Identification and Quantification of Archaea Involved in Primary ...

JOURNAL OF CLINICAL MICROBIOLOGY, Apr. 2006, p. 1274–1282 0095-1137/06/$08.00⫹0 doi:10.1128/JCM.44.4.1274–1282.2006 Copyright © 2006, American Society for Microbiology. All Rights Reserved.

Vol. 44, No. 4

Identification and Quantification of Archaea Involved in Primary Endodontic Infections M. E. Vianna,1,2 G. Conrads,2 B. P. F. A. Gomes,1 and H. P. Horz2* Endodontic Area, Department of Restorative Dentistry, Piracicaba Dental School, State University of Campinas, Piracicaba SP, Brazil,1 and Division of Oral Microbiology and Immunology, Department of Operative and Preventive Dentistry and Periodontology, and Department of Medical Microbiology, RWTH University Hospital Aachen, Aachen, Germany2 Received 28 November 2005/Returned for modification 4 January 2006/Accepted 20 January 2006

Members of the domain Archaea, one of the three domains of life, are a highly diverse group of prokaryotes, distinct from bacteria and eukaryotes. Despite their abundance and ubiquity on earth, including their close association with humans, animals, and plants, so far no pathogenic archaea have been described. As some archaea live in close proximity to anaerobic bacteria, for instance, in the human gut system and in periodontal pockets, the aim of our study was to assess whether archaea might possibly be involved in human endodontic infections, which are commonly polymicrobial. We analyzed 20 necrotic uniradicular teeth with radiographic evidence of apical periodontitis and with no previous endodontic treatment. Using real-time quantitative PCR based on the functional gene mcrA (encoding the methyl coenzyme M reductase, specific to methanogenic archaea) and on archaeal 16S rRNA genes, we found five cases to be positive. Direct sequencing of PCR products from both genes showed that the archaeal community was dominated by a Methanobrevibacter oralis-like phylotype. The size of the archaeal population at the diseased sites ranged from 1.3 ⴛ 105 to 6.8 ⴛ 105 16S rRNA gene target molecule numbers and accounted for up to 2.5% of the total prokaryotic community (i.e., bacteria plus archaea). Our findings show that archaea can be intimately connected with infectious diseases and thus support the hypothesis that members of the domain Archaea may have a role as human pathogens.

causative agents of disease could be partly the result of the fact that these microbes are completely ignored in routine laboratory diagnostics. Methanogens are a unique group of strictly anaerobic archaea which metabolize hydrogen, CO2, or acetate as a substrate with the resultant production of methane. As terminal oxidizers in complex microbial communities, they are vital to the anaerobic microbial degradation of organic compounds in natural environments and probably also in defined ecological niches of the human body (7). Since methanogens coexist and closely interact with anaerobic bacteria at certain sites (e.g., human colon or dental plaque), they could be implicated in mixed anaeorobic infections. In fact, methanogens have recently been linked to periodontal disease (18, 20), a polymicrobial infection that affects the gums and supporting structures of the teeth and is characterized by periodontal pockets. In order to find more evidence for the existence of pathogenic methanogens, we focused on primary endodontic infections, which are commonly polymicrobial and lead to inflammation and destruction of periradicular tissues, called apical periodontitis (16). Unlike periodontal diseases, the apical periodontitis is caused by infection of a tooth’s root canal, a place devoid of microbes in a healthy state (27). This means that endodontic microorganisms must have strategies to gain access into this sterile place and to evade host defense mechanisms, both features that are characteristically displayed by pathogens (21, 28). For assessing the possible existence of archaea, we selected clinical samples from endodontic infections that had previously been screened for the detection of bacteria (35). To accomplish this, we used real-time quantitative PCR (RTQ-PCR)

With the advent of molecular phylogenetic studies (e.g., comparative analyses of small-subunit 16S and 18S rRNAs), it has become accepted that all cellular life falls into three primary domains, i.e., Bacteria, Eucarya, and Archaea (37). Organisms from the domain Archaea differ fundamentally from eukarya and bacteria in several genetic, biochemical, and structural features. As “archaebacteria” they have been classified as an early-branching evolutionary offshoot of the domain Bacteria and have long been considered to represent a primitive form of life that thrives only in extreme environments such as hot springs, salt lakes, or submarine volcanic habitats. However, recent work has shown that archaea are more physiologically diverse and ecologically widespread than was previously supposed (2, 3). Like bacteria, archaea are commonly mesophilic, and some members are known to be closely associated with eukaryotic hosts, including humans. For instance, high numbers of methane-producing archaea (methanogens) have been found in the gastrointestinal tract (17), vagina (5), and oral cavity (4). Although they are now recognized as a component of human microbiota, it is generally assumed that archaea are not a cause of human disease. However, considering the range of known pathogens within the domains Bacteria and Eukarya, the complete absence of recognized pathogens within Archaea, whose ubiquity and phylogenetic diversity are comparable to those of the other two domains, is striking. Instead, the assumption that methanogens or other archaea are not

* Corresponding author. Mailing address: Division of Oral Microbiology and Immunology, University Hospital (RWTH), Pauwelsstrasse 30, D-52057 Aachen, Germany. Phone: 49-241-8088448. Fax: 49-241-8082483. E-mail: [email protected]. 1274

VOL. 44, 2006

ARCHAEA IN ENDODONTIC INFECTIONS

1275

TABLE 1. Primer descriptions and thermal profiles for PCR Primer

Sequence (5⬘33⬘)

Reference

Target DNA (size in bp)

Temp profile

Molecular analysis

25

mcrA (464)

95˚C (10 min); 40 cycles of 95˚C (10 s), 56˚C (7 s), and 72˚C (25 s)

RTQ-PCR

ACKGCTCAGTAACACGT

13

16S rRNA gene (798)


RTQ-PCR

A934R

GTGCTCCCCCGCCAATTCCT

32

PF1

AGAGTTTGATCCTGGCTCAG

10

16S rRNA gene (1,522)


Conventional PCR

PR1

GGCTACCTTGTTACGACTT

9

EuF

TCCTACGGGAGGCAGCAGT

26

16S rRNA gene (466)


RTQ-PCR

EuR

GGACTACCAGGGTATCTAATCCTGTT

LuF

GGTGGTGTMGGATTCACACART AYGCWACAGC

LuR

TTCATTGCRTAGTTWGGRTAGTT

A109F

based on the functional gene mcrA, encoding methyl coenzyme M reductase, the terminal enzyme complex in the methane generation pathway. The ubiquity of this gene among methanogens (34) has facilitated the development of mcrA as a molecular marker, allowing the detection and enumeration of methanogens without requiring laboratory culture (24, 25). We also determined the total load of archaea as well as bacteria by using two different 16S rRNA gene-based RTQ-PCR assays. Here we report for the first time the detection, identification, and quantification of a defined phylotype of archaea in infected root canals. This finding may contribute to an emerging view of archaea as potential human pathogens. MATERIALS AND METHODS Microbial strains. The following archaeal type strains used in this study were obtained from the Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ), Braunschweig, Germany: Methanococcus maripaludis DSM 2067T, Methanoplanus endosymbiosus DSM 3599T, Methanospirillum hungatei DSM 864T, Methanobrevibacter oralis DSM 7256T, and Methanobrevibacter smithii DSM 861T. Bacterial strains used in this study were obtained from the American Type Culture Collection (ATCC), Manassas, Va. The majority were type strains, as indicated: Actinomyces odontolyticus ATCC 17929T, Enterococcus faecalis ATCC 29212, Fusobacterium nucleatum ATCC 25586T, Prevotella nigrescens ATCC 33563T, and Tannerella forsythia ATCC 43037T. Sample collection. Twenty patients who were at the Piracicaba Dental School for root canal treatment, who were otherwise healthy, and who had not received antibiotic treatment during the previous 3 months were selected for this study. The age of the patients ranged from 19 to 63 years. The selected teeth (one tooth per patient) were uniradicular, presented necrotic pulp tissues, and showed radiographic evidence of apical periodontitis but an absence of periodontal diseases. All teeth were asymptomatic. A detailed medical and dental history was obtained from each patient. The Human Volunteers Research and Ethics Committee of the Dental School of Piracicaba approved a protocol describing the specimen collection for this investigation, and all patients signed an informed consent form to participate in the study. The teeth were isolated with a rubber dam. The crown and the surrounding rubber dam were disinfected with 30% (vol/vol) H2O2 for 30 s followed by 2.5% NaOCl for additional 30 s. Subsequently, 5% sodium thiosulfate was used to neutralize the disinfectant agents

(35). An access cavity was prepared with sterile high-speed diamond burs under irrigation with sterile saline. Before entering the pulp chamber, the access cavity was disinfected with the same protocol as mentioned above. The sterility of the crown and the surrounding rubber was checked by taking a swab sample of the cavity surface and streaking on blood agar plates. The absence of archaea on the tooth’s surface and surrounding area was confirmed by PCR targeting archaeal 16S rRNA and mcrA genes as described below. All subsequent procedures were performed aseptically. The pulp chamber was accessed with sterile burs refrigerated in saline. The samples were collected with four sterile paper points, which were consecutively placed in the canal to the total length calculated from the preoperative radiograph. Afterwards, the four paper points per root canal were pooled in a sterile tube containing 1 ml reduced transport fluid (33). The samples were transported on dry ice by an overnight delivery service to the Division of Oral Microbiology (RWTH Aachen University Hospital, Germany) for subsequent molecular analysis. Extraction of total genomic DNA. Prior to DNA extraction, the deep-frozen endodontic samples were thawed and dispersed by vortexing for 15 s. Microbial DNA from endodontic samples as well as DNA from pure cultures was extracted and purified with a Qiamp DNA minikit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. The DNA concentration (A260) and the purity (A260/A280) were calculated using a Gene Quant II photometer (Pharmacia Biotech, Cambridge, England). General conditions for RTQ-PCR. Amplification and detection of DNA by RTQ-PCR were performed on a LightCycler 2.0 (Roche Applied Science, Penzberg, Germany) using LightCycler FastStart DNA MasterPlus SYBR Green I in a total volume of 20 ␮l. Final reaction mixtures contained 100 nM of each primer and 3 ␮l of template DNA (approximately 75 ng). Primer sequences as well as the temperature profiles used for the detection of mcrA genes from methanogenic archaea, 16S rRNA genes from total archaea, and 16S rRNA genes from total bacteria are specified in Table 1. Data acquisition and subsequent analysis were performed using LightCycler software 3.5 (Roche Applied Science). Melting curve analysis was performed to determine the melting point of the amplification products and to assess reaction specificity. To avoid any possible primer dimer interference, the temperature at which the fluorescence was read during each cycle was adjusted to a degree just below the melting point of the amplification product. The amount of initial target DNA was calculated by determining the crossing point, i.e., the cycle at which the fluorescence exceeds a threshold value significantly higher than the background fluorescence. Quantification was performed using the automated (default) algorithm, a strategy that calculates the crossing point as the first maximum of the second derivative of the amplification curve. The conversion of crossing points to initial gene target molecule numbers was

1276

VIANNA ET AL.

based on dilution series of target DNA with defined target molecule amounts as described below. Abundance data determined for archaea and bacteria in this study will be referred to as target molecule numbers of the respective genes analyzed. All samples were run in triplicate, and the mean value was used for analysis. The coefficient of variation of the crossing point values among replicates was below 1%. Quantification of archaea. DNA from M. oralis DSM 7256T was amplified with the mcrA-specific primers LuF and LuR and with universal archaeal primers A109f and A934b (Table 1), and the resulting amplicons were cloned into a plasmid by using the TOPO TA cloning kit (Invitrogen Corp., San Diego, CA), following the protocol of the manufacturer. After reamplification with vectorspecific primers (M13F and M13R), the PCR products were purified using the QIAGEN purification kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. Purified PCR products were subsequently quantified with the PicoGreen double-stranded DNA quantification kit (Molecular Probes, Leiden, The Netherlands). Knowing the exact size of the amplicons (Table 1) and using the average molecular weight of a single DNA base pair, the measured DNA amount could then be converted to target molecule numbers per microliter. Dilution series of these PCR products were then used as calibration standards for measuring samples with unknown contents of methanogens and archaea by using the assay primers LuF/LuR and A109f/A934b by RTQ-PCR (Table 1). The linear scope of detection for both assays ranged from 102 to 108 target molecule numbers, with amplification efficiencies of 1.88 (error, 0.01) for the mcrA-based assay and 1.88 (error, 0.05) for the archaeal 16S rRNA genebased assay. Quantification of bacteria. DNAs from five bacterial species that have been frequently found in endodontic infections were used to establish the standard curve. The representatives of A. odontolyticus, E. faecalis, F. nucleatum, P. nigrescens, and T. forsythia were amplified using the universal bacterial primers PF1 and PR1 (Table 1). The resulting amplicons were purified and quantified as described above, again enabling the conversion of the DNA amount to target molecule numbers. Dilution series of the PCR products from all five bacterial species were then used as calibration standards for measuring samples with unknown contents of bacteria, using the universal bacterial primers EuF/EuR as assay primers for RTQ-PCR (Table 1). The latter primer system has been shown to cover a broad range of bacterial taxa (15, 26). The mean amplification efficiency for the five species was 1.95 (coefficient of variation, 2%; error range, 0.03 to 0.07). Sequencing and phylogenetic analysis. Preparation of plasmid DNA, PCR amplification of cloned inserts, and nonradioactive sequencing were carried out as described previously (14). Sequences for M. oralis DSM 7256T were determined from cloned PCR products from the mcrA gene and the 16S rRNA gene. Sequences for M. smithii DSM 861T and for the endodontic samples were determined by direct sequencing (i.e., without cloning) of the respective PCR products. The identities of the mcrA and 16S rRNA gene sequences were confirmed by searching the international sequence databases using the BLAST program (http://www.ncbi.nlm.nih.gov/BLAST/). The currently available database of mcrA gene sequences was integrated within the ARB program package (23). DNA sequences were analyzed and edited using the alignment tools implemented in ARB. Phylogenetic tree reconstruction was performed using the neighbor-joining approach (29) with the Felsenstein correction. Nucleotide sequence accession numbers. The partial gene sequences determined in this study (i.e., the mcrA and 16S rRNA gene sequences of M. oralis and of the endodontic samples as well as the mcrA gene sequence of M. smithii) have been deposited in the EMBL, GenBank, and DDBJ nucleotide sequence databases under accession numbers DQ251043 to DQ251051.

RESULTS Identification of mcrA and 16S rRNA genes specific to archaea. Using the PCR assay based on the mcrA gene, we found 5 of the 20 cases, or 25%, to be positive for methanogens (samples Endo4, Endo12, Endo14, Endo15, and Endo17) (Table 2). Melting curve analysis as well as agarose gel electrophoresis confirmed the identity of the target gene (data not shown). In order to assess whether archaea other than methanogens might also be present in infected root canals, a second PCR assay based on broad-range 16S rRNA primers targeting the domain Archaea was tested. While the mcrA-positive samples were also positive with the archaeal 16S rRNA-based PCR approach, the remaining 15 samples were negative. Again

J. CLIN. MICROBIOL. TABLE 2. Total load of bacteria and archaea, expressed as 16S rRNA gene target molecule numbers, determined by RTQ-PCR from 20 root canals with primary endodontic infections Sample

Total bacteria

Total archaea

% Archaeaa

Endo1 Endo2 Endo3 Endo4 Endo5 Endo6 Endo7 Endo8 Endo9 Endo10 Endo11 Endo12 Endo13 Endo14 Endo15 Endo16 Endo17 Endo18 Endo19 Endo20

2.5 ⫻ 106 3.5 ⫻ 106 6.0 ⫻ 106 1.0 ⫻ 108 4.5 ⫻ 107 8.2 ⫻ 106 7.8 ⫻ 107 8.1 ⫻ 106 7.1 ⫻ 106 1.0 ⫻ 108 2.8 ⫻ 107 1.2 ⫻ 108 4.2 ⫻ 107 4.5 ⫻ 107 2.1 ⫻ 108 3.2 ⫻ 106 1.5 ⫻ 107 8.3 ⫻ 106 1.4 ⫻ 108 4.0 ⫻ 107

0 0 0 6.8 ⫻ 105 0 0 0 0 0 0 0 6.7 ⫻ 105 0 1.3 ⫻ 105 5.8 ⫻ 105 0 3.9 ⫻ 105 0 0 0

0 0 0 0.68 0 0 0 0 0 0 0 0.56 0 0.29 0.28 0 2.53 0 0 0

a Percentage refers to total prokaryotic 16S rRNA gene levels (bacteria plus archaea).

melting curve analysis and gel electrophoresis confirmed the accuracy of the amplified gene fragments (data not shown). Direct sequencing of the archaeal 16S rRNA gene PCR products (i.e., without cloning) was performed, and an ambiguityfree sequence could be obtained for sample Endo12. Preliminary identification by searching the GenBank database revealed M. oralis as the closest relative. For a thorough phylogenetic analysis, a 794-bp stretch of the 16S rRNA gene of M. oralis DSM 7256T was sequenced and incorporated into the ARB database along with the sequence type obtained from sample Endo12. Figure 1 shows the phylogenetic affiliations of these 16S rRNA gene sequences in relation to representative members of the major phylogenetic groups within the domain Archaea (i.e., Euryarchaeota, Crenarchaeota, Korarchaeota, and Nanoarchaeota). Sample Endo12 was almost identical to M. oralis (⬎99%) and shared approximately 97% similarity with M. smithii. In addition to the 16S rRNA gene sequence of sample Endo12, we obtained ambiguity-free sequences from the mcrA gene PCR products of all five samples, allowing a “cross-linking” of the two data sets and thus the identification of the predominant archaeal population in all positively tested endodontic samples. Comparative sequence analysis by searching the GenBank database revealed a similarity value of about 80% to Methanobrevibacter ruminantium and Methanobrevibacter aboriphilus as the closest relatives. For proper phylogenetic tree reconstruction we also determined the mcrA gene sequences of M. oralis and M. smithii. Figure 2 shows the phylogenetic affiliation of these strains along with those of the oral samples tested in this study. The sequences obtained from endodontic samples were almost identical to each other (two to three nucleotide changes over the whole sequence) and grouped tightly with M. oralis, with a similarity of approximately 98%. These sequences formed a distinct evolutionary

VOL. 44, 2006


1277

FIG. 1. Phylogenetic tree showing the positions of 16S rRNA gene types identified in infected root canals of human teeth relative to those of representative members of the four major lineages from the domain Archaea. Sequences determined in this study are shown in boldface. The scale bar corresponds to 0.1 substitution per nucleotide. The tree was calculated using 798 nucleotide positions and the neighbor-joining approach (with the Felsenstein correction), via the ARB program package (23). The statistical significance levels of interior nodes, shown as percentages, were determined by performing bootstrap analyses (1,000 replications; only values over 50% are shown).

lineage, showing a sequence similarity of approximately 90% to M. smithii, with which they shared a common branching point. The sequence similarities to M. ruminantium and M. arboriphilus were 80% and 79%, respectively. The topology of a neighbor-joining tree calculated from the deduced amino acid sequences was in accordance with the nucleotide-based tree (data not shown), with M. oralis showing a similarity of 93% to M. smithii, 85% to M. ruminantium, and 86% to M. arboriphilus. On the protein level the sequences obtained from the endodontic samples were identical to M. oralis. In summary, these data indicate that root canals can be infected by an M. oralis-like species, which to our knowledge is the first archaeon that has been observed at this site. Assessment of total microbial load. We also determined the total number of archaea and bacteria in the infected root canals by real-time quantitative PCR. Within the 20 samples the bacterial load differed considerably and ranged from 2.5 ⫻ 106 to 2.1 ⫻ 108 16S rRNA gene target molecules (Table 2). In contrast, the total load of archaea was much more consistent within the five positive samples and ranged from 1.3 ⫻ 105 to 6.8 ⫻ 105 target molecules, with the proportion of archaea with respect to the total microbial community ranging from 0.28% to 2.53%. We also quantified the methanogenic population based on the RTQ-PCR of the functional mcrA gene. The total load of methanogenic archaea ranged from 3.3 ⫻ 104 to 2.8 ⫻

105 mcrA gene target molecules (Fig. 3). These values were consistently lower than those determined by 16S rRNA genebased RTQ-PCR. By targeting both genes, we also quantified a dilution series extracted from M. oralis and M. smithii. The ratio between 16S rRNA and mcrA gene target molecule numbers of M. oralis was comparable to the ratio determined for the oral samples Endo4 and Endo12 (ratios of 1.81, 2.43, and 2.39, respectively, calculated from the values shown in Fig. 3), while higher 16S/mcrA ratios were found with M. smithii (samples Endo14, Endo15, and Endo17 [ratios of 6.96, 3.94, 2.90, and 4.59, respectively, calculated from the values shown in Fig. 3]). Melting curve analysis performed by targeting the 16S rRNA gene showed one defined melting peak for both M. oralis and M. smithii as well as for the endodontic samples (Fig. 4A). In contrast, melting curve analysis performed by targeting the mcrA gene enabled discrimination between M. oralis and M. smithii (with the melting point differing by approximately 1°C) (Fig. 4B). The differentiability among other methanogenic species that are more distantly related was even more pronounced (Fig. 4C). DISCUSSION Prevalence and abundance of archaea in infected root canals. This study was based on an investigation of infected root canals of human teeth, which in the healthy condition consti-

1278

VIANNA ET AL.

J. CLIN. MICROBIOL.

FIG. 2. Phylogenetic tree showing the positions of the mcrA gene types identified in infected root canals of human teeth relative to those of representative members of methanogenic archaea. Sequences determined in this study are shown in boldface. The scale bar corresponds to 0.1 substitution per nucleotide. The tree was calculated using 464 nucleotide positions and the neighbor-joining approach (with the Felsenstein correction), via the ARB program package (23). The statistical significance levels of interior nodes, shown as percentages, were determined by performing bootstrap analyses (1,000 replications; only values over 50% are shown).

tute a sterile anatomical site. The fact that we detected methanogens in 5 of the 20 endodontic samples suggests that members of archaea can invade this naturally closed system and participate in the polymicrobial infection. Comparative sequence analysis of PCR products from archaeal 16S rRNA and mcrA genes demonstrated that archaeal diversity was confined to Methanobrevibacter oralis-like sequence types. Although we did not find a 100% match with this species, the few nucleotide differences among endodontic samples may represent sequencing errors, intraoperon variability, or different strains of a single species and thus may reflect only one defined archaeal phylotype. It is noteworthy that the prevalence of this archaeon is comparable to the prevalence of the bacterial phyla Fusobacteria and Actinobacteria, both of which include several recognized endodontic pathogens (30). We found M. oralis-like sequence types to be present in the root canal with about 105 to 106 16S rRNA gene target molecule numbers. A direct comparison with other endodontic pathogens is hardly possible, as the individual bacterial species in infected root canals

have to our knowledge not yet been quantified. Nonetheless, the medical importance of a given species might be better reflected by its proportion relative to the total microbial community at the infected site. The range of 0.28 to 2.53% for M. oralis found in our study was comparable to the relative proportion of methanogens previously reported in cases of moderate periodontal disease (20). Could the detection of M. oralis in infected root canals be due to contamination from periodontal pockets and/or the oral cavity? This is unlikely, first because M. oralis-like sequence types appear to be present at detectable levels only at diseased sites of periodontal diseases and not at healthy sites from the same patients (20), and the teeth selected for our study showed no evidence of gingivitis or periodontal diseases. Second, the surfaces of the infected teeth and the surrounding area were isolated and thoroughly disinfected prior to sampling, and lack of contamination was confirmed afterwards by archaeal 16S rRNA gene- and mcrA-based RTQ-PCR (see Materials and Methods).

VOL. 44, 2006


1279

FIG. 3. Comparison of 16S rRNA gene target molecule numbers (white bars) with mcrA gene target molecule numbers (gray bars), determined by RTQ-PCR from pure cultures and from samples obtained from primary endodontic infections. Error bars indicate standard deviations from three replicate RTQ-PCR runs. Mo, M. oralis; Ms, M. smithii.

Detection of methanogens in clinical samples. Because methanogens might be the only archaea in the human body and yet are impossible to cultivate on normal laboratory media, the mcrA gene might represent a valuable marker gene for a universal screening for archaea in clinical samples. We consistently detected higher levels of archaeal 16S rRNA target molecules than mcrA target molecules, probably due to different numbers of operons per cell for both genes. The operon numbers of 16S rRNA genes have been reported to range from one to four copies in archaea (1), while methanogens harbor one to two copies of the mcrA gene (25). We found a 16S rRNA/mcrA ratio in M. oralis of approximately 2 (Fig. 3). A comparable ratio was also determined for samples Endo4 and Endo12, while higher ratios were determined for the remaining endodontic samples. This could indicate the presence of nonmethanogenic archaea (not detectable by the mcrA-based approach), cross-reaction of archaeal 16S primers with bacterial 16S rRNA genes, and/or variability in operon numbers between closely related methanogenic strains. These methodological constraints hamper the precise determination of methanogenic cells by 16S rRNA analysis but favor the use of mcrA as a molecular marker for quantification due to its specificity for methanogens and the principal lower number of operons present per cell. This gene has another advantage for characterizing methanogens, as it allows a fine-scale resolution of closely related methanogenic species, which becomes evident when comparing the topology of the 16S rRNA gene-based tree (Fig. 1) with that of the mcrA-based tree (Fig. 2). In principal, the mcrA-based phylogeny is consistent with the 16S rRNA gene-based phylogeny of methanogens (25); however, the trees differ in their branch lengths separating individual sequences. The reason for this is prob-

ably the accumulation of synonymous (neutral) mutations in the third codon position that do not lead to changes of amino acid residues but clearly facilitate stronger differentiation of mcrA sequence types. Thus, sequence detection of mcrA genes in clinical samples might provide valuable information not only about the prevalence of methanogens in human infectious diseases but also about the functional diversity of such putative pathogens. Although direct sequencing is the gold standard for reliably identifying methanogenic species in clinical samples without culturing, melting curve analysis of mcrA RTQ-PCR products might enable a preliminary identification. This is because the relatively high degree of diversity among mcrA gene types facilitates a differentiation of even closely related species, such as M. oralis and M. smithii, by their individual melting profiles. Such a differentiation is not possible by melting curve analysis of the respective 16S rRNA gene PCR products (Fig. 4). Role of methanogens in infected root canals. Most methanogens, including members of the genus Methanobrevibacter, metabolize molecular hydrogen (H2) and carbon dioxide (CO2) with methane as the resultant product. Hydrogen is a crucial intermediate product in anoxic environments, as a balance of hydrogen-producing and hydrogen-consuming processes is necessary for the efficient anaerobic digestion of organic matter (8). This is due to the unfavorable energetics of fermentation reactions in the presence of even low concentrations of hydrogen. While the root canal infection is a dynamic process in which various bacterial species dominate at different stages of the infection due to changes in the availability of nutrition, oxygen level (redox potential), and the local pH, the hydrogen concentration might steadily increase until it reaches

1280

VIANNA ET AL.

J. CLIN. MICROBIOL.

FIG. 4. Dissociation curves of archaeal 16S rRNA gene PCR products (A) and methanogenic mcrA gene PCR products (B and C). E, endodontic samples; Mo, M. oralis; Ms, M. smithii; Mb, M. bryantii; Mm, M. maripaludis; Mh, M. hungatei; NTC, nontarget control.

a level too high to sustain further microbial growth. By consuming H2, methanogens therefore could play an important role in supporting microbial growth and driving the infection process in root canals. Such an “interspecies hydrogen transfer” between anaerobic bacteria and methanogens is known from natural environments and seems to be an important factor for ecosystem functioning (6, 8, 22). The fact that we did not find methanogens in all endodontic samples could be due to a different species combination in the root canal (i.e., no hydrogen-producing microorganisms and thus no substrate availability for methanogens) or to exclusion by other hydrogen-metabolizing bacteria. For instance, dissimilatory sulfate-reducing bacteria such as those of the genera Desulfomicrobium and Desulfovibrio are potential competitors for H2. Members of both genera have been found in periodon-

tal pockets (19) but so far not in endodontic infections according to our own investigations (data not shown) using RTQPCR primers specific to the gene dsrAB, encoding the key enzyme dissimilatory sulfite reductase, which is conserved in all known sulfate-reducing bacteria (36). Other microbial H2 competitors, for example, Treponema populations (20), or unfavorable environmental conditions such as host-microbe interactions could be responsible for the absence of methanogens from those sites. Nonetheless, the presence of methanogens in relatively high numbers (as mentioned above) in some but not all cases of primary endodontic infections indicates that they find favorable conditions that allow growth coupled with syntrophic interactions with other endodontic pathogens. Our findings are in contrast to a recent study in which a survey of 96 cases was performed to search for archaea in

VOL. 44, 2006

endodontic infections (31). Those authors did not find evidence for the presence of archaea in human endodontic infections and concluded that they are not implicated in the etiology of apical periodontitis. Although it is unclear why they did not detect methanogens in any of their samples, the most plausible reason might be the different primer systems used. We retested the universal archaeal primers used by Siqueira et al. (31) under same conditions by conventional PCR and by RTQ-PCR. Of five tested methanogenic isolates only three, Methanococcus maripaludis, Methanoplanus endosymbiosus, and Methanospirillum hungatei, could be amplified (data not shown). In contrast, M. oralis and M. smithii, which are known colonizers of the human body as well as the clinical samples that had tested positive in our study, were not amplifiable by their primer system. A subsequent database search of archaeal 16S rRNA genes through the ARB phylogenetic software package (23) showed mismatches of the forward primer Arch21F (11, 31) with several members from the domain Euryarchaeota. It is therefore plausible that methanogens were overlooked by Siqueira et al. (31) due to the primer set used. Archaea as human pathogens. Molecular and cultural studies have shown that various bacterial taxa, both cultivable and uncultivable, can be detected in infected root canals (30). However, an association of archaea with apical periodontitis has, to our knowledge, not been described so far. As archaea such as methanogens are essential syntrophic partners in many anaerobic systems, there is good reason to assume that they have an analogous function in root canal infections and probably also in other mixed anaerobic infections. This raises the interesting question as to whether some archaea can be considered potential human pathogens; that is, do they have features or strategies that characteristically distinguish pathogenic bacteria from commensals? This issue has recently been addressed by two different research groups (7, 12), both of which compiled literature data about archaea in possible association with human disease. For instance, higher levels of breath methane (produced by methanogens) have been detected in patients with precancerous conditions (ulcerative colitis and colonic polyposis) and cancer of the colon. Cell wall structures of the archaeon Sulfolobus solfataricus have been demonstrated to exhibit toxic activity similar to that of lipopolysaccharides in mice and rabbits, indicating a genetically programmed immune response in those animals that recognizes archaea as potential pathogens. Furthermore, various toxin/antitoxin systems have been found in Methanococcus jannaschii, Archaeoglobus fulgidus, and haloarchaea. In addition, virulence genes for lipopolysaccharide biosynthesis and the tadA gene (e.g., required by Actinobacillus actinomycetemcomitans for nonspecific adherence) have been identified in archaea (reviewed in references 7 and 12). In summary, these authors (7, 12) have developed a meaningful perspective concerning the potential for archaea to cause disease, yet there is still a large gap in knowledge regarding the diversity and abundance of archaea in the human body and the types of interactions they are engaged in with human cells and other microbes. Our results show that methanogens are implicated in an oral infectious disease and thus support the hypothesis that members of Archaea might function as human pathogens.


1281

ACKNOWLEDGMENTS This work was supported by the Brazilian grant agencies CAPES (BEX 3410/04-8) and FAPESP (02/13980-9) and the START program of the Faculty of Medicine, RWTH, Aachen, Germany. We thank Dana Kemnitz and Ralf Conrad, Max-Planck-Institute for Terrestrial Microbiology, Marburg, Germany, for kindly donating some methanogenic strains. We thank Ilse Seyfarth and Vreni Merriam for various forms of assistance. REFERENCES 1. Acinas, S. G., L. A. Marcelino, V. Klepac-Ceraj, and M. F. Polz. 2004. Divergence and redundancy of 16S rRNA sequences in genomes with multiple rrn operons. J. Bacteriol. 186:2629–2635. 2. Barns, S. M., C. F. Delwiche, J. D. Palmer, and N. R. Pace. 1996. Perspectives on archaeal diversity, thermophily and monophyly from environmental rRNA sequences. Proc. Natl. Acad. Sci. USA 93:9188–9193. 3. Barns, S. M., R. E. Fundyga, M. W. Jeffries, and N. R. Pace. 1994. Remarkable archaeal diversity detected in a Yellowstone-National-Park hot-spring environment. Proc. Natl. Acad. Sci. USA 91:1609–1613. 4. Belay, N., R. Johnson, B. S Rajagopal, E. C. de Macario, and L. Daniels. 1988. Methanogenic bacteria from human dental plaque. Appl. Environ. Microbiol. 54:600–603. 5. Belay, N., B. Mukhopadhyay, D. M. Conway, R. Galask, and L. Daniels. 1990. Methanogenic bacteria in human vaginal samples. J. Clin. Microbiol. 28:1666–1668. 6. Bonchosmolovskaya, E. A., and K. O. Stetter. 1991. Interspecies hydrogen transfer in cocultures of thermophilic archaea. Syst. Appl. Microbiol. 14:205–208. 7. Cavicchioli, R., P. M. G. Curmi, N. Saunders, and T. Thomas. 2003. Pathogenic archaea: do they exist? Bioessays 25:1119–1128. 8. Conrad, R. 1999. Contribution of hydrogen to methane production and control of hydrogen concentrations in methanogenic soils and sediments. FEMS Microbiol. Ecol. 28:193–202. 9. Conrads, G., S. E. Gharbia, K. Gulabivala, F. Lampert, and H. N. Shah. 1997. The use of a 16S rDNA directed PCR for the detection of endodontopathogenic bacteria. J. Endod. 23:433–438. 10. Conrads, G., K. Pelz, B. Hughes, I. Seyfarth, and D. A. Devine. 1997. Optimized oligonucleotides for the differentiation of Prevotella intermedia and Prevotella nigrescens. Oral Microbiol. Immunol. 12:117–120. 11. DeLong, E. F. 1992. Archaea in coastal marine environments. Proc. Natl. Acad. Sci. USA 89:5685–5689. 12. Eckburg, P. B., P. W. Lepp, and D. A. Relman. 2003. Archaea and their potential role in human disease. Infect. Immun. 71:591–596. 13. Grosskopf, R., P. H. Janssen, and W. Liesack. 1998. Diversity and structure of the methanogenic community in anoxic rice paddy soil microcosms as examined by cultivation and direct 16S rRNA gene sequence retrieval. Appl. Environ. Microbiol. 64:960–969. 14. Horz, H.-P., R. Virginia, S. Avrahami, and B. J. M. Bohannan. 2005. Methaneoxidizing bacteria in a California upland grassland soil: diversity and response to simulated global change. Appl. Environ. Microbiol. 71:2642–2652. 15. Horz, H.-P., M. E. Vianna, B. P. Gomes, and G. Conrads. 2005. Evaluation of universal probes and primer sets for assessing total bacterial load in clinical samples: general implications and practical use in endodontic antimicrobial therapy. J. Clin. Microbiol. 43:5332–5337. 16. Kakehashi, S., H. R. Stanley, and R. J. Fitzgerald. 1965. The effects of surgical exposures of dental pulps in germ-free and conventional laboratory rats. Oral Surg. Oral Med. Oral Pathol. 20:340–349. 17. Karlin, D. A., R. D. Jones, J. R. Stroehlein, A. J. Mastromarino, and G. D. Potter. 1982. Breath methane excretion in patients with unresected colorectal cancer. J. Natl. Cancer Inst. 69:573–576. 18. Kulik, E. M., H. Sandmeier, K. Hinni, and J. Meyer. 2001. Identification of archaeal rDNA from subgingival dental plaque by PCR amplification and sequence analysis. FEMS Microbiol. Lett. 196:129–133. 19. Langendijk, P. S., E. M. Kulik, H. Sandmeier, J. Meyer, and J. S. van der Hoeven. 2001. Isolation of Desulfomicrobium orale sp nov and Desulfovibrio strain NY682, oral sulfate-reducing bacteria involved in human periodontal disease. Int. J. Syst. Evol. Microbiol. 51:1035–1044. 20. Lepp, P. W., M. M. Brinig, C. C. Ouverney, K. Palm, G. C. Armitage, and D. A. Relman. 2004. Methanogenic archaea and human periodontal disease. Proc. Natl. Acad. Sci. USA 101:6176–6181. 21. Love, R. M., and H. F. Jenkinson. 2002. Invasion of dentinal tubules by oral bacteria. Crit. Rev. Oral Biol. Med. 13:171–183. 22. Lovley, D. R. 1985. Minimum threshold for hydrogen metabolism in methanogenic bacteria. Appl. Environ. Microbiol. 49:1530–1531. 23. Ludwig, W., O. Strunk, R. Westram, L. Richter, H. Meier, Yadhukumar, A. Buchner, T. Lai, S. Steppi, G. Jobb, W. Forster, I. Brettske, S. Gerber, A. W. Ginhart, O. Gross, S. Grumann, S. Hermann, R. Jost, A. Konig, T. Liss, R. Lussmann, M. May, B. Nonhoff, B. Reichel, R. Strehlow, A. Stamatakis, N. Stuckmann, A. Vilbig, M. Lenke, T. Ludwig, A. Bode, and K. H. Schleifer. 2004. ARB: a software environment for sequence data. Nucleic Acids Res. 32:1363–1371.

1282

VIANNA ET AL.

24. Lueders, T., K. J. Chin, R. Conrad, and M. Friedrich. 2001. Molecular analyses of methyl-coenzyme M reductase alpha-subunit (mcrA) genes in rice field soil and enrichment cultures reveal the methanogenic phenotype of a novel archaeal lineage. Environ. Microbiol. 3:194–204. 25. Luton, P. E., J. M. Wayne, R. J. Sharp, and P. W. Riley. 2002. The mcrA gene as an alternative to 16S rRNA in the phylogenetic analysis of methanogen populations in landfill. Microbiology 148:3521–3530. 26. Nadkarni, M. A., F. E. Martin, N. A. Jacques, and N. Hunter. 2002. Determination of bacterial load by real-time PCR using a broad-range (universal) probe and primers set. Microbiology 148:257–266. 27. Nair, P. N. 2004. Pathogenesis of apical periodontitis and the causes of endodontic failures. Crit. Rev. Oral Biol. Med. 15:348–381. 28. Relman, D. A., and S. Falkow. 2000. A molecular perspective of microbial pathogenicity, p. 2–13. In G. L. Mandell et al. (ed.), Principles and practice of infectious diseases, 5th ed. Churchill Livingstone, Philadelphia, Pa. 29. Saitou, N., and M. Nei. 1987. The neighbor-joining method—a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406–425. 30. Siqueira, J. F. 2003. Taxonomic changes of bacteria associated with endodontic infections. J. Endod. 29:619–623.

J. CLIN. MICROBIOL. 31. Siqueira, J. F., I. N. Rocas, J. C. Baumgartner, and T. Xia. 2005. Searching for archaea in infections of endodontic origin. J. Endod. 31:719–722. 32. Stahl, D. A., and R. Amann. 1991. Development and application of nucleic acid probes in bacterial systematics, p. 205–248. In E. Stackebrandt and M. Goodfellow (ed.), Nucleic acid techniques in bacterial systematics. John Wiley & Sons Ltd., Chichester, England. 33. Syed, S. A., and W. J. Loesche. 1972. Survival of human dental plaque flora in various transport media. Appl. Microbiol. 24:638–644. 34. Thauer, R. K. 1998. Biochemistry of methanogenesis: a tribute to Marjory Stephenson. Microbiology 144:2377–2406. 35. Vianna, M. E., H.-P. Horz, B. P.Gomes, and G. Conrads. 2005. Microarrays complement culture methods for identification of bacteria in endodontic infections. Oral Microbiol. Immunol. 20:253–258. 36. Wagner, M., A. J. Roger, J. L. Flax, G. A. Brusseau, and D. A. Stahl. 1998. Phylogeny of dissimilatory sulfite reductases supports an early origin of sulfate respiration. J. Bacteriol. 180:2975–2982. 37. Woese, C. R., O. Kandler, and M. L. Wheelis. 1990. Towards a natural system of organisms: proposal for the domains Archaea, Bacteria, and Eucarya. Proc. Natl. Acad. Sci. USA 87:4576–4579.