present report describes the mil ligram scaled recombinant expression of protein from the SLURP family characterized by biochemical and struc tural methods. The developed expression system opens new perspectives in structural–functional and mutagene sis studies of homological proteins SLURP1 and SLURP2 (Fig. 1). For example, the production of 13C 15 Nlabeled analog of SLURP1 will allow determination of the spatial structure of both neuromodulator forms with atomic resolution. For the first time, the structural similarity between SLURP1 and other peptide ligands of nAChRs (snake αneurotoxins and Lynx1) has been proved. Moreover, for the first time the SLURP1 binding to muscletype nAChRs and the competition with snake αneurotoxin has been demonstrated. These results point to the possible overlap of the neuromodulator and neuro toxin binding sites on the receptor. This work was supported by grants from the Russian Academy of Sciences (Program “Molecular and Cellular Biology”), the Russian Foundation for Basic Research (grant No. 120401639), Russian Federal Target Program “Scientific and Science–Educational Personnel of Innovative Russia, 20092013 years”, Ministry of Education and Science of Russia (projects 8789 and 8268), and the grant from the President of the Russian Federation (NSh5597.2012.4).
REFERENCES 1. 2. 3.
4.
5. 6.
7. 8. 9.
Albuquerque, E. X., Pereira, E. F., Alkondon, M., and Rogers, S. W. (2009) Physiol. Rev., 89, 73120. Egleton, R. D., Brown, K. C., and Dasgupta, P. (2008) Trends Pharmacol. Sci., 29, 151158. Gotti, C., Clementi, F., Fornari, A., Gaimarri, A., Guiducci, S., Manfredi, I., Moretti, M., Pedrazzi, P., Pucci, L., and Zoli, M. (2009) Biochem. Pharmacol., 78, 703711. Miwa, J. M., IbanezTallon, I., Crabtree, G. W., Sanchez, R., Sali, A., Role, L. W., and Heintz, N. (1999) Neuron, 23, 105114. Dessaud, E., Salaun, D., Gayet, O., Chabbert, M., and deLapeyriere, O. (2006) Mol. Cell Neurosci., 31, 232242. Adermann, K., Wattler, F., Wattler, S., Heine, G., Meyer, M., Forssmann, W. G., and Nehls, M. (1999) Protein Sci., 8, 810819. Tsuji, H., Okamoto, K., Matsuzaka, Y., Iizuka, H., Tamiya, G., and Inoko, H. (2003) Genomics, 81, 2633. Kini, R. M., and Doley, R. (2010) Toxicon, 56, 855867. IbanezTallon, I., Miwa, J. M., Wang, H. L., Adams, N. C., Crabtree, G. W., Sine, S. M., and Heintz, N. (2002) Neuron, 33, 893903. BIOCHEMISTRY (Moscow) Vol. 78 No. 2 2013
211
10. Lyukmanova, E. N., Shenkarev, Z. O., Shulepko, M. A., Mineev, K. S., D’Hoedt, D., Kasheverov, I. E., Filkin, S. Y., Krivolapova, A. P., Janickova, H., Dolezal, V., Dolgikh, D. A., Arseniev, A. S., Bertrand, D., Tsetlin, V. I., and Kirpichnikov, M. P. (2011) J. Biol. Chem., 286, 10618 10627. 11. Arredondo, J., Chernyavsky, A. I., Jolkovsky, D. L., Webber, R. J., and Grando, S. A. (2006) J. Cell Physiol., 208, 238245. 12. Chimienti, F., Hogg, R. C., Plantard, L., Lehmann, C., Brakch, N., Fischer, J., Huber, M., Bertrand, D., and Hohl, D. (2003) Hum. Mol. Gen., 12, 30173024. 13. Fischer, J., Bouadjar, B., Heilig, R., Huber, M., Lefevre, C., Jobard, F., Macari, F., BakijaKonsuo, A., Ait Belkacem, F., Weissenbach, J., Lathrop, M., Hohl, D., and Prud’homme, J.F. (2001) Hum. Mol. Gen., 10, 875880. 14. Arredondo, J., Chernyavsky, A. I., Webber, R. J., and Grando, S. A. (2005) J. Invest. Dermatol., 125, 12361241. 15. Arredondo, J., Chernyavsky, A. I., and Grando, S. A. (2007) Life Sci., 80, 22432247. 16. Moriwaki, Y., Yoshikawa, K., Fukuda, H., Fujii, Y. X., Misawa, H., and Kawashima, K. (2007) Life Sci., 80, 2365 2368. 17. Moriwaki, Y., Watanabe, Y., Shinagawa, T., Kai, M., Miyazawa, M., Okuda, T., Kawashima, K., Yabashi, A., Waguri, S., and Misawa, H. (2009) Neurosci. Res., 64, 403 412. 18. Eletsky, A. V., Maslennikov, I. V., Kukhtina, V. V., Utkin, Y. N., Tsetlin, V. I., and Arseniev, A. S. (2001) Russ. J. Bioorg. Chem., 27, 7283. 19. Lyukmanova, E. N., Shenkarev, Z. O., Schulga, A. A., Ermolyuk, Y. S., Mordvintsev, D. Y., Utkin, Y. N., Shoulepko, M. A., Hogg, R. C., Bertrand, D., Dolgikh, D. A., Tsetlin, V. I., and Kirpichnikov, M. P. (2007) J. Biol. Chem., 282, 2478424791. 20. Lyukmanova, E. N., Shulepko, M. A., Tikhonov, R. V., Shenkarev, Z. O., Paramonov, A. S., Wulfson, A. N., Kasheverov, I. E., Ustich, T. L., Utkin, Y. N., Arseniev, A. S., Tsetlin, V. I., Dolgikh, D. A., and Kirpichnikov, M. P. (2009) Biochemistry (Moscow), 74, 11421149. 21. Shulepko, M. A., Lyukmanova, E. N., Kasheverov, I. E., Dolgikh, D. A., Tsetlin, V. I., and Kirpichnikov, M. P. (2011) Russ. J. Bioorg. Chem., 37, 543549. 22. Rule, G. S., and Hitchens, K. T. (2006) Fundamentals of Protein NMR Spectroscopy, Springer, Netherlands. 23. Lyukmanova, E. N., Shulepko, M. A., Shenkarev, Z. O., Dolgikh, D. A., and Kirpichnikov, M. P. (2010) Russ. J. Bioorg. Chem., 36, 137145. 24. Lyukmanova, E. N., Shulga, A. A., Arsenieva, D. A., Pluzhnikov, K. A., Dolgikh, D. A., Arseniev, A. S., and Kirpichnikov, M. P. (2004) Russ. J. Bioorg. Chem., 30, 25 34. 25. Bocharov, E. V., Lyukmanova, E. N., Ermolyuk, Ya. S., Shulga, A. A., Pluzhnikov, K. A., Dolgikh, D. A., Kirpichnikov, M. P., and Arseniev, A. S. (2003) Appl. Magn. Reson., 24, 247254. 26. Tikhonov, R. V., Pechenov, S. E., Belacheu, I. A., Yakimov, S. A., Klyushnichenko, V. E., Tunes, H., Thiemann, J. E., Vilela, L., and Wulfson, A. N. (2002) Prot. Exp. Purif., 26, 187193. 27. Wulfson, A. N., Tikhonov, R. V., and Pechenov, S. E. (2001) Dokl. Biochem. Biophys., 380, 329331.
