(1990) Mol. Endocrinol. 4 , 1866-1873. 37. Baulieu, E. E., and Segal, S. J. (1985) in The Antiprogesterone. RU486 in Human Fertility Control, Plenum Publishing ...
THEJOURNAL OF BIOLOGICAL CHEMISTRY IC:! 1991 by The American Society for Biochemistry and Molecular Biology, Inc
Vol. 266, No. 27, Issue of September 25, pp. 18268-16275,1991 Printed in U.S.A.
Identification of a Glucocorticoid Response Element Contributing to the Constitutive Expression ofthe Rat Liver a,-Inhibitor I11 Gene* (Received for publication, December 24, 1990)
Lawrence J. Abraham$, Amy D. BradshawQ, Wolfgang Northemannn,and Georg H. Fey11 From the Department of Immunology, Research Institute of Scripps Clinic, La Jolla, California 92037
al-Inhibitor I11 (a113),a broad range plasma protein- treated and dexamethasone-treatedFAZA cells, simiase inhibitor,is synthesized with striking tissue spec- lar extentsof a113promoter upstream sequences were ificity in rat livers. The gene is expressed strongly in protected, indicating that proteins capable of binding periportal hepatocytesof healthy adults and less abun- in the glucocorticoid response-mediating element dantly in regions near the centrilobular vein. This (GME) region were present before andafter arrival of expression pattern is suggestive of a concentration the hormonal signal. However,a purified recombinant gradient of a blood-borne hormonethat enters through fragment of the GR which contained essentially only the portal vein and diffuses across lobe the toward the its DNA binding domain was unable to at bind theGME although it interacted strongly witha consensus GRE centrilobular vein. The a113 gene was known to be regulated both by glucocorticoids and interleukin 6, sequence. and therefore the hypothesis was tested that the normal constitutive expression of this gene depended on glucocorticoids. al13 mRNA levels in the livers of hypophysectomized rats with low endogenous glucocoral-inhibitor I11 (al13),’like many of the acute phase proticoid levels were only about 20% of those in control teins, is a broad range proteinase inhibitor. It is the second r a t livers. Injection of exogenous glucocorticoids re- most abundant plasmaglobulin in rats witha plasma concenconstituted hepatic al13 mRNA levels up to 64% of tration in the range of6-10 mg/ml. a113 belongs to the atheir original values aindose-dependent manner. Sim- macroglobulinfamily of thiolester proteins which also inilarly, treatmentof FAZA rat hepatoma cells with the cludes al-macroglobulin, a,-macroglobulin, and the complesynthetic glucocorticoid dexamethasone induced u113 ment components C3, C4 and C5 (1-3). Unlike a,-macroglobmRNA levels in a dose-dependent manner. Taken toulin, which is strongly induced, and al-macroglobulin,which gether these data suggested that glucocorticoids are required for the constitutive high level expressionof is affected onlyvery little by acute inflammations, a113 is this gene in normal adult rat livers. A series of 5’ strongly down-regulated duringan acute phase inflammatory deletion constructs and linker scanning mutants of the response (4): during the first 2 days after an inflammation al13 plasma concentrations fall to 1-2 mg/ml. It is the most promoter upstream region were produced and transfectedinto FAZA cells. A functional glucocorticoid strongly down-regulated “negativeacutephaseprotein” response element was mapped between-168 and -151 known to date in rat plasma. In previous studies a113 cDNA to that base pairs 5’ of the transcription start site. This ele- clones were isolated and characterized and used show ment conforms with an inverted consensus glucocorti- al13 mRNA levels decreased during an inflammation to an coid response element (GRE) but differs in two posi- extent similar to that seenfor al13 plasma levels (5-7). The transcription rate of the al13 gene was decreased 12.7-fold at tions essential for protein DNA interaction between the GRE and the glucocorticoid receptor (GR). The 6h afteranexperimentally induced inflammation witha induction of a113 gene promoter region constructs by concomitant 16-fold decrease in nuclear aJ3 precursor RNA dexamethasone was abolished by the receptor antago- concentrations (8). nist RU486, indicating that the GR participated in the Recently we have analyzed the inflammatory signals that activation of the al13 gene. In DNase I footprinting are responsible for the acute phasenegative regulation of the al13 gene in rat hepatomacell lines (9). In that studywe have experiments with nuclear protein extracts from unestablished that interleukin 6 and glucocorticoids can regulate * This work was supported by Grants A122166 and A123351 from the al13 gene both in a positive and in a negative direction, the National Institutes of Health (to G. H. F.) and by International depending on the precise concentrations of both hormones. Fellowship 1F05TW04073-01fromtheFogartyCenter,National We have also identified recently the transcriptional control Institutes of Health (toL. J. A,). This is publication 6641-1“ from the Departmentof Immunology, Research Instituteof Scripps Clinic. elements in the 5’ region of the al13 gene which are responThe costs of publication of this article were defrayed in part by the sible for the highly tissue-specific expression seenin ratlivers and have begun to characterize the hepatic nuclear factors payment of pagecharges. Thisarticlemusttherefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 that bind to these elements (10). solely to indicate this fact. There is evidence for lobular heterogeneity of hepatocytes, $Presentaddress:Dept. of ClinicalImmunology,Royal Perth showing systematic differences in the expression of plasma Hospital, Wellington St., Perth, Australia,6001. Presentaddress: University of California, Santa Barbara, CA proteins depending on their topographic location in theliver 93163-9963. 1 Presentaddress:Elias,EntwicklungslaborfurImmunoassays GmbH, Obere Hardtstrasse 18, D7800 Freiburg, Germany. 11 To whom correspondence should be addressed: Research Institute of Scripps Clinic, 10666 N. Torrey Pines Rd., La Jolla, CA 92037. Tel.: 619-554-8059; Fax: 619-554-6705.
The abbreviations used are: ul13, ul-inhibitor 111; GR, glucocorticoid receptor; GRE, glucocorticoid response element; GME, glucocorticoid response-mediating element; bp, base pairs; AGP, acid glycoprotein; LAP, liver activator protein; HBS, Hepes-buffered saline; EGTA, [ethylenebis(oxyethylenenitrilo)]tetraaceticacid.
18268
Variant Glucocorticoid Response Element of the a113Gene
18269
detected after electrophoresis through a denaturing polyacrylamide lobule(11, 12). For example, in normal adult rat liversa gel and autoradiography. higher frequency of expression of a113 mRNA and protein FAZA Hepatoma Cell Culture andTransfection-The rat hepatoma was observed in hepatocytes of the periportal and mediolob- cell line, FAZA (22), and stably transfected derivatives were grown ular areas than in the perivenous zones (11). One possible in a 1:1 mixture of Dulbecco's modified Eagle's medium and Ham's interpretation of these datawas that various hormones enter- F-12 nutrient solution (GIBCO).Media were supplemented with 10% ing the liver through the portal vein could create a hormone fetal bovine serum 100 units/ml penicillin and streptomycin. Cells of 5% CO, at 37 "C. concentration gradient across the lobe which is reflected in were cultured in 100-mm dishes in an atmosphere For dexamethasone (Upjohn) and RU486 (Roussel Uclaf) treatment, the gradient of a113 RNA and protein concentrations. We cells were grown to 90% confluence (approximately 5 X 10" cells/100knew that glucocorticoids are present in the systemic circu- mm Petri dish) and supplemented with hormone. lation of normalhealthyadultratsintheabsence of an Transfection was carriedout by amodifiedcalcium phosphate precipitation technique (23). Plasmid DNA to be used fortransfection inflammatory state in concentrationsof approximately was isolated using an alkaline lysis procedure (24) and purified by IO-' M (13) and that expression of a113 in cultured hepatic chloride equilibrium centrifugation steps. cells was sensitive to low levels of glucocorticoids (less than twosuccessivecesium FAZA cells were plated to be 60% confluent after overnight incuba10"" M (9)). Therefore, we wanted to test the hypothesis thattion. Prior to transfection the cells were washed three times with glucocorticoids may be the principal hormones responsible for Hepes-buffered saline (HBS; 10 mM Hepes, pH 7.3,6.7 mM potassium the maintenance of the normal constitutive expressionlevels chloride, 142 mM sodium chloride). The DNA precipitate was formed by dropwise addition of 250 mM calcium chloride to an HBS solution of al13 in adult rat liver tissue. Here we demonstrate that the al13 gene was regulated by containing 7.5 mM Na2HP0, and 20 pg/ml test plasmid DNA plus 1 glucocorticoids at the transcriptional level through a response pg/ml pRSVCAT (25). After incubation in fresh medium for 1 h the cells were incubated for 6 h with the precipitate. Thecells were then element that was a variant of the consensus glucocorticoid shocked with 25% glycerol (in HBS) for 2 min, washed three times response element (GRE) found in many other genes regulated withHBS,andincubatedinfreshmedium for 40 h. Transient by glucocorticoids (14-16). This elementdiffered from a con- transfectants were then assayed for luciferase activity. Stable transventional GRE in thatwas it not sufficient to binda truncated fectants were split 1:l andgrown in the presenceof 400 pg/ml '2418 recombinant glucocorticoid receptor (GR) fragment that con-(GIBCO) for 3 weeks with a change of medium every 5 days. Pools of 500 stable G418-resistant cloneswere mixed, replated, tained essentially only the DNA binding domain (17). The approximately and passaged for 2 weeks. element foundin the al13gene partially overlapped with other Luciferase assays were performedas described(21,27).After elements important for the liver-specific expression of this transfection, cell extracts were prepared as follows. After washing gene which were mapped previously (10). Therefore, binding three times with HBS, the cells were scraped off the dish into 100 mM potassium phosphate, p H 7.2, 1 mM dithiothreitol, washed, and of the GR at this variant element may require additional subjected to three freeze-thaw cycles. After lysis and removal of the contacts with other DNA-binding proteins attachedneighto cell debris by centrifugation, constant amounts of protein (120 pg) boring sites. The results alsosuggest that glucocorticoids are were assayed for luciferaseactivity using a Monolight2001 luminomeindeed required for the constitutive expression of the al13 ter (Analytical LuminescenceLaboratories,San Diego, CA).The gene in normal healthy adult ratlivers. relative efficiency of transfection in each experimentwas monitored by assaying for the production of constant amounts of chloramphenicol acetyltransferase (26) generated by the cotransfected pRSVCAT Treatment of Animals and Preparation of RNA-Normal and hy- construct. a1Z3Luciferase Fusion Genes-A nested setof 5' deletions containpophysectomizedmale Fisher 344 rats, weighing 125-150 g, were ing al13 promoter fragments extending from -2214 bp to + 58, which obtained from Charles River Laboratories. After surgery,animals were allowed to recover for a t least 6 weeks. Only rats that showed had been introduced into the transcriptionvector, pl9LUC (27),was availablefromaprevious study(10).Thisconstruction produced no increase in their body weight and the absenceof testicular development were used. When required, hypophysectomized animals were fusion genes consisting of the 5'-noncoding sequences of the rvl13 injected intraperitoneally with the indicated concentrations of dexa- gene linked to the coding region of the firefly luciferase gene. Nuclear Extract Preparation-FAZA nuclear extracts were premethasone in 0.5 ml of phosphate-buffered saline. Control animals pared from tissue culturecells that hadreached 90% confluence. The wereinjected with 0.5 ml of phosphate-bufferedsaline.Afterthe cells were detached from the dishes using trypsin EDTA, and extracts appropriate time interval rats were killed and the liver removed for were prepared according to the method of Shapiro et al. (28) and RNA preparation. Three animalswere used per data point. dialyzed against 20 mM Hepes, pH 7.9,20% glycerol (v/v), 0.2 mM RNA Preparation, Dot-blot Hybridization, and PrimerExtensionEDTA, 2 mM EGTA, 2 mM dithiothreitol, 60 mM potassium chloride. Total RNA was prepared from both normal and hypophysectomized After dialysis, the extracts were stored in liquid Nr until needed. rat livers using a guanidinium hydrochloride procedure as described DNase Z Footprinting and Gel Retardation Assays-DNase I footpreviously (18). RNA was isolat,ed from cultured cell lines using a printreactions(29) were carriedoutwithunfractionated nuclear guanidlnium thiocyanate lysis procedure followed by ultracentrifuextracts. The -225 to -81 fragment from the aI13 promoter region gation through a cesium chloride step gradient (19). The concentra- was isolated, end labeled with the Klenow fragment of DNA polymtion of the RNA was determined by measuring the absorptiona t 260 erase I, and thenrecleaved with either Ssp1 or EcoRI followed by gel and 280 nm. Both the integrity and the relative concentrations of the purification. Theglucocorticoid response element containing pGTCO RNA samples were monitored by electrophoresis in formaldehydeplasmid2 was preparedsimilarlyafter cleavage with Hind111 and agarose gels and ethidium bromide staining. EcoRI. The labeled probe fragments (1 ng) were then incubated in 0113mRNA levels were quantitated by dot-blot hybridization. RNA 20-pl reaction volumes containing 4 pg of poly(d1-dC) and either 50 was fixed to nylon (Genescreen)membranes by UV irradiation. pg of nuclear extract or 21 pg of T7X556, a purified glucocorticoid Filters were then hybridized with cDNA probes for rat al13that had receptor fragment containing theDNA binding domain (17). Control been :',P labeled (5). In addition, duplicate series of dots were probed reactions contained40 pg of bovine serum albumin(molecular biology with a :',P-labeled ribosomal cDNA probe to monitor for constant grade, Boehringer Mannheim) in20 mM Hepes, pH 7.9,20% glycerol, RNA loading (20). RNA was quantitated by liquid scintillation count- 0.2 mM EDTA, 2 mM EGTA, 2 mM dithiothreitol, 60 mM potassium ing of individual dots. chloride. After a 10-min incubation on ice and 40 min a t 22 "C, 20 p1 Luciferase mRNA was identifiedby primerextensionusing a of20 mM magnesiumchloride,5 mM calciumchloride was added specific primer, CTTCCATTTTACCAACAGTACCGGAATGCC, followed by an appropriate dilution of DNase I. After 120 s a t room that hybridized with nucleotides a t position +63to +92 onthe temperature the reactionwas stopped by the addition of 40 p1 of stop luciferase coding sequence (21). The specific 30-mer was end labeled buffer (1%sodium dodecyl sulfate, 20 mM EDTA, sodium chloride, using ['"PIATP and T4 polynucleotide kinase. The primer was hy- 25 pg/ml tRNA). The probe DNA was recovered by phenol/chlorobridized at 50 "C using standard conditions, and cDNA was synthe- form extraction and ethanol precipitation analyzed and on denaturing sized using avian myeloblastosis virus reverse transcriptase (Pharmacia LKB Biotechnology Inc.). The luciferase-specific cDNA was ' K. Yamamoto, unpublished observation. MATERIALSANDMETHODS
Variant Glucocorticoid Response Element of the aJ3 Gene
18270
polyacrylamide gels along with probe DNA that had been subjected to the G+A cleavage reaction of Maxam and Gilbert (30). For competition experiments 20 ng of cold specific oligonucleotide was included in the binding reaction instead of the nonspecific 35-mer. Gel retardation assays (31, 32) were performed using the extracts from FAZA cells. The binding reaction mixture (20 pl) containing 2 ng of end-labeled double-stranded oligonucleotide and 0.1-1 pg of extract with 4 pg ofpoly(d1-dC), 0.5 pg of Escherichia coli chromosomal DNA, and 200 ng of the nonspecific 35-mer in DNase I footprinting buffer, was incubatedfor 30 min onice. Protein-bound DNA complexes were analyzed on 8% polyacrylamide gels containing 25 mM Tris borate, 0.25 mM EDTA a t 4 "C. Two hundred ng of specific oligonucleotide was included in the binding reaction, instead of the nonspecific 35mer, when competition assays were performed.
compared with untreated hypophysectomized control and normal animals. Hepatic mRNAlevels in hypophysectomized rats treatedwith increasing concentrations of dexamethasone (40 pg/kg-8 mg/kg) were increased in a dose-responsive manner (Fig. 1A). For instance, 6 h after administration of 8 mg/ kg dexamethasone the mRNA level was increased from 21 to 40% of normal levels. The a,I3 mRNA levels 12 and 24 h after administration of 8 mg/kg dexamethasone were 57 and 64%, respectively, of normal levels. Overall, aJ3 expression levels in rats with very low levels of glucocorticoidscaused by hypophysectomy were decreased and could berestored at least in a major part by intraperitoneal injection of glucocortocoids. The effects of glucocorticoids on al13 expression in vivo RESULTS were paralleled in vitro in the rat hepatoma cell line, FAZA. DexamethasoneIncreases a113mRNA Concentration in Hy- FAZA cells were treated with increasing concentrations of dexamethasone, and 12 hlater RNA was prepared. a113 pophysectomized Rats and in FAZA Hepatoma Cells-Results from previous studies on the acute phase regulation of the mRNAlevelswere increased in a dose-responsive manner al13 gene in rat liver and rat hepatoma cell lines suggested (Fig. lB), in a similar way as in dexamethasone-treated that glucocorticoids may be required for the normal expression hypophysectomized rats. The "normal" expression levels in of al13 (9, 11). To investigate whether glucocorticoids are rats are equivalent to the levels observed in glucocorticoidrequired for normal aJ3 expression in rats al13 mRNA levels treated hepatoma cells. The Promoter Upstream Region of the a113Gene Mediates in the livers of hypophysectomized and normal rats were Glucocorticoid Induction-To establish that theglucocorticoid compared. In hypophysectomized ratsthe levels of al13 regulation of the al13 gene occurred at thelevel of transcripmRNA were approximately 20% of those determined in normal animals (Fig. 1A). To determine whether decreased a113 tion, transfection studies using 5' promoter constructs were expression was specifically caused by lowered glucocortocoid initiated. Approximately 2.2 kilobase pairs of the al13 gene levels in the hypophysectomized animals, the effect of admin- 5"flanking sequence were available (8). A restriction map of istration of dexamethasone was studied. Hypophysectomized this al13 gene promoter region was generated. Subsequently, rats were treated with increasing doses of dexamethasone for a region extending from -2,214 to +59 (relative to the transcriptional initiation site in liver) was linked to the coding varying lengths of time,and the al13 mRNAlevelswere region of the firefly luciferase reporter gene (Fig. 2A). This construct, called A113 (-2,214), was used to cotransfect FAZA A hepatoma cells. Stable clones expressing luciferase were isoI lated after G418 selection. Stable transfectants expressing luciferase from the SV40 minimal promoter (33) in the plasmid pSV232LUC werealso isolated. A mixed culture of stable A113 (-2,214) transfectants, referred to as F-1, representing approximately 500 clones was used to test the response of
A
-
e
a
8
Y
1
1
-80 *58
-2214 -1514 -1025 -581-431
Hypophysectomy
6
B -
1
.E a
-
s' J
I
'E
-
Dexamethasone Concentration (M)
FIG. 1. Regulated expression of aJ3 mRNA in rat liver and the FAZA hepatoma cell line. RNA (2 pg) was dotted to a nylon membrane andhybridized with 32P-labeled al13 cDNA. After washing, the membrane was autoradiographed, and al13 mRNA levels were quantitated byliquid scintillationcounting of individual dots. A, normal orhypophysectomized rats were either mock treated or treated with increasing concentrations of dexamethasone for 6, 12, or 24 h as indicated prior to RNA preparation. Each data point was measured in duplicate. B, duplicate cultures of FAZA cells were treated with increasing concentrations of dexamethasone, as indicated for 24 h prior to preparation and quantitationof al13 mRNAlevels.
5
18000 18000 14000 12000 10000 8000 8000 4000 2000 0
0
10"10"
lo"
10' 10' l o "
Dexamethasone Concentration I M P
FIG. 2. Inducible expression ofan al13 luciferase fusion construct in FAZA-derived stable transfectants. A, a physical map of the a,I3 luciferase fusion construct, A113 (-2,214), showing the positions (in bp) of restriction endonuclease cleavage sites with respect to the transcription initiation site(arrow).B, cultures of the stable A113 (-2,214) transformed line F1 or the pSV232LUC-transformedline F-232 were treated with increasing concentrations of dexamethasone for 12 h prior to assayingfor luciferase activity (light units).
Variant Glucocorticoid Response Element of the a113Gene (ul13gene promoter region to different concentrationsof glucocorticoid (Fig. 2B). In the absence of dexamethasone, F-1 cells expressed luciferase at a basal level (2,000 light units). Progressively higherconcentrations of dexamethasone caused a n increase in promoter activity from 1.6-fold (3,200 light units) using 1 X lo-" M dexamethasone to 9-fold (18,300 light units) with 1X M dexamethasone. In contrast the activity of the SV40 minimal promoter in the transformed line, F-232 was not increased significantly after dexamethasone treatment. 5' Deletion Analysis of the Glucocorticoid-responsive Regions Upstream of the a113 Gene-To map the 5' extent of the region responsible for the glucocorticoid-regulated expression of the aI13 gene a series of deletion constructs with inserts extending from +58 bp to between -48 and -2,214 bp upstream of the transcription start site was used. These constructs were linked to the firefly luciferase gene, and the luciferase activity was measured after transient transfection into the rat hepatomaFAZA cell line. Constructs containing at least 225 bp upstream of the transcription initiation site, A113 (-2,214) and A113 (-225), contained sufficient information to mediate a 25-fold induction of luciferase activity M dexamethasone for 24 h (Fig. after treatment with 1 X 3A). The A113 (-186) construct gave a similar but slightly lower induction. In contrast the shortest constructs, A113 (-150) and A113 (-118) were not induced above that seen withthe pSV232LUC controlplasmid (4-fold). Thus,sequences located between -186 and -150 were necessary for at least a 6-fold glucocorticoid induction of the al13 gene. Quantitation of the luciferase mRNA produced after transfection of constructs A113 (-2,214), A113 (-225), and A113 (-118) followed by dexamethasone treatment, by primer extension using a luciferase-specific oligonucleotide (Fig. 3B), showed that the transcriptional start site used in FAZA cells waswithin4 bp of that used in rat liver aJ3 and that differences between the luciferase mRNA levels in the A113 (-2,214) and A113 (-225) constructs after dexamethasone
treatment were similartothoseseen with the luciferase activity measurements, relative to A113 (-118). Delineation of the Glucocorticoid-responsive Element-A series of Sal1 linker scan mutations extending across the region that had been found tobe essential for basal level expression (10) was available from a previous study (10). In the present study, thisregion was found tobe involved also in mediating the induction by dexamethasone. The linker mutant constructs were transfected into FAZA cells, and luciferase activities were measured either with or without dexamethasone treatment (Fig. 4). Mutations LM5,LM6,LM7, and LM9 abolished the glucocorticoid responsiveness of the al13 promoterconstruct.Previousresults(10) indicated thatthe mutations LM5, LM6, and LM9 completely abolished basal level transcriptional activity, and the present study showed that these same mutations also abolished glucocorticoid-inducible expression.However, the LM7 mutation did not affect basal level transcription (10) but completely abolished inducibility by dexamethasone. Thus,a GRE was contained within or overlapped the -156 to -151 region covered by the LM7 mutation and may extend further to the 5' end of the LM5 mutation at -168. Inspection of the -168 to -151 region revealed partial sequence homology to an inverted copy of the consensus GREresponsible for the transcriptionalactivation of many genes by glucocorticoids (14-16,34-36) and functioning asa binding site for theGR. An ideal GRE, asdefined by saturation mutagenesis (36), has thepalindromic sequence
. . . . 5' 3'
R G N A C A N N N T G T N C Y Y C N T G T N N N A C A N G R
ATAM
1
AlW
All%-2251
ATAM
A1111-1081 AlAM
11151-1501
LLI
ATAM
A1151-1101 " I
1142
e AlAM
A1151-401
3' 5'
whereR = purine, Y = pyrimidine,N = any nucleotide; arrows represent the inverted half-sites of the palindrome on theopposite DNA strands,anddotsindicate nucleotides important for protein DNA contact. The reverse of this se-
-
A
11131-22141
18271
lu:
pSv232LuC
FIG. 3. Effect of 5' deletions on the glucocorticoid inducibility of the aJ3 promoter. A series of constructs containing up to2,214 bp of nJ3 5"flanking sequences linked to theluciferase reporter gene were tested for transcriptional activity, bothwithandwithouttreatment with 1 X M dexamethasone for 24 h after transient transfection in FAZA cells. A, luciferase activity was measured in cell extracts and normalized with respect to the chloramphenicol acetyltransferase activities measured in each extract. The luciferaseactivities presentedarean average of a t least five measurements.Fromthesedatathe relative (fold) induction by dexamethasone was determined. B, relative luciferase mRNA induction of three constructs after treatment with dexamethasone was determined by primer extension using a luciferase-specific primer, as described under "Materials and Methods." The arrow indicates the position of the luciferase-specific product. Also shown is a dideoxy sequencing reaction (ACGT) using the sameluciferase primer on A113 (-225) plasmid DNA.
Variant Glucocorticoid Response Element of the aJ3 Gene
18272
30
I
I
I
Linker Mutants-
FIG.4. Linker mutational analysis of the -225 to -118 region of the aJ3 promoter. A series of Sal1 substitutions (LM) were introduced in the upstream promoter region of the A113 (-225) construct (10) as indicated below the sequence. The various linker scan mutants were used to transfect FAZA cells transiently. The effect of each mutation on the induction of the promoter by 1 X M dexamethasone was determined by comparing the activity of the promoter before and after induction. The levels of induction of the inducible MMTVLUC construct, the minimal SV40 promoter construct, pSV232LUC, and the wild-type construct A113 (-225) are also shown.
quence matches the GMEof the a113gene as follows.
. .
.
4
irl13GME
5'
C C C T G G C A C A T T T C G T G C A A
3'
-168
3'
G G G A C C C T G T A A A G C A C G T T
5'
lllllllll IIII
"-0 "
-
.-
c
FIG. 5. DNase I footprint and gel shift analysis of the aJ3 upstream promoter elements. A, footprints on the noncoding strand of the nl13 promoter region using either untreated (0 h) or 5h dexamethasone-treated FAZA nuclear extracts. The position of the sequence mediating the glucocorticoid response (-151 to -156) is indicated. G+A chemical cleavages of the end-labeled probes were used as sequence markers. R, gel retardation analysis of the GME. Assays were performed using labeled oligonucleotide B3 and FAZA extracts from either uninduced, 5-h, or 12-h dexamethasone (1X M)-treatedFAZA cells. Competition reactions, in addition, contained 200 ng of unlabeled B3 oligonucleotide. RSA, bovine serum albumin.
with the -156 to -151 region mapped as containing the GME was found. The protected region included the GME region, reverse 3' Y C N T G T N N N A C A N G R 5' indicating that a complex of nuclear factors bound to these . . . . . sequences as described previously (10). Both uninduced and GRE induced extracts gave a similar region of protection from However, the GME varies in two nucleotides of one half site DNase I digestion (Fig. 5A and data not shown), suggesting may be which are both important for receptor DNA contact. There- thatsimilaroridenticalGMEbindingactivities present in both uninduced and induced extracts. fore, the GME of the a113 gene deviates significantly from a These results were confirmed and extendedby gel retardaconsensus GRE. This sequence variation implies apotentially different way of protein DNA contacts between the GR and tion assayusing a double-stranded oligonucleotide B3, 5' a consensus GRE and the GME of the al13gene, respectively. TCCCCTGGCATTTCGTGCAAC 3', which included the Stimulation of Luciferase Expression Is Mediated by the GME sequence (Fig. 5B). When nuclear extracts from uninGlucocorticoid Receptor-To determine whether theeffect of duced FAZA cells were used in the assay, two predominant dexamethasone on the transcriptional activationof the al13 retarded complexes were seen. When nuclear extractsfrom 5promoter was mediated through the glucocorticoid receptor, or 12-h dexamethasone-treated FAZA cells were used two the effect of the receptor antagonist RU486 was tested (37, retarded complexes were seen which appeared tobe identical retarded 38). FAZA cells were transfected with A113 (-225) followed tothoseobtainedwithuninducedextracts.The by treatment with 10" M dexamethasone for 24h. The complexes could be competed specifically by unlabeled 3B. transcriptional activityof the al13 luciferase fusion increased There was no apparent change in the GME binding activity approximately 10-fold after treatment with this concentrationwhen FAZA cells were treated withdexamethasone. If the GR of dexamethasone (data not shown). However, simultaneous bound to thisregion only after hormonal treatment then one treatment with both M dexamethasoneand M RU486 might have expected to find a corresponding change in the led to a low transcriptional activity thatwas similar to that gel retardation pattern, even if the bindingwas weak. Purified GlucocorticoidReceptor Does Not Bindto the GME measured with either RU486 alone or control transfected cells. Thus, RU486 blocked completely the inductionby dexameth- of the a113Gene-DNase I footprint analysis was carried out asone, suggesting that the effect of dexamethasone on aJ3 on the aJ3 GME region to determine whether theglucocorticoid receptor was able to bind. A 150-amino acid glucocorpromoter activity was mediated through theGR. DNase I Footprint Analysis of the a113 Glucocorticoid In- ticoid receptor fragment, T7X556, was used in footprint reduction-mediating Element (GME)-To investigate whether actions. This fragment contained the DNA binding domain sequence as the full-length transcription factors bind to the region that hadbeen mapped and protected the same GRE as being important for the glucocorticoid induction of the al13 receptor (17). When the al13 promoter region was used in was unable to bind gene, DNase I footprint analysis of the area surrounding the footprint reactions this receptor fragment -156 to -151 region of the promoter was carried out using to the sequence delineated by the LM7 mutation (-151 to nuclear extracts preparedfrom either uninduced or 5-hdex- -156) or to sequences extending through the LM5 and LM6 amethasone-induced FAZA cells (Fig. 5A and data not shown).region (-157 to -168). Onlyavery minorchangeinthe A region protected from DNase I digestion which coincided footprint profile was seen around-151 and also around -163
-
Variant Glucocorticoid Respo'me Element of the a113Gene on the noncoding strand but not on the coding strand. The consensus GRE contained in the pGTCO plasmid2was very strongly protected from DNase I digestion by this receptor even when %O of the concentration of T7X556 was used as compared with thea113binding reactions (Fig. 6).
18273
administration of glucocorticoids served to restore a major fraction of the normal a113 mRNA expression levels. In the current study, FAZA hepatoma cells treated with dexamethasone were shown tobehave similarlyto hepatocytes in vivo; both the endogenous al13 gene and transfected al13 promoter luciferase constructs were induced by dexamethaDISCUSSION sone ina dose-responsive manner. The resultsconfirmed that Two essential results were obtained in this study. ( a ) Glu- FAZA hepatoma cells provided a good model system to study cocorticoids are required forthe constitutivehigh level expres- the glucocorticoid-mediated transcriptional regulation of the sion of the al13 gene in healthy adult rat livers. ( b ) The al13 gene. In this model system, resting hepatoma cells were in glucocorticoid response element of the al13gene is a variant considered to be equivalent to hepatocytes hypophysectomof the consensus GRE, differing from it in qualitatively im- ized rat liver. Glucocorticoid-treated (induced)hepatoma cells, in contrast, were equivalent to hepatocytes in normal portant aspects. rats with normal levels of circulating glucocorticoids. Using a Glucocorticoids participate in the transcriptional activation of a number of hormone-induciblegenes (14-16). T o our transient transfection assay, a glucocorticoid-responsive eleknowledge, however, there are no well documented cases in ment was located between positions -186 and -150 bp upstream from the al13transcription initiation site. Linker scan which glucocorticoids havebeenshown to be an essential prerequisite for the constitutive, high level expression of a analysis delineated the GRE to the sequence CCCTGGCAgene in its normal producer cell type. The a113 gene is an CATTTCGTGC (-167 to -150). Comparison of this sequence example of such a situation. Thisgene differs strikingly from with the glucocorticoid response element found in many stethe majority of other plasma protein genes expressed in the roid-responsive genes(14-16,34-36) showed that this element differingina few liver which have been studied so far. Other genes, specifying is an inverted consensus GRE element abundant plasma proteins that are constitutively expressed, nucleotides from the consensus GRE(8).The consensus GRE such as the transferrin, complement C3, C4, or albumingenes, has been defined in two different ways in the literature: once many are controlled by a set of transcription factors (HNF1,39-41; by comparing the functional elements found in different C/EBP; DBP-LAP; 42-45 and others) which are themselves genes (14-16), and, more recently, be systematic saturation constitutively and preferentially expressed in fully differen- mutagenesis in all 15 nucleotide positions of the GRE and tiated hepatocytes. In contrast to those genes, the al13 gene comparing relative binding intensities for the GR (36). The is representativeof a rare category of strongly expressed liver- "ideal" GRE, defined by this latter approach as the best GR specific genes which,in addition to those constitutive factors,protein binding sequence, showed good agreement with the require inducible factors such as the GRfor their transcrip- consensus GRE asdefined by the first approach(14-16). The tion. Our results showed that in ratshypophysectomy greatly GRE consistsof two half-sites ina palindromic arrangement. decreased the productionof al13 mRNA in theliver and that One half-site is thought to be occupied first and to facilitate binding of a second molecule of the GR at the second halfa113 a113 site by cooperative interaction (36). Until recently it was coding strand nomcoding strand pGTCO thought that the strong half-site must be a hexanucleotide U + S = +Sa ?S a o m o o m o m o with only one unspecified position (N) separating the TGT triplet from the CY doublet. However, it was shown recently (36) that a half-site can also be a heptanucleotide with two unspecified nucleotidesseparating the triplet and doublet: the T G T N1 N2C Y. This result suggests that within each halfsite there are two separable subelements that are possibly contact points for separate subdomains of the GR with the DNA. I t is of interest to note that in the GME of the aI13 gene, one half-site is perfectly conserved whereas inthe second half-site two nucleotides differ as shown in the alignment given under "Results." Both of these variant positions are nucleotides involved in protein DNA contact between a consensus GRE and theGR. It is therefore conceivable that the second half-site of the GMEbecomes a veryweak binding site or no binding site a t all and that itcould even destabilize or prevent bindingof a first copy of the GR at the conserved strong half-site. The variant sequence of the GME suggests the plausible prediction that the GME of the a113 may be a much weaker binding site for the GR thana consensus GRE. In view of the variant sequence of the GME we were FIG.6. DNase I footprint analysis of the a113-225 region prompted to ask whether the glucocorticoid effect involved using purified glucocorticoid receptor. An al13 promoter fragthe GR and whether the receptor bound directly to the GME ment extending from -225 to -81 was labeled on either the coding or noncoding strand and used in the binding reaction with either of theal13 gene. The glucocorticoid receptor antagonist bovine serum albumin or 21 pg of glucocorticoid receptor fragment, RU486 was able to block the effect of dexamethasone comT7X556 (17). The controlplasmid, pGTCO, containing a glucocorti- pletely, indicating that the al13 promoter activity was mecoid-responsive element, was used in binding reactionswith 2.1 pg of diated through the GR. However, when the purified recomT7X556. The position of the GME mapped by the LM7 mutation binant GR fragmentwas used in footprint reactionswith the (-156 to -151) is indicated. Also, the maximum extent of the GRE is shown by the broken lines. The arrow marks the position of the al13 GME, no significant binding was observed. There are a weak protection by the GR, from DNase I digestion. The protected number of possible explanations for this observation. GRE on pGTCOis indicated by brackets. First, the GR may be able to bind weakly at the GME of 4
0
18274
Variant Glucocorticoid Respcmse Elementof the a113Gene
the al13 gene, but to initiate transcription successfully it may the GME and these previously characterized tissue specific need to be held in place by interaction with other accessory cis-acting elements it islikely that there isa close association factors. This interactionpossibly requires domainsof the GR between the various transcription factors that bind to these other than its DNA binding domain. In our experiments with sequences. the truncated recombinant GR fragment no binding may have Acknowledgments-We thank Dr. K. Fournier for the FAZA hepbeen observed because ( a ) the intrinsic binding to the GME was too weak because of the variant DNA sequence of the atoma cell line. We gratefully acknowledge gifts of RU486 from Roussel UCLAF, France andof purified T7X556 glucocorticoid recepsite; and( b ) because the necessary factors were not present. tor fragment from Dr. K. Yamamoto. We thank Keith Dunn for The glucocorticoid receptor is known to undergo coopera- preparation of the manuscript and Dr. H. Leffert for helpful discusa variety of transcription factors such sions. tive GRE binding with as nuclear factor 1, Spl, OTF-1,CCAAT box binding factors REFERENCES and the estrogen receptor, to activate an adjacent promoter (46-48, 58). Chang and co-workers (59) have shown that the 1. Sottrup-Jensen, L., Stepanik, T. M., Kristensen, T., Lonblad, P. transcriptionfactorAGP/EBP, amember of theC/EBP B., Jones, C. M., Wierzbicki, D. M., Magnusson, S., Domdey, H., Wetsel, R. A,, Lundwall, A,, Tack, B. F., and Fey, G. H. family and probably the murine equivalentof rat interleukin (1985) Proc. Natl. Acad. Sci. U. S. A. 8 2 , 9-13 6-DBP/liver activator protein (44, 45), binds at a sequence 2. Sottrup-Jensen, L., Sand, O., Kristensen, L., and Fey, G. H. overlapping the GRE of the murine alAGP gene. The fact (1989) J. Biol. Chem. 2 6 4 , 15781-15789 that the GME of the al13 gene is highly conserved with the 3. Sottrup-Jensen, L. (1987) in The Plasma Proteins (Putnam, F. functionally active glucocorticoid response regions of the rat W., ed) pp. 191-291, Academic Press, Orlando, FL and murine alAGP (8, 49-50, 59) and a2"-g1obulin genes (8, 4. Lonberg- Holm, K., Reed, D. L., Roberts, R. C., Herbert, R. R., 51) makes the involvement of accessory proteins plausible. In Hillman, M. C., and Kutney, R. M. (1986) J. Biol. Chem. 2 6 2 , 438-445 fact, for the controlof the rat alAGPgene by glucocorticoids, 5. Braciak, T. A., Northemann, W., Hudson, G. O., Shiels, B. R., Klein et al. (52, 53) have demonstrated a requirement for Gehring, M. R., and Fey, G. H. (1988) J. Biol. Chem. 2 6 3 , accessory proteins bindingat neighboring sites, some of which 3999-4012 are labile and need to be resynthesized continuously. The 6. Aiello, L. P., Shia, M. A., Robinson, G. S., Pilch, P. F., and alAGP GRE shares a higher degree of sequence homology Farmer, S. R. (1988) J. Bid. Chem. 263, 4013-4022 with the GME of the rat a113 gene than with the consensus 7. Schweizer, M., Takabayashi, K., Geiger, T., Laux, T., Biermann, GRE sequence (8). However, unlike alAGP, the al13 GME G., Buhler, J. M., Gauthier, F., Roberts, L. M., and Heinrich, P. C. (1987) Eur. J. Biochem. 1 6 4 , 375-381 appears unable to bind recombinant GR in footprint reactions. It is possible that because of the constitutive induction 8. Northemann, W., Shiels, B. R., Braciak, T. A,, and Fey, G. H. (1989) Biochemistry 28, 84-95 of al13 by glucocorticoids and its down-regulation during the Abraham, L. J., Bradshaw, A., Fletcher, R., and Fey, G. H. (1990) 9. acute phase, the GR requires accessory factors to bind to the Mol. Biol. Med 7 , 261-272 GME since cycloheximide completely blockedboth the unin- 10. Abraham, L. J., Bradshaw, A. D., Shiels, B. R., Northemann, W., duced and the dexamethasone-induced expression of the al13 Hudson, G., and Fey, G. H. (1990) Mol. Cell. Bid. 1 0 , 3483gene." 3491 A second possible explanation of our data is that the GR 11. Bernuau, D., Legres, L., Lamri, Y., Giuily, N., Fey, G., and Feldmann, G. (1989) J. Exp. Med. 170,349-354 may not bind directly to the GME DNAsequence but rather indirectly to other proteins that are in turn attached to the 12. Kushner, I., and Feldmann, G. (1978) J . Exp. Med. 1 4 8 , 466470 DNA. A similar mechanism was proposed for the regulation 13. Sapolsky, R., Rivier, C., Yamamoto, G., Plotsky, P., and Vale, of the prolactin gene by steroids. Regulation of this gene W. (1987) Science 2 3 8 , 522-534 involves the estrogen and glucocorticoid receptors interacting 14. Beato, M. (1989) Cell 5 6 , 335-344 with other transcription factors to suppress prolactin gene 15. Yamamoto, K. R. (1985) Annu. Reu. Genet. 1 9 , 209-252 16. Evans, R. M. (1988) Science 240,889-894 transcription (54). Similarly, the glucocorticoid receptoris involved in the transcriptional repression of the collagenase 17. Freedman, L. P., Luisi, B. F., Korszun, Z. R.,Basavappa,R., Sigler, P. B., and Yamamoto, K. R. (1988) Nature 3 3 4 , 543gene not by direct binding to the DNA but by interaction 546 with the transcription factor jun in thefluid phase and thus 18. Gehring, M. R., Shiels, B. R., Northemann, W., de Bruijn, M. H. preventing it from activating the gene through an AP1 site L., Kan, C.-C., Chain, A. C., Noonan, D. J., and Fey, G. H. (55-57). (1987) J. Bid. Chem. 262,446-454 A third possible explanation is that the glucocorticoid effect 19. Turpin, T. H., and Griffith, 0. M. (1987) Biotechnigues 4 , 11-13 on the al13 gene is indirect and does not involve binding of 20. Mroczka, D. L., Cassidy, D., Busch, H. B., and Rothblum, L. I. (1984) J. Mol. Biol. 1 7 4 , 141-162 the GR at the GME, either by direct protein-DNA interaction or by protein-proteininteraction.Instead, glucocorticoids 21. de Wet, J. R., Wood, K. V., DeLuca, M., Helinski, D. R., and Subramani, S. (1987) Mol. Cell. Biol. 7 , 725-737 could activate an intermediate gene, and the intermediate S. E., and Weiss, M. C. (1974) Proc. Natl. Acad. Sci. gene product could exert its control over the al13 gene through 22. Malawista, U. S. A. 71,927-931 the GME site without interactionof the GR with this site. 23. Graham, F. L., and Van der Eb, A. J. (1973) Virology 5 2 , 456Among the possibilities, we believe the most likely is that 467 the GR bindsat the GME to the DNA and requires auxiliary 24. Birnboim, H. C., and Doly, J. (1979) Nucleic Acids Res. 7 , 15131523 proteins bound atneighboring sites tohold it in place and to interact productively with the components of the transcrip- 25. Gorman, C. M., Merlino, G. T., Willingham, M. C., Pastan, I., and Howard, B. H. (1982) Proc. Natl. Acad. Sci. U. S. A. 79, tional machinery to augment the rateof transcription initia6777-6781 tion. Previously we have mapped four tissue specific cis-acting 26. Sleigh, M. J. (1986) Anal. Biochem. 1 5 6 , 251-256 elements tosequences surrounding the GME in the al13 gene 27. van Zonneveld, A.-J., Curriden, S. A., and Loskutoff, D. J. (1988) (10). We have established that nuclear factors bind to these Proc. Natl. Acad. Sci. U. S. A. 8 5 , 5525-5529 elementsinbothuninducedanddexamethasone-induced 28. Shapiro, D. J., Sharp, P. A., Wahli, W. W., and Keller, M. J. FAZA nuclear extracts. Considering the close proximity of (1988) D N A ( N . Y . ) 7,47-55 L. Abraham, unpublished data.
29. Galas, D., and Schmitz, A. (1978) Nucleic Acids Res. 3170
5 , 3157-
Variant Glucocorticoid Response Element 30. Maxam, A. M., and Gilbert, W. (1980) Methods Enzymol. 6 5 , 499-560 31. Garner, M. M., and Revzin, A. (1981) Nucleic Acids Res. 9,30473060 32. Fried, M., and Crothers,D. M. (1981) Nucleic Acids Res. 9,65056525 33. Fromm, M., and Berg, P. (1982) J. Mol. Appl. Genet. 1 , 457-481 34. Karin, M., Haslinger, A,, Hallgrave, H., Richards, R. I., Krauter, P., Westphal, H. M., and Beato, M. (1984) Nature 3 0 8 , 513519 35. Straehle, U., Klock, G., and Schuetz, G. (1987) Proc. Natl. Acad. Sci. U. S. A . 8 4 , 7871-7895 36. Nordeen, S. K., Suh, B. J., Kuehnel, B., and Hutchison, C. A., I11 (1990) Mol. Endocrinol. 4 , 1866-1873 37. Baulieu, E. E., and Segal, S.J. (1985) in The Antiprogesterone RU486 in Human FertilityControl, Plenum Publishing Co.,
New York 38. Schweizer, G., Cadepond-Vincent, F., and Baulieu, E. E. (1985) Biochemistry 2 4 , 1742-1749 39. Courtois, G., Baumhueter, S., and Crabtree, G . (1988) Proc. Nutl. Acad. Sci. U. S. A . 8 5 , 7937-7941 40. Baumhueter, S., Mendel, D. B., Conley, P. B., Kuo, C. J., Turk, C., Graves, M. K., Edwards, C. A,, Courtois, G., and Crabtree, G. R. (1990) Genes & Deu. 4, 372-379 41. Frain, M., Swart, G., Monaci, P., Nicosia, A., Staempfli, S., Frank, R., and Cortese, R. (1989) Cell 59, 145-157 42. Johnson, P. F.,Landschulz, W. H., Graves, B. J., and McKnight, S. L. (1987) Genes & Deu. 1, 133-146 43. Mueller, C. R., Maire, P., and Schibler, U. (1990) Cell 6 1 , 279291 44. Descombes, P., Chojkier, M., Lichtsteiner, S., Falvey, E., and
of the a113Gene
18275
Schibler, U. (1990) Genes & Deu. 4 , 1541-1551 45. Poli, V., Mancini, F. P., and Cortese, R. (1990) Cell 6 3 , 643-653 46. Schuele, R., Mueller,M., Haltschmidt, C., and Renkawitz,R. (1988) Science 2 4 2 , 1418-1420 47. Schuele, R., Mueller, M., Otsuka-Murakami, H., and Renkawitz, R. (1988) Nature 3 3 2 . 8 7 - 9 0 48. Straehle, V., Schmid, W., and Schuetz, G. (1988) EMBO J . 7, 3389-3395 49. Reinke, R., and Feigelson, P. (1985) J . Biol. Chem. 2 6 0 , 43974403 50. Baumann, H., and Maquat, L. E. (1986) Mol. Cell. Biol. 6 , 25512561 51. Addison, W. R., and Kurtz, D. T. (1986) Mol. Cell. Biol. 6 , 23342346 52. Klein, E. S., Reinke, R., Feigelson, P., and Ringold, G. M. (1987) J. Biol. Chem. 2 6 2 , 520-523 53. Klein, E. S.,DiLorenzo, D., Posseckert,G.,Beato, M., and Ringold, G. (1988) Mol. Endocrinol. 2, 1343-1351 Waterman, M. L., He, X., and Rosenfeld, M. G. (1988) 54. Adler, S., Cell 5 2 , 685-695 55. Jonat, C., Rahmsdorf, H. J., Park, K.-K., Cato, A. C. B., Gebel, S., Ponta, H., and Herrlich, P. (1990) Cell 6 2 , 1189-1204 56. Yang-Yen, H.-F.,Chambard,J.-C.,Sun, Y. L., Smeal, T., Schmidt, T. J., Drouin, J., and Karin,M. (1990) Cell 6 2 , 1205 57. Schuele, R., Rangarajan, P., Kliewer, S., Ransom, L. J., Bolado, J., Yang, N., Verma, I. M., and Evans, R. M. (1990) Cell 6 2 , 1217-1226 58. Briiggemeier, U., Kalff, M., Franke, S., Scheidereit, C., and Beato, M. (1991) Cell 6 4 , 565-572 59. Chang, C. J., Chen, T. T., Lei, H. Y., Chen, D. S., and Lee, S. C. (1990) Mol. Cell. B i d . 1 0 , 6642-6653
