Identification of a Novel Missense Mutation That Is ... - Oxford Academic

0013-7227/03/$15.00/0 Printed in U.S.A.

The Journal of Clinical Endocrinology & Metabolism 88(3):1341–1349 Copyright © 2003 by The Endocrine Society doi: 10.1210/jc.2002-021560

Identification of a Novel Missense Mutation That Is as Damaging to DAX-1 Repressor Function as a Nonsense Mutation PAMELA BROWN, GRAEME A. SCOBIE, JULIE TOWNSEND, ROSEMARY A. L. BAYNE, JONATHAN R. SECKL, PHILIPPA T. K. SAUNDERS, AND RICHARD A. ANDERSON Medical Research Council Human Reproductive Sciences Unit, Center for Reproductive Biology, University of Edinburgh (P.B., G.A.S., J.T., R.A.L.B., P.T.K.S., R.A.A.); and Endocrinology Unit, Molecular Medicine Center, Western General Hospital (J.R.S.), Edinburgh, United Kingdom EH16 4SB Mutations in the DAX-1 (NROB1) gene result in X-linked congenital adrenal hypoplasia (AHC) and hypogonadotropic hypogonadism. The clinical presentation is usually as adrenal insufficiency in early life, with hypogonadotropic hypogonadism detected at the time of expected puberty. In this study we identified mutations in the DAX-1 gene of two patients with AHC. One mutation, Y399X, resulted in a premature stop codon and was associated with loss of Leydig cell responsiveness to human chorionic gonadotropin. The second, L297P, was a missense mutation, and human chorionic gonadotropin responsiveness was maintained. Kindred analysis established that the mutations had been inherited from the proband’s mothers. The L297P has not been described previously and

T

HE DAX-1 (NROB1; dosage-sensitive, sex reversal, adrenal hypoplasia critical region on the X chromosome gene 1) gene encodes an atypical member of the nuclear hormone receptor superfamily (1). Mutations in DAX-1 have been shown to be responsible for X-linked congenital adrenal hypoplasia (AHC), a rare disorder characterized by impaired development of the adrenal cortex and hypogonadotropic hypogonadism (1, 2). AHC was first described by Sikl et al. (3) and was suggested to be familial after its description in a male sibship (4). Males with DAX-1 mutations generally present with adrenal failure early in life and hypogonadotropic hypogonadism in adolescence, although milder forms of the syndrome have been described (5). Hypogonadism is generally recognized by failure of spontaneous puberty (6) and may have both hypothalamic and pituitary components, although it appears that the hypothalamo-pituitary-testicular axis is active during childhood (7, 8). DAX-1 was assigned to the nuclear receptor superfamily of ligand-activated transcription factors because it contains a region within the C-terminus of the protein with sequence similarities to the ligand-binding domain of other superfamily members (1, 9). The protein contains a unique aminoterminal domain containing 3.5 repeats of a 65- to 67-amino acid motif that forms 2 putative zinc finger domains, although this region is unlike the central DNA-binding domain found in other nuclear receptors (1, 10). To date no ligand for Abbreviations: AHC, Congenital adrenal hypoplasia; AMH, antiMullerian hormone; hCG, human chorionic gonadotropin; LUC, luciferase; SF-1, steroidogenic factor-1.

occurs within a highly conserved binding motif (LLXLXL). Transient transfection assays demonstrated that both mutations resulted in a severe loss of DAX-1 repressor activity. Immunohistochemical analysis of testicular tissue obtained from an affected sibling of the subject with the Y399X mutation, who had died with adrenal failure as a neonate, showed normal testicular morphology and expression of DAX-1, steroidogenic factor-1, and anti-Mullerian hormone protein. These data extend the clinical and molecular information on DAX-1 mutations, confirm normal testicular development at the neonatal stage, and illustrate variability in Leydig cell function. (J Clin Endocrinol Metab 88: 1341–1349, 2003)

DAX-1 has been identified. DAX-1 has been shown to act as a transcriptional repressor. In particular, there is overwhelming evidence for a coregulatory molecular interaction of DAX-1 with steroidogenic factor-1 (SF-1). SF-1 is essential for transcriptional regulation of steroidogenic enzymes within the gonad and adrenal as well as for the production of GnRH (11, 12) and gonadotropins (13). The relationship between the activities of the two proteins is complex, as not only does SF-1 transcriptionally modulate DAX-1 (14, 15), but DAX-1 inhibits the molecular function of SF-1 (16 –18). This coregulatory interaction requires the C-terminal region of the DAX-1 molecule (17, 19), the most frequent site of mutations in patients with AHC. Analysis of DAX-1 from AHC-affected patients has confirmed that the protein contains a number of critical functional domains (19, 20). Truncation of the Cterminal region by nonsense or frameshift mutations accounts for the majority of mutations detected in subjects with AHC (2, 8, 20 –24). The degree of truncation correlates with the complexity and polarization of clinical symptoms (25, 26). Similarly, missense mutations can result in late-onset (5, 27) or early-onset (28, 29) adrenal insufficiency. So although mapping missense mutations within the DAX1 gene suggests that there are functional domains within the C terminus of the DAX-1 molecule (28), how these affect DAX-1 function is probably dependent on molecular interactions with other transcription factors (30 –32). Relying on the degree of protein truncation to predict the severity of phenotype may result in confusion if not linked to assays of mutant gene function (2, 8, 20 –24), and analysis of missense mutations (5, 28) is fraught with the same dif-

1341

1342

J Clin Endocrinol Metab, March 2003, 88(3):1341–1349

ficulty. Analysis of the clinical phenotype of the individual and affected kindred seems the only critical test. In the present study we describe two adults with AHC and hypogonadotropic hypogonadism in whom we have identified DAX-1 mutations. One resulted in a premature stop codon at amino acid 399 (Y399X), predicted to result in synthesis of a protein lacking 71 amino acids from the C terminus. The second had a novel missense mutation that converted a leucine residue conserved in the mouse and human sequences (20) to a proline (L297P). Functional effects of the mutations were investigated using transient transfection analyses of DAX-1 expression constructs. Immunohistochemical analysis of the testes from the deceased sibling of one patient showed normal development of Sertoli cells and fetal-type germ cells. These data enlarge on the clinical features and molecular functionality associated with DAX-1 mutations. Materials and Methods Subjects and DNA samples This project received approval from the Lothian pediatrics and reproductive medicine ethics committee, and subjects gave informed consent in writing. Blood samples for DNA extraction and analysis were obtained from the two probands, JM and RW, and in both cases from their mothers and only sisters. The positive control sample was obtained from a healthy fertile male. Tissue samples of testis from JM’s elder male sibling were obtained from the archive of the Pathology Department, Royal Hospital for Sick Children, for analysis with the knowledge and consent of his mother.

DNA extraction, sequencing, PCR, and mutation analysis DNA was extracted from 300 ␮l whole blood using the Genomic DNA extraction kit (Amersham Pharmacia Biotech, Little Chalfont, UK). All PCR primers, including those based on published sequences (23), are listed in Table 1. PCR reactions for exons 1 and 2 of DAX-1 were performed using AGS Gold (Hybaid, Ashford, UK) with 100 ng genomic DNA and were as follows: 1 cycle of 94 C for 2 min, followed by 30 cycles of 94 C for 30 sec, 58 C for 30 sec, and 72 C for 60 sec, with a final cycle of 72 C for 10 min. Each PCR product was sequenced with 5 pmol primer on a 373 ABI sequencer using Big Dye Terminator Mix (PerkinElmer, Warrington, UK). Sequences generated from controls and patients were compared with the published DAX1 sequence (accession no.: Dax-1, gene U31929, cDNA, NM_000475).

Brown et al. • Repressor Function of Missense Mutation in Dax-1

A 143-bp region of the DAX-1 gene in subject JM and his mother and sister was amplified as described above, covering the Y399X mutation in exon 2 (Table 1), purified using High Pure PCR clean-up kit (Roche, Lewes, UK), and subjected to analysis with RsaI (Promega Corp. UK Ltd., Southampton, UK) or Tsp509I (New England Biolabs, Inc., Hitchin, UK) restriction enzymes. Cleaved PCR products were fractionated on 2% agarose gels stained with 10 ␮g/ml ethidium bromide and visualized.

Cloning of DAX1 gene and transfection analysis Specific primers (Table 1) amplified the DAX-1 gene as a 4913-bp PCR product using the same conditions as above, but with a graded extension of 10 cycles at 72 C for 30 sec, which increased by 20 sec/cycle in cycles 10 –30. The PCR products from the probands and the control subject were cloned into pCR3.1 (Invitrogen, Paisley, UK), and at least 3 clones of each were sequenced in the forward and reverse orientations. For in vitro studies of DAX-1 function, a full-length mouse SF-1 cDNA clone (gift from Dr. K. Parker, Dallas, TX) was ligated into pcDNA3 (Invitrogen, Paisley, UK). In addition, sense 5⬘-cGCCTCTCCCTGACCTTGTCTGCCTCTCGCg-3⬘ and antisense ctagCGCGAGAGGCAGACAAGGTCAGGGAGAGGCggtac-3⬘ oligonucleotides containing three copies of the SF-1 DNA-binding site (uppercase) and the core-binding site (underlined), from the LH ␤-subunit gene promoter (33) were synthesized (Sigma-Genosys, Pampisford, UK) with overhanging KpnI and NheI sites (lowercase), annealed, and ligated upstream of a minimal TK promoter in the p-TAL vector (BD Biosciences-CLONTECH Laboratories, Inc., Oxford, UK) to form SF-1/ptk-luciferase (LUC). HeLa cells (ECACC, CAMR, Porton Down, UK) were passaged in DMEM, 10% fetal calf serum, and 1% penicillin/streptomycin at 37 C in a humidified 5% CO2 atmosphere. A Fugene 6 (Roche) transfection mix of 1.5 ␮g SF-1/ptk-LUC or ptk-LUC empty vector, with 250 ng SF-1/ pcDNA3 and 100 ng ␤-galactosidase/well was supplemented with either 125 ng pBluescript II (Stratagene Europe, Amsterdam, The Netherlands) or increasing amounts of DAX-1 expression construct and transfected into the HeLa cells. LUC and ␤-galactosidase activities were determined 48 h later using a Dual-Light assay kit (PerkinElmer, Cambridge, UK) in an LB96V luminometer (Bertold Technologies, Bad Wildbad, Germany). Results calculated from three separate experiments, each performed in triplicate, are expressed as relative light units ⫻ 103 and presented as the mean ⫾ sem.

Immunohistochemistry A tissue block containing a testicular tissue fragment of an elder sibling of subject JM who had died at age 23 d was obtained from the archives at the Edinburgh Hospital for Sick Children. Sections (5 ␮m) were stained with hematoxylin or used to perform immunohistochemistry with antibodies directed against anti-Mullerian hormone (AMH; gift from R. Rey and N. Josso), aromatase (prepared in-house) (34), human DAX-1 (raised against an N-terminal peptide; Santa Cruz Bio-

TABLE 1. Specific primers DNA primer

Sense 5⬘-CACTGGGCAGAACTGGGCTAC-3⬘ Antisense 5⬘-CTGCAGCATGCTGGGCTCCG-3⬘ Sense 5⬘-CCGCTTGCACTTCGAGACTGTG-3⬘ Antisense 5⬘-CGCCCCTAGATAGGCACTGCC-3⬘ Sense 5⬘-GCTAGCAAAGGACTCTGTGGTG-3⬘ Antisense 5⬘-CCCTCATGGTGAACTGCACTAC-3⬘ Sense 5⬘-GCTAGCAAAGGACTCTGTGGTG-3⬘ Antisense 5⬘-CGTCATCCTGGTGTGTTCACTG-3⬘ Sense 5⬘-gaggatcCGCGCTAGGTATAAATAGGTC-3⬘a Antisense 5⬘-ccgctcgagCTCATGGTGAACTGCACTAC-3⬘a Antisense 5⬘-GCGCTCGTCAGCATGCTGTAGA-3⬘ Antisense 5⬘-ACGTGCGTTTGCTTTGAGCT-3⬘ Antisense 5⬘-CGCTTGATTTGTGCTCGTGG-3⬘ Sense 5⬘-TCAAGAGTCCACAGGTGGTCT-3⬘

Location in DAX-1

PCR product (base pairs)

35 bp 5⬘ of ATG ⫹ 954 bp of EX1

989 bp

262 bp EX1 ⫹ 72 bp IVS1

335 bp

58 bp IVS1, EX2 ⫹ 46 bp 3⬘ of TAA

349 bp

58 bp IVS1 ⫹ 85 bp EX2

143 bp

68 bp 5⬘ of ATG ⫹ 43 bp 3⬘ of TAA

4913 bp

EX1 EX1 EX1 EX1

The DAX-1 gene comprises two exons (EX1, EX2) and one intron (IVS1). Primer annealing sites are expressed, where appropriate, relative to EX1, EX2, or IVS1 boundaries or translational start (ATG) or stop (TAA) codons. a Lowercase refers to BamHI or XhoI restriction enzyme cleavage recognition sequence included to facilitate subcloning of DNA.


J Clin Endocrinol Metab, March 2003, 88(3):1341–1349 1343

technology, Inc., Santa Cruz, CA), or SF-1 (gift from K. Morohashi, Okazaki, Japan). All antibodies were raised in rabbits, except for that directed against aromatase, which was a mouse monoclonal. Immunohistochemistry was performed according to a standard protocol previously described in detail (34, 35). Sections to be incubated with antibodies directed against AMH, SF-1, and DAX-1 were all subjected to heat-induced antigen retrieval in glycine buffer, pH 3.5 (DAX-1) or pH 8 (SF-1 and AMH), as described previously (35). Sections were incubated with 3% hydrogen peroxide in methanol for 30 min to block endogenous peroxidase. Primary antibodies were used at the following dilutions: anti-DAX-1, 1:60; anti-AMH, 1:200; anti-SF-1, 1:150; and antiaromatase, 1:60. Sections were incubated with the appropriate biotinylated secondary antibodies, either swine antirabbit or rabbit antimouse (both from DAKO Corp., Cambridge, UK), diluted 1:500. Incubations lasted for 1 h and were followed by two washes in Tris-buffered saline (5 min each). Thereafter, sections were incubated in avidin-biotin-peroxidase/horseradish peroxidase complex (DAKO Corp.) for 1 h and washed in Trisbuffered saline (twice, 5 min each time), and bound antibodies were visualized by incubation with 3,3⬘-diaminobenzidine tetrahydrochloride (liquid DAB, catalog no. K3468, DAKO Corp.). Sections were counterstained with hematoxylin. Images were captured using a Provis microscope (Olympus Corp., London, UK) equipped with a Kodak DCS330 camera (Eastman Kodak Co., Rochester, NY), stored on a Macintosh PowerPC computer (Cupertino, CA) and assembled using Photoshop 6 (Adobe, Mountain View, CA).

Results

Case report 2 (RW)

Case report 1 (JM)

JM first presented age 10 d with vomiting and hyperkalemia. Adrenal insufficiency was diagnosed and treated with cortisone. Adrenal function was subsequently assessed as adequate by a Thorn test at age 2 yr (50% fall in eosinophils after 20 U ACTH), and in response to ACTH at age 5 yr. Height, weight, and bone age were normal at that time. However, at age 7 yr he suffered an Addisonian crisis and was subsequently maintained on cortisone and salt; the salt was replaced by fludrocortisone at age 8 yr. He was reinvestigated at age 14 yr. In response to 250 ␮g Synacthen, plasma cortisol rose briefly from 25 to 1208 nmol/ liter at 30 min, but fell to 541 nmol/liter at 90 min. However, urinary 17-hydroxycorticosteroids were reported as undetectable, and the baseline ACTH concentration was markedly elevated at 366 mU/liter (1462 ng/liter). He showed evidence of spontaneous onset of puberty from age 14 yr, with serum testosterone rising to 9.7 nmol/liter at age 15 yr, but he subsequently developed hypogonadotropic hypogonadism, and testosterone replacement therapy was instigated (Table 2). He was reevaluated at age 35 yr. Medication consisted of injectable testosterone esters (Sustanon, Organon, Oss, The Netherlands; 250 mg every 3 wk), hydrocortisone (25 mg/d), TABLE 2. Hormonal data on subject JM during adolescence Age (yr) 14

LH (IU/liter) FSH (IU/liter) Testosterone (nmol/liter)

and fludrocortisone (100 ␮g daily). Testicular volumes were 4 ml. After withdrawal of testosterone replacement for 6 wk, both LH and FSH were less than 1.0 IU/liter and remained undetectable after 50 ␮g GnRH, iv. Plasma testosterone was also undetectable (⬍0.8 nmol/liter). One semen analysis showed the presence of few spermatozoa (0.7 ⫻ 106/ml), but all subsequent samples showed azoospermia. Gonadotropins and testosterone remained undetectable after the administration of pulsatile GnRH in a dose of up to 15 ␮g/ pulse, sc, every 90 min for 3 months. Gonadotropin therapy was changed to 1500 IU human chorionic gonadotropin (hCG) twice weekly with 150 IU FSH three times weekly. After 4 wk, plasma testosterone became detectable at 1.6 nmol/liter and rose to 3.8 nmol/liter after 3 months, but despite an increase in the dose of hCG to 3000 IU twice weekly, plasma testosterone concentrations did not rise above 5.1 nmol/liter over the following 3 months. The basal inhibin B concentration was 32 pg/ml (normal, 243 ⫾ 121 pg/ml; mean ⫾ sd) and did not rise with gonadotropin administration. Testosterone replacement therapy was reinitiated thereafter.

15

16

17

Basal

Stimulated

Basal

Basal

Basal

Stimulated

⬍0.3 4.1 3.0

0.88 4.1 8.9

1.4 5.5 9.7

3.5 3.3 4.5

2.5 3.6 3.8

9.1 4.4 12.0

Stimulated refers to 30 min after 100 ␮g GnRH (LH and FSH) or after hCG (testosterone). The dose of hCG was 1000 IU for 2 d at age 14 yr and 5000 IU for 3 d at age 17 yr.

The subject was evaluated at age 34 yr. The subject had received cortisone replacement since a salt-loosing crisis at age 5 wk, and testosterone had been introduced at age 24 yr after failure of spontaneous puberty. On withdrawing testosterone replacement for 8 wk, he was confirmed to have hypogonadotropic hypogonadism with LH below 1.0, FSH of 1.5 IU/liter, and testosterone of 2.9 nmol/liter. Administration of GnRH (50 ␮g, iv) resulted in no change in either LH or FSH concentrations. However, administration of hCG (3000 IU twice weekly) resulted in rapid normalization of testosterone secretion (13 nmol/liter at 3 wk). After 9 months of treatment with continued hCG administration in combination with FSH (150 IU three times weekly), he remained azoospermic. The serum inhibin B concentration before gonadotropin administration was 112 pg/ml and rose slightly to 144 pg/ml after 7 months of gonadotropin treatment. Testicular volumes remained 3 ml bilaterally. Testosterone replacement therapy was reinitiated thereafter. Kindred analysis and identification of nucleotide mutations

Subject JM. Kindred JM are Scottish (Fig. 1A). JM’s older sibling had died at age 23 d (Fig. 1A; III-AHC); he had presented at 16 d of age with vomiting. Postmortem examination revealed very small adrenal glands (combined weight, 0.68 g) with abnormal architecture with large vacuolated irregularly arranged cells. A diagnosis of AHC was made: other organs, including pituitary gland and testes, appeared of normal size. The proband’s mother (Fig. 1A; II-1) was interviewed to determine whether other family members had been diagnosed with AHC, and blood samples were obtained from close family members. DNA sequencing of amplified PCR fragments (Fig. 1B) identified a C3 A transversion in the second exon of the DAX-1 gene (arrow) and established that the proband was hemizygous; his mother was heterozygous, but his sister did not carry the mutation. This transversion altered the restriction enzyme recognition

1344



FIG. 1. Kindred analysis of JM and RW pedigrees and identification of nucleotide changes in DAX-1. f, Hemizygous males; J, heterozygous carrier females. Generations are indicated in Roman numerals, and additional information is identified by lowercase letters or numbers. A, Kindred JM has five generations. Genotyping was performed on numbered individuals. Lowercase letters correspond to: a, no children; b, stillborn; c, spina bifida; d, neonatal death. LP denotes an individual reported in Ref. 29. B, Sequence analysis of kindred JM: arrow indicates nucleotide alteration of C3 A. Restriction fragment analysis of PCR products generated from kindred JM and DNA nucleotide changes. RsaI cleaves control 142-bp PCR product into 59 and 84 bp, but not mutant DNA; conversely, Tsp509I cleaves mutant DNA into 57and 86-bp fragments. C, Control; P, proband; S, sister; M, heterozygous mother. C, Kindred RW and DNA nucleotide alterations. Numbered individuals were genotyped. I-1 and II-2, Heterozygous mother and sister (not shown); II-3, hemizygous proband. Arrow indicates T3 C transversion on DNA chromatogram.

sequence for RsaI and introduced one recognized by Tsp509I. Changes in the DNA sequence of the JM kindred were confirmed by gel analysis after digestion of a 143-bp fragment (Fig. 1B). RsaI cleaved control 143-bp PCR products into 59and 84-bp fragments, whereas Tsp509I did not cleave control DNA, but did cleave DNA carrying the point mutation into 57 and 86 bp. This point mutation alters a tyrosine into a stop codon (Y399X) and so truncates the DAX-1 protein by 71 amino acids (Table 3). The same mutation has been reported for family member LP (Fig. 1A; V-AHC), who has also been diagnosed with AHC, although no kindred analysis was reported (29). Kindred JM has three family members with AHC, establishing that this mutation has been inherited from previous generations and has not occurred de novo. The high neonatal morbidity in JM’s siblings (III-c and -d) was due not to AHC, but to other complications (prematurity and spina bifida). How-

ever, it is noteworthy that in generation III there were two stillborn male siblings (III-b) and a number of family members do not have children (III-a and IV-a), although further details are not available. Subject RW. Kindred RW is English in origin (Fig. 1C). Again, an elder sibling had previously been diagnosed with AHC at postmortem examination, having died in the neonatal period (Fig. 1C; II-AHC). DNA sequencing of the DAX-1 gene in RW’s family identified a single occurrence of a T3 C transversion in the proband, and both his mother and sister were heterozygous for this mutation (Fig. 1C; I-1 and II-2). This transversion changes the encoded amino acid sequence from leucine to proline, causing a missense mutation in codon 297 in the first exon of the DAX-1 gene (Table 3). This missense occurs within a recognizable amino acid LLXLXL repeat motif of the protein, changing it to LLXPXL (Table 3).



Analysis of the complete DAX-1 cDNA for both patients revealed that there were no other alterations in the nucleotide coding sequence that differed from published data or from the control. Gene expression studies

The coregulatory interaction between DAX-1 and SF-1 was used to assay repressor activity of DAX-1 constructs (17, 19), as DAX-1 represses SF-1 mediated trans-activation of promoter constructs. SF-1 trans-activation of the LH ␤-subunit gene promoter is required for fertility (13), so a reporter construct containing three copies of the SF-1 DNA-binding TABLE 3. DAX-1 mutations identified in this study Patient

JM

RW

Mutation type

Nonsense

Missense

Nucleotide change

WT aa398 Mut WT aa294 Mut

AAGTACATT K Y I AAGTAAATT K X I CTGCTCATGCTTGAGCTGGCC L L M L E L A CTGCTCATGCCTGAGCTGGCC L L M P E L A

WT, Wild type; Mut, identified mutation.

site from the LH␤ gene promoter was constructed (33, 36 – 38). The effects of the identified nonsense and missense mutations on function of the DAX-1 protein were tested in vitro and compared with controls (Fig. 2). The DAX-1 control efficiently repressed SF-1-mediated trans-activation at low concentrations (16 ng); cotransfection of high amounts (63,125 ng) of control DAX-1 expression vectors further reduced SF-1/ptk-LUC gene expression levels well below basal levels, but this may be due to transcriptional interference and has been noted by others when high concentrations of DAX-1 are transfected in vitro (39). In contrast, neither Y399X nor L297P DAX-1 mutant efficiently repressed SF-1 trans-activation at low concentrations (16 ng). It is notable that the missense L297P mutation affected DAX-1 protein function as profoundly as the nonsense Y399X mutation (Fig. 2).

Mutation

Testicular histology of sibling of JM Y399X

L297P

Examination of tissue sections revealed the presence of well defined seminiferous testis cords containing numerous Sertoli cells and germ cells surrounded by an interstitial region (Fig. 3A). The presence of functionally competent Sertoli cells was confirmed by immunopositive cytoplasmic staining for AMH (Fig. 3B). At high power magnification testis cords were clearly surrounded by a layer of peritubular

FIG. 2. Effects of DAX-1 mutants on SF-1 mediated trans-activation. Schematic showing interaction of DAX-1 with SF-1 bound to DNA recognition sequence in SF-1/ptk-Luc. SF-1/ptk-LUC (125 ng) was cotransfected with 100 ng ␤-galactosidase with or without SF-1 to establish the level of SF-1 induction; increasing amounts (16, 32, 63, and 125 ng) of control, Y399X, or L297P DAX-1 DNA expression constructs were added to this mix, and LUC levels were determined. Results were determined from three independent experiments performed in triplicate and are expressed as relative light units (RLU) ⫻ (103) ⫾ SEM calculated after correcting for transfection efficiency.

1346


cells (small arrows) and contained numerous large round cells identified as germ cells (gonocytes or spermatogonia; large arrows in B). The interstitium contained cells tentatively identified as Leydig cells. We have previously demonstrated expression of DAX-1 protein in human fetal testes (40) and used the same antibody that is directed against the N terminus of human DAX-1 to demonstrate that immunopositive Sertoli cells (arrows in Fig. 3C) could be identified, although background staining was present. Sertoli cell nuclei were also immunopositive for SF-1 (Fig. 3D). No immunopositive staining for aromatase was detected (not shown). Discussion

We here report two DAX-1 mutations in men with AHC and HH: patient JM had a nonsense mutation at amino acid Y399X, and patient RW carried a missense mutation at amino acid L297P. The mutation in RW is novel. Using the coregulatory interaction between SF-1 and DAX-1 as an assay of DAX-1 repressor function, we have demonstrated that the DAX-1 proteins synthesized in both patients have minimal repressor activity compared with WT, and the missense L297P mutation affected protein function as severely as the nonsense Y399X mutation. There are a number of apparent anomalies when correlating DAX-1 mutations with phenotype. Most patients with DAX-1 mutations present in infancy, but adrenal function


can recover over a number of years. This was clearly demonstrated by JM and has been reported in patients up to 13 yr of age (8, 21). The basis for this is unclear, as it does not correlate with the molecular diagnosis (2, 23), and intriguingly the timing of onset of symptoms varies with the same mutation (41). The C-terminal region of DAX-1 (amino acids 253– 470) shows significant homology to the ligand-binding domain of members of the nuclear hormone family and is required for functional activity (17). It is notable that in the paper by Ito et al. (17) deletion of the C-terminal part of the protein, analogous to the situation in patient JM, resulted in no reduction in binding to SF-1 protein; these researchers identified an inhibitory domain between amino acids 443 and 470 at the extreme C terminus of the protein. Evidence for discrete repressor domains within the C-terminal region can also be mapped by clusters of DAX-1 mutations (20, 28), which may in part explain anomalies between the DAX-1 gene mutation and the clinical phenotype in AHC. That the loss of 71 amino acids in the Y399X mutation was as damaging to DAX-1 repressor activity as the L297P point mutation provides further illustration that the degree of protein truncation may not predict the severity of phenotype if not linked to an assay of mutant gene function. The Y399X mutation identified in JM has been previously reported in subject LP (29), and it has now emerged that they are of the same kindred. In that report only limited clinical

FIG. 3. Testicular histology of sibling of JM. The testis contained well defined testis cords (S in panel A, hematoxylin alone), which consisted of Sertoli cells (sc) and numerous germ cells (large arrows in B) and which were surrounded by the interstitium (In) that contained Leydig cells (Lc) and peritubular cells (small arrows in B). Functional Sertoli cells were immunopositive for AMH (cytoplasmic staining in B), DAX-1, and SF-1 (nuclear staining, arrows in C and D, respectively). Magnification: A, C, and D, ⫻40; B, ⫻100.


information on LP is given. As LP is still a child, the information presented here on subject JM adds significantly to the phenotype of this mutation. A similar mutation has been reported previously as case 1 by Nakae et al. (21). In their subject a mutation resulted in a change at amino acid 395 resulting in a truncated protein (Q395X). This subject presented rather later in life than JM, at age 6 yr, and showed no signs of spontaneous puberty. He did, however, show a normal response to hCG administration. JM also showed a normal response to hCG administration when first tested in early spontaneous puberty, but subsequently became unresponsive. The case presented by Nakae et al. (21) was assessed at age 21 yr; thus, it is possible that later assessment may have revealed a change in responsiveness to hCG. The L297P mutation identified in RW has not been previously reported, although an L295P has recently been identified (42), but with no information on the phenotype of the patient. Notably, another missense mutation (A300V), located three amino acids nearer the C terminus, has been reported to have a variable phenotype: one family member was diagnosed with adrenal failure and delayed puberty at age 15 yr, while another developed adrenal failure as a neonate (7, 43). The latter also showed hypothalamo-pituitarygonadal activity for the first 3 yr of life. These comparisons illustrate the complexity of relating phenotype to genotype, especially when the phenotype shows significant alterations over time. Zhang et al. (20) have published a three-dimensional model of the DAX-1 protein. Interestingly, the position of the mutated amino acid (297) in RW maps within a highly conserved site that has been proposed to be of major functional significance for transcriptional silencing (19). The amino acid motif LLXLXL surrounding the mutation site is known to be important for coregulator recruitment (44) in ligand-activated nuclear receptors, and the insertion of a proline within this region occurs within the same LLXLXL motif as a newly reported L295P mutation (42). DAX-1 represses transcription via recruitment of corepressors (30, 31) that are also required for coregulatory interaction with SF-1 (30), indicating that disruption of this motif implicates it as an integral part of the repressor domains contained within the C terminal of the DAX-1 molecule. Hypogonadotropic hypogonadism has been invariably found in association with AHC in subjects with DAX-1 mutations and may have both hypothalamic and pituitary components (45). Interstitial cells are present in the testis from the sibling of JM at the time of his death at age 23 d. Both subjects in this study had low or undetectable basal gonadotropin secretion that did not respond to GnRH administration, either as single dose or during prolonged pulsatile administration. However, testosterone was secreted in response to hCG by the patient carrying the L297P mutation. JM had shown some evidence of initiation of puberty when assessed at age 15 yr, suggesting that his testes contained functional Leydig cells at that time, but they became unresponsive thereafter. In support of this, clinical examination of the testes noted an increase in volume that was not sustained, and corresponding plasma testosterone concentrations fell. Genital size is generally normal in childhood, and the hypothalamic-pituitary-testicular axis can be active (7, 8, 23). Spontaneous puberty followed by progressive gonadotropin


deficiency has been described in association with DAX-1 mutations (46). Limited data are available regarding response to hCG administration in adulthood, although the response during adolescence may be normal (24, 27, 47, 48). These changes demonstrate a progressive evolution of the course of the condition, with the gonadal effects of DAX-1 deficiency manifesting at different stages through the neonatal period, childhood and adolescence, and adulthood. Interestingly, JM also showed evidence of a degree of adrenal responsiveness at age 15 yr, although the response was short-lived. It has been suggested that in addition to playing a role in modulation of the hypothalamic-pituitary-testicular axis, DAX-1 may have direct effects within the testis. DAX-1 is expressed in Sertoli cells and interstitial cells in rats (40, 49). The testes from the older brother of JM had a grossly normal morphology at 23 d of age and contained numerous germ cells as well as Sertoli cells capable of synthesizing AMH, SF-1, and the truncated DAX-1 protein. A role for DAX-1 in spermatogenesis is supported by the report of an individual with a very mild AHC phenotype with oligospermia who was unresponsive to gonadotropin administration (5). The inability to induce spermatogenesis despite gonadotropin therapy in this and previous reports (26, 27) suggests that although germ cells may be present in the testes of adults with DAX-1 mutations, there appears to be a defect in spermatogenesis additional to coexisting hypogonadotropism that may be due to direct effects on Sertoli cell function. This interpretation is further supported by the significant serum concentration of inhibin B in RW, consistent with the presence of germ cells within the testis (50, 51), although in the mild case described by Tabarin et al. (5), inhibin B was at the limit of detection. Low concentrations were found in subject JM. These data therefore increase the spectrum of the testicular phenotype in DAX-1 mutations. The description of testicular morphology in a sibling with AHC who died has also allowed us to make further comparisons with the effects of DAX-1 gene manipulation in the mouse. Immunohistochemical analysis showed that DAX-1 protein was expressed in the testis, using an antibody directed against the presumed conserved N terminus of the molecule. This result demonstrates for the first time in vivo expression of truncated DAX-1 in human testis. Interestingly, in a patient with a closely related mutation [case 1, (21)], mRNA expression of the mutated DAX-1 was detected in the testis. DAX-1 may function differently in mice, as genedisrupted DAX-1 mice show abnormal differentiation of Leydig and Sertoli cells and progressive degeneration of the seminiferous epithelium (52, 53), and DAX-1 expression in intact Sertoli cells can rescue infertility (53). These abnormalities were not apparent in human neonatal tissue. We also found no evidence of overexpression of aromatase, which has been described in the Leydig cells of DAX-1-knockout mice (39), although this may have been because levels of the protein were too low to be detected immunohistochemically. It is likely that these differences reflect in part the developmental stages examined in humans and mice and may reflect the postinfancy onset of the testicular lesion in the human. However, it is unclear whether the changes observed in the mouse are of relevance to the human phenotype of this

1348


condition. We are not aware of any reports of testicular histology in adult humans with DAX-1 mutations. In conclusion, the two individuals reported here add to the clinical and genetic data on AHC and hypogonadotropic hypogonadism in association with DAX-1 mutations. These data confirm the potential for recovery of adrenal function for several years during childhood and the loss of gonadal function at puberty. Normal fetal and neonatal development of the testis is suggested by examination of a sibling with AHC who died.


17. 18. 19. 20.

Acknowledgments We are very grateful to the subjects and their families for their cooperation in these studies, and to Dr. J. Keeling, Department of Pathology, Royal Hospital for Sick Children, for provision of the histological specimen. Received October 7, 2002. Accepted December 5, 2002. Address all correspondence and requests for reprints to: Dr. Richard A. Anderson, Medical Research Council Human Reproductive Sciences Unit, Center for Reproductive Biology, University of Edinburgh Chancellor’s Building, 49 Little France Crescent, Edinburgh, United Kingdom EH16 4SB. E-mail: [email protected].

References 1. Zanaria E, Muscatelli F, Bardoni B, Strom TM, Guioli S, Guo W, Lalli E, Moser C, Walker AP, McCabe ERB, Meitingerm T, Monaco AP, SassoneCorsi P, Camerino G 1994 An unusual member of the nuclear hormone receptor superfamily responsible for X-linked adrenal hypoplasia congenita. Nature 372:635– 641 2. Muscatelli F, Strom TM, Walker AP, Zanaria E, Re´can D, Meindl A, Bardoni B, Guioli S, Zehetner G, Rabl W, Schwartz HP, Kaplan J-C, Camerino G, Meitinger T, Monaco AP 1994 Mutations in the DAX-1 gene give rise to both adrenal hypoplasia congenita and hypogonadotropic hypogonadism. Nature 372:672– 676 3. Sikl H 1948 Addison’s disease due to congenital hypoplasia of the adrenals in an infant aged 33 days. J Pathol Bacteriol 60:323–326 4. Mitchell RG, Rhaney K 1959 Congenital adrenal hypoplasia in siblings. Lancet 1:488 – 492 5. Tabarin A, Achermann JC, Recan D, Bex V, Bertagna X, Christin-Maitre S, Ito M, Jamieson JL, Bouchard P 2000 A novel mutation in DAX-1 causes delayed-onset adrenal insufficiency and incomplete hypogonadotrophic hypogonadism. J Clin Invest 105:321–328 6. Prader A, Zachmann M, Illig R 1975 Luteinizing hormone deficiency in hereditary congenital adrenal hypoplasia. J Pediatr 86:421– 422 7. Takahashi I, Takahashi T, Shoji Y, Takeda G 2000 Prolonged activation of the hypothalamus-pituitary-gonadal axis in a child with X-linked adrenal hypoplasia congenita. Clin Endocrinol (Oxf) 53:127–129 8. Binder G, Wollmann H, Schwarze CP, Strom TM, Peter N, Ranke MB 2000 X-linked congenital adrenal hypoplasia: new mutations and long-term follow-up in three patients. Clin Endocrinol (Oxf) 53:249 –255 9. Beato M, Klug J 2000 Steroid hormone receptors: an update. Hum Reprod Update 6:225–236 10. Guo W, Burris TP, McCabe ERB 1995 Expression of DAX-1, the gene responsible for X-linked adrenal hypoplasia congenita and hypogonadotrophic hypogonadism, in the hypothalamic-pituitary-adrenal/gonadal axis. Biochem Mol Med 56:8 –13 11. Ikeda Y, Luo X, Abbud R, Nilson JH, Parker KL 1995 The nuclear receptor steroidogenic factor 1 is essential for the formation of the ventromedial hypothalamic nucleus. Mol Endocrinol 9:478 – 486 12. Shinoda K, Lei H, Yoshii H, Nomura M, Nagano M, Shiba H, Sasaki H, Osawa Y, Ninomiya Y, Niwa O, Morihashi K 1995 Developmental defects of the ventromedial hypothalamic nucleus and pituitary gonadotroph in the Ftz-F1 disrupted mice. Dev Dyn 204:22–29 13. Zhao L, Bakke M, Krimkevich Y, Cushman LJ, Parlow AF, Camper SA, Parker KL 2001 Steroidogenic factor 1 (SF1) is essential for pituitary gonadotrope function. Development 128:147–154 14. Kawabe K, Shikayama T, Tsuboi H, Oka S, Oba K, Yanase T, Nawata H, Morohashi K 1999 Dax-1 as one of the target genes of Ad4BP/SF-1. Mol Endocrinol 13:1267–1284 15. Hoyle C, Narvaez V, Alldus G, Lovell-Badge R, Swain A 2002 Dax1 expression is dependent on steroidogenic factor 1 in the developing gonad. Mol Endocrinol 16:747–756 16. Zazopoulos E, Lalli E, Stocco DM, Sassone-Corsi P 1997 DNA binding and

21.

22.

23.

24. 25.

26.

27.

28.

29.

30. 31.

32. 33.

34.

35.

36. 37. 38.

transcriptional repression by DAX-1 blocks steroidogenesis. Nature 390:311– 315 Ito M, Yu R, Jamieson JL 1997 DAX-1 inhibits SF-1-mediated transactivation via a carboxy-terminal domain that is deleted in adrenal hypoplasia congenita. Mol Cell Biol 17:1476 –1483 Nachtigal MW, Hirokawa Y, Enyeart-VanHouten DL, Flanagan JN, Hammer GD, Ingraham HA 1998 Wilms’ tumor 1 and Dax-1 modulate the orphan nuclear receptor SF-1 in sex-specific gene expression. Cell 93:445– 454 Lalli E, Bardoni B, Zazopoulos E, Wurtz J-M, Strom TM, Moras D, SassoneCorsi P 1997 A transcriptional silencing domain in DAX-1 whose mutation causes adrenal hypoplasia congenita. Mol Endocrinol 11:1950 –1960 Zhang YH, Guo W, Wagner RL, Huang BL, McCabe L, Vilain E, Burris TP, Anyane-Yeboa K, Burghes AH, Chitayat D, Chudley AE, Genel M, Gertner JM, Klingensmith GJ, Levine SN, Nakamoto J, New MI, Pagon RA, Pappas JG, Quigley CA, Rosenthal IM, Baxter JD, Fletterick RJ, McCabe ER 1998 DAX1 mutations map to putative structural domains in a deduced threedimensional model. Am J Hum Genet 62:855– 864 Nakae J, Tajima T, Kusuda S, Kohda N, Okabe T, Shinohara N, Kato M, Murashita M, Mukai T, Imanaka K, Fujieda K 1996 Truncation at the Cterminus of the DAX-1 protein impairs its biological actions in patients with X-linked adrenal hypoplasia congenita. J Clin Endocrinol Metab 81:3680 –3685 Schwartz M, Blichfield S, Muller J 1997 X-linked adrenal hypoplasia in a large Greenlandic family. Detection of a missense mutation (N440I) in the DAX-1 gene; implication for genetic counselling and carrier diagnosis. Hum Genet 99:83– 87 Peter M, Viemann M, Partsch C-J, Sippell WG 1998 Congenital adrenal hypoplasia: clinical spectrum, experience with hormonal diagnosis, and report on new point mutations of the DAX-1 gene. J Clin Endocrinol Metab 83:2666 – 2674 Caron P, Imbeaud S, Bennet A, Plantavid M, Camerino G, Rochiccioli P 1999 Combined hypothalamic-pituitary-gonadal defect in a hypogonadic man with a novel mutation in the DAX-1 gene. J Clin Endocrinol Metab 84:3563–3569 Domenice S, Latronico AC, Brito VN, Arnhold IJ, Kok F, Mendonca BB 2001 Adrenocorticotropin-dependent precocious puberty of testicular origin in a boy with X-linked adrenal hypoplasia congenita due to a novel mutation in the DAX1 gene. J Clin Endocrinol Metab 86:4068 – 4071 Seminara SB, Achermann JC, Genel M, Jameson JL, Crowley Jr WF 1999 X-linked adrenal hypoplasia congenita: a mutation in DAX1 expands the phenotypic spectrum in males and females. J Clin Endocrinol Metab 84:4501– 4509. Mantovani G, Ozisik G, Achermann JC, Romoli R, Borretta G, Persani L, Spada A, Jameson JL, Beck-Peccoz P 2002 Hypogonadotropic hypogonadism as a presenting feature of late-onset X-linked adrenal hypoplasia congenita. J Clin Endocrinol Metab 87:44 – 48 Achermann JC, Ito M, Silverman BL, Habiby RL, Pang S, Rosler A, Jameson JL 2001 Missense mutations cluster within the carboxyl-terminal region of DAX-1 and impair transcriptional repression. J Clin Endocrinol Metab 86: 3171–3175 Reutens AT, Achermann JC, Ito M, Gu WX, Habiby RL, Donohoue PA, Pang S, Hindmarsh PC, Jameson JL 1999 Clinical and functional effects of mutations in the DAX-1 gene in patients with adrenal hypoplasia congenita. J Clin Endocrinol Metab 84:504 –511 Crawford PA, Dorn C, Sadovsky Y, Milbrandt J 1998 Nuclear receptor DAX-1 recruits nuclear receptor corepressor N-CoR to steroidogenic factor 1. Mol Cell Biol 18:2949 –2956 Altincicek B, Tenbaum SP, Dressel U, Thormeyer D, Renkawitz R, Baniahmad A 2000 Interaction of the corepressor Alien with DAX-1 is abrogated by mutations of DAX-1 involved in adrenal hypoplasia congenita. J Biol Chem 275:7662–7667 Holter E, Kotaja N, Makela S, Strauss L, Kietz S, Janne OA, Gustafsson JA, Palvimo JJ, Treuter E 2002 Inhibition of androgen receptor (AR) function by the reproductive orphan nuclear receptor DAX-1. Mol Endocrinol 16:515–528 Brown P, McNeilly AS 1997 Steroidogenic factor-1 (SF-1) and the regulation of expression of luteinising hormone and follicle stimulating hormone bsubunits in the sheep anterior pituitary in vivo. Int J Biochem Cell Biol 29: 1513–1524 Turner KJ, Macpherson S, Millar MR, McNeilly AS, Williams K, Cranfield M, Groome NP, Sharpe RM, Fraser HM, Saunders PT 2002 Development and validation of a new monoclonal antibody to mammalian aromatase. J Endocrinol 172:21–30 Saunders PT, Millar MR, Macpherson S, Irvine DS, Groome NP, Evans LR, Sharpe RM, Scobie GA 2002 ER␤1 and the ER␤2 splice variant (ER␤cx/␤2) are expressed in distinct cell populations in the adult human testis. J Clin Endocrinol Metab 87:2706 –2715 Halvorson LM, Kaiser UB, Chin WW 1996 Stimulation of luteinizing hormone ␤ gene promoter activity by the orphan nuclear receptor, steroidogenic factor-1. J Biol Chem 271:6645– 6650 Keri RA, Nilson JH 1996 A steroidogenic factor-1 binding site is required for activity of the luteinizing hormone ␤ subunit promoter in gonadotropes of transgenic mice. J Biol Chem 271:10782–10785 Halvorson LM, Ito M, Jameson JL, Chin WW 1998 Steroidogenic factor-1 and early growth response protein 1 act through two composite DNA binding sites


39. 40. 41. 42.

43. 44.

45.

to regulate luteinizing hormone ␤-subunit gene expression. J Biol Chem 273: 14712–14720 Wang ZJ, Jeffs B, Ito M, Achermann JC, Yu RN, Hales DB, Jameson JL 2001 Aromatase (Cyp19) expression is up-regulated by targeted disruption of Dax1. Proc Natl Acad Sci USA 98:7988 –7993 Majdic G, Saunders PTK 1996 Differential patterns of expression of DAX-1 and steroidogenic factor-1 (SF-1) in the fetal rat testis. Endocrinology 137: 3586 –3589 Merke DP, Tajima T, Baron J, Cutler GB 1999 Hypogonadotrophic hypogonadism in a female caused by an X-linked recessive mutation in the DAX1 gene. N Engl J Med 340:1248 –1252 Zhang YH, Huang BL, Anyane-Yeboa K, Carvalho JA, Clemons RD, Cole T, De Figueiredo BC, Lubinsky M, Metzger DL, Quadrelli R, Repaske DR, Reyno S, Seaver LH, Vaglio A, Van Vliet G, McCabe LL, McCabe ER, Phelan JK 2001 Nine novel mutations in NR0B1 (DAX1) causing adrenal hypoplasia congenita. Hum Mutat 18:547 Takahashi T, Shoji Y, Haraguchi N, Takahashi I, Takada G 1997 Active hypothalamic-pituitary-gonadal axis in an infant with X-linked adrenal hypoplasia congenita. J Pediatr 130:485– 488 McInerney EM, Rose DW, Flynn SE, Westin S, Mullen TM, Krones A, Inostroza J, Torchia J, Nolte RT, Assa-Munt N, Milburn MV, Glass CK, Rosenfeld MG 1998 Determinants of coactivator LXXLL motif specificity in nuclear receptor transcriptional activation. Genes Dev 12:3357–3368 Habiby RL, Boepple P, Nachtigall L, Sluss PM, Crowley WF, Jameson JL 1996


46. 47. 48. 49.

50. 51. 52. 53.

Adrenal hypoplasia congenita with hypogonadotrophic hypogonadism. J Clin Endocrinol Metab 98:1055–1062 Bassett JH, O’Halloran DJ, Williams GR, Beardwell CG, Shalet SM, Thakker RV 1999 Novel DAX1 mutations in X-linked adrenal hypoplasia congenita and hypogonadotrophic hypogonadism. Clin Endocrinol (Oxf) 50:69 –75 Black S, Brook CGD, Cox PJN 1977 Congenital adrenal hypoplasia and gonadotrophin deficiency. Br Med J 2:996 Hay ID, Smail PJ, Forsyth CC 1981 Familial cytomegalic adrenocorticotrophic hypoplasia: an X-linked syndrome of pubertal failure. Arch Dis Child 56:715– 721 Ikeda Y, Swain A, Weber TJ, Hentgen KE, Zanaria E, lalli E, Tamai KT, Sasson-Corsi P, Lovell-Badge R, Camerino G, Parker KL 1996 Steroidogenic factor 1 and Dax-1 colocalise in multiple cell lineages: potential links in endocrine development. Mol Endocrinol 10:1261–1272 Andersson A-M, Mu¨ ller J, Skakkebaek NS 1998 Different roles of prepubertal and postpubertal germ cells and Sertoli cells in the regulation of serum inhibin B levels. J Clin Endocrinol Metab 83:4451– 4458 Anderson RA, Sharpe RM 2000 Regulation of inhibin production in the human male and its clinical applications. Int J Androl 23:136 –144 Yu RN, Ito M, Saunders TL, Camper SA, Jameson JL 1998 Role of Ahch in gonadal development and gametogenesis. Nat Genet 20:353–357 Jeffs B, Ito M, Yu RN, Martinson FA, Wang ZJ, Doglio LT, Jameson JL 2001 Sertoli cell-specific rescue of fertility, but not testicular pathology, in Dax1 (Ahch)-deficient male mice. Endocrinology 142:2481–2488