European Journal of Ophthalmology / Vol. 19 no. 1, 2009 / pp. 124-128
Identification of a novel mutation in a Chinese family with X-linked ocular albinism Y. WANG 1 , X. GUO 2 , A. WEI 1 , W. ZHU 1 , W. LI 2 , S. LIAN 1 1 Department
of Dermatology, Xuan Wu Hospital, Capital Medical University, Beijing Laboratory of Molecular Developmental Biology, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Beijing - China
2 Key
P URPOSE . The purpose of the study was to evaluate the GPR143 gene (G-protein coupled receptor 143) in a Chinese three-generation family with OA1, including four carriers and a proband with clinical features of X-linked ocular albinism. M ETHODS . The proband underwent a detailed ophthalmologic evaluation. Blood samples of family members were obtained and genomic DNA isolated. Mutational analysis by SSCP and direct sequencing of the GPR143 gene was used to screen all nine exons including the intron/exon junctions. The novel mutation c.943G>T (p.G315X) found in the study was confirmed by DHPLC to exclude the possibility of polymorphism. R ESULTS . Ophthalmic features of the proband were characteristic of X-linked ocular albinism. The authors identified a novel nonsense mutation p.G315X on exon 8 that was not found in 100 non-albinism subjects by DHPLC. This novel mutation in the GPR143 gene is predicted to subject to nonsense mediated decay. C ONCLUSIONS . The novel mutation p.G315X in the OA1 gene was identified in a Chinese family with ocular albinism, which is predicted to generate a premature stop codon. These findings extend the mutational spectrum of GPR143 gene and will be useful for gene diagnosis and genetic counseling in Chinese OA1 patients. (Eur J Ophthalmol 2009; 19: 124-8) K EY W ORDS . GPR143, Gene diagnosis, Mutation, OA1 Accepted: June 8, 2008
INTRODUCTION X-linked ocular albinism type 1 (OA1, Nettleship-Falls type, OMIM #300500) is the most common form of ocular albinism, with an estimated prevalence of 1 in 60,000 live births (1, 2). The common features in hemizygous individuals with OA1 are congenital nystagmus, foveal hypoplasia, hypopigmentation of the retina, and iris translucency, together with normally pigmented skin and hair (3). Most affected males present impaired visual acuity with variable strabismus, photophobia, and misrouting of optic pathway, which results from a defect in the cellular distribution of melanin in the retinal pigment epithelium (RPE) and iris pigment epithelium (IPE). The size, shape, and number of melanocytes are normal in the skin, hair follicle, and retinal pigment epithelium in 1120-6721/124-05$25.00/0
© Wichtig Editore, 2009
OA1 patients, but they contain variable proportions of giant melanosomes (4). Heterozygous female OA1 carriers may have normal vision, but usually show a classic mosaic pattern of retinal pigmentation. These carriers present progressively more coarse and reticular in the retinal periphery, and a few show small hypopigmented patches on the skin which do not tan normally (5). The causative OA1 gene, GPR143, spans about 40 kb of genomic DNA on chromosome Xp22.3. It contains nine exons and encodes a 424 amino acids G proteincoupled receptor with seven putative transmembrane domains and one potential glycosylation site at codon Asp106 (6-8). To date, 88 mutations in the GPR143 gene have been reported in different population groups (9-14). However, very little is known about the molecular basis of OA1 in Chinese patients. Only one mutation
Wang et al
(p.S89F) was so far reported in Chinese OA1 patients (14). In this study, we selected a three-generation family, including four carriers and one proband with ophthalmologic features of X-linked OA1, to carry out genetic analysis of the GPR143 gene.
METHODS Pedigree and clinical examinations A three-generation family (Fig. 1A) with OA1 from Guangdong Province, China, was recruited in the Chinese Albinism Registry (15). The proband, a 6-monthold boy (III-1), underwent detailed ophthalmologic exa m i n a ti o n i n c luding visua l a c uity, sl i t l amp anterior/posterior segment biomicroscopy, and color fundus photography. The 5-year-old proband’s cousin (III-2) underwent an ophthalmologic examination including visual acuity and color fundus photography. After having informed consent for genetic analyses, blood samples were collected from six family members (I-1, II1–3, III-1–2). This study was approved by the Internal Review Board of the Ethnic Committee of Xuan Wu Hospital, Capital Medical University.
Mutational screening of GPR143 gene by SSCP We extracted genomic DNA from the leukocytes of all subjects by using routine proteinase K/SDS method.
The primer sequences, including all nine exons and the intron/exon junctions, were designed for the mutation screening of the GPR143 gene (Tab. I). For exons 1 and 8, two primer sets were designed respectively, because DNA fragments less than 300 bp were optimized for mutational screening in our system. Standard PCR amplification procedures were performed with an annealing temperature of 59 °C for all primers as shown in Table I. For SSCP experiment, 7 mL PCR products were mixed with 1 volume denature solution (95% deionized formamide, 2.0 mM EDTA [pH 8.0]) and denatured for 5 min at 80 °C followed by chilling on ice. Samples were resolved on 8% polyacrylamide gels containing 5% glycerol at 4 °C, 100 V for 10 hours using an electrophoresis system (DYY-III, Liu Yi Instrument Co., Beijing, China). Finally, the SSCP bands were detected by silver staining (16). PCR products showing shift patterns were reamplified and subjected to sequencing when replicated.
DNA sequencing Genomic PCR was carried out in 20 mL volumes containing 50 ng genomic DNA, 10 pmol of each primer (Tab. I), 5 pmol dNTP, and 0.5 units Taq polymerase (Ampligene). Reactions were carried out as follows: 95 °C (2 min); 35 cycles of 95 °C (30 s), annealing temperature 59 °C (30 s), 72 °C (30 s); final extension 72 °C (10 min). Then products were separated by 1.0% agarose gel electrophoresis and visualized by ethidium bromide
TABLE I - PRIMER SEQUENCES OF GPR143 FOR PCR-SSCP AND SEQUENCING Primer sequence (5'-3') Amplified Region
Exon 1 Exon Exon Exon Exon Exon Exon Exon
2 3 4 5 6 7 8
Exon 9
Forward
tggcgttagcccagtgct GCCTAGGGACCTTCTGCTG ttttccaaagcaagaagtcag tgtctaccctgccgtctcaa ttttcctgacctttccagag agccaaaactttgcttttgag ctgcttccattgccttctct gttctctttacctgctgccatt ggggggagtgtgtcactctg CAGTGGGAATCACTGACCAC ctgagcattttctgaagctgat
Reverse
CTCGTGCTGAGCTTCCAGC gttggaatctgatcagcgc ttatgctcctcaaatcgcag aagagatggcactgagcgtt tgtgttgtcttgcagggaat tgttgtcctggaattctcca ggctatggaaacaacttgcc aaagcggtggcatgatcata CCATGAAAACCCTGCTTCC gtgttcagcagcacctctca CACCTTCCCAACACTGCACT
Amplicon (bp) 251 279 239 251 259 254 251 260 263 263 262
The sequences in lower-cases are on introns.
125
A novel mutation of GPR143
staining. All purified PCR products were sequenced using an ABI PRISM 3700 automated sequencer (Applied Biosystems, Foster City, CA). Additionally, the sequences were analyzed by the BLAST 2 Sequences program from the NCBI Web site (http://www.ncbi.nlm. nih.gov/blast/ bl2seq/wblast2.cgi) to examine any nucleotide changes compared with the reference sequence available in the NCBI Genome database.
Denaturing high-performance liquid chromatography (DHPLC) analysis
RESULTS Clinical features In this family (Fig. 1A), the proband (III-1) was remarkable for congenital nystagmus and photophobia at age 6 months. Ocular examination revealed translucency of the iris including foveal hypoplasia and a prominence of the choroidal vasculature due to paucity of pigment in the overlying retinal pigment epithelium and macular hypoplasia (Fig. 1B [a, b]). The proband’s 5-year-old cousin (III-2) presented with visual acuity of 0.8 and the fundus images
The novel mutation c.943G>T (p.G315X) found in our study was confirmed by DHPLC. Samples from 100 unaffected controls were likewise tested for the mutation to exclude the possibility of a polymorphism. Prior to DHPLC analysis, PCR products of controls (10 mL) were mixed with PCR products of affected samples (10 mL). The mixtures were denatured at 95 °C for 5 min and gradually cooled to room temperature to facilitate heteroduplex formation, and then run under the melting temperature in the WAVE 2100B DNA Fragment Analysis System (Transgenomic, A Omaha, NE).
B
Fig. 1 - (A) The pedigree of a Chinese family with OA1. The proband is indicated with an arrow. The carriers confirmed by mutational analyses are represented with a dot. (B) Photographs of the fundus of the eyes of the proband (III-1), a 6-month-old boy with clinical signs of X-linked ocular albinism (a, b), and a female carrier (III-2) (c, d). Photographs are from the patient’s medical records taken in Zhuhai Women and Children’s Hospital, Guangdong, China.
126
a
b
c
d
Wang et al
Fig. 2 - Identification of a novel mutation c.943G>T (p.G315X) in the GPR143 gene in the Chinese family with OA1 in Figure 1. (A) Sequence analysis of the proband (III-1) showing hemizygosity for p.G315X. (B) A representative graph of carriers showing heterozygosity for p.G315X (III-2). (C) Sequence analysis of an unaffected male (II-2) at codon G315.
an abnormal band pattern observed in the proband’s sample when comparing two unaffected control samples and subsequent sequencing revealed a novel nonsense mutation c.943G>T (p.G315X) (Fig. 2A), which was not detected in the unaffected subject II-2 (Fig. 2C), and the DHPLC pattern of the mutation was different from that of 100 unaffected subjects (Fig. 3), indicating it is unlikely a polymorphism of this nucleotide change. In addition, no other mutation of the GPR143 gene from the proband’s sample was found by directly sequencing all nine exons, including the intron/exon junctions. The affected male (III-1) was hemizygous for the mutation (Fig. 2A), whereas his mother (II-1), grandmother (I-2), aunt (II-3), and cousin (III-2) all showed heterozygosity at this nucleotide position (Fig. 2B), supporting the X-linked recessive inheritance in this family.
DISCUSSION
Fig. 3 - Representative curves of the c.943G>T mutation of GPR143 by DHPLC. M = heterozygote; N = normal control.
showed that a mosaic pattern of hypopigmented RPE intermixed with normally pigmented RPE (Fig. 1B [c, d]). The proband’s 34-year-old mother (II-1) presented with a visual acuity of 1.0, and her binocularity was normal using the Lang Chart.
A novel mutation of GPR143 gene The proband was screened for a mutation by applying the SSCP method. Only in exon 8 of the GPR143 gene was
In this study, we reported a family with typical clinical features of X-linked ocular albinism. The sequence analysis of the GPR143 gene identified a novel nonsense mutation c.943G>T in this Chinese OA1 family, which is predicted to generate a premature stop codon (p.G315X) and subject to nonsense mediated decay (17). Multiple inheritance patterns have been described for congenital nystagmus; however, ocular albinism presents mostly the X-linked inheritance (OMIM 300500) (1, 2). In this pedigree, the four unaffected female carriers of OA1, I-2, II-1, II-3, and III-2, were all heterozygotes for p.G315X, while the male proband (III-1) was hemizygous for this mutation. The p.G315X hemizygote coexists with the affected phenotypes, whereas the heterozygotes did not show similar lesions in the eyes, supporting the Xlinked recessive inheritance. Most missense, nonsense, frameshift, and splice site mutations of GPR143 gene were found on exons 1, 2, 3, 6, and 7, with few mutations identified on exons 4, 5, 8, and 9 (18). Genotype–phenotype relationship has rarely been described. In this study, we found a p.G315X mutation in exon 8 that is close to the p.Y311X mutation. The p.Y311X mutation is located in a region of the protein within the membrane lipid bilayer, and affects its subcellular localization (12), suggesting a similar effect may exist for the p.G315X mutation. In summary, we have identified a novel mutation in the GPR143 gene in a Chinese family with X-linked ocular al-
127
A novel mutation of GPR143
binism, which will extend the mutational spectrum of GPR143 gene and be useful for gene diagnosis and genetic counseling of OA1.
ACKNOWLEDGEMENTS
Reprint requests to: Shi Lian, MD Department of Dermatology Xuan Wu Hospital Capital Medical University 45 Changchun St Xuanwu District Beijing 100053, China
[email protected]
The authors thank the volunteers for donating blood samples. They also thank Prof. Xiangdong Zhang from the Department of Ophthalmology, Capital Medical University, for discussions in analyzing the photographs of the fundus. This work was supported in part by grants from the 863 Program of China (2006AA02Z322; 2006AA02A407) (to W.L.), and from Capital Medical Development Foundation (2007-3111) (to W.Z.).
Wei Li, PhD Institute of Genetics and Developmental Biology Chinese Academy of Sciences Datun Rd Chaoyang District Beijing 100101, China
[email protected]
The authors have no proprietary interest.
REFERENCES 1.
King RA, Hearing VJ, Creel DJ, Oetting WS. Albinism. The Metabolic and Molecular Bases of Inherited Disease, 8th ed. New York: McGraw-Hill, 2001; 5587. 2. Rosenberg T, Schwartz M. X-linked ocular albinism: prevalence and mutations: a national study. Eur J Hum Genet 1998; 6: 570-7. 3. Creel D, O’Donnell FE, Witkop CJ. Visual system anomalies in human ocular albinos. Science 1978; 201: 931-3. 4. Preising M, Opde Laak JP, Lorenz B. Deletion in the OA1 gene in a family with congenital X linked nystagmus. Br J Ophthalmol 2001; 85: 1098-103. 5. Hegde M, Lewis RA, Richards CS. Diagnostic DNA testing for X-linked ocular albinism (OA1) with a hierarchical mutation screening protocol. Genet Test 2002; 6: 7-14. 6. Schiaffino MV, Bassi MT, Galli L, et al. Analysis of the OA1 gene reveals mutations in only one-third of patients with Xlinked ocular albinism. Hum Mol Genet 1995; 4: 2319-25. 7. Bassi MT, Schiaffino MV, Renieri A, et al. Cloning of the gene for ocular albinism type 1 from the distal short arm of the X chromosome. Nat Genet 1995; 10: 13-9. 8. d’Addio M, Pizzigoni A, Bassi MT, et al. Defective intracellular transport and processing of OA1 is a major cause of ocular albinism type 1. Hum Mol Genet 2000; 9: 3011-8. 9. Lauronen L, Jalkanen R, Huttunen J, et al. Abnormal crossing of the optic fibers shown by evoked magnetic fields in patients with ocular albinism with a novel mutation in the OA1 gene. Br J Ophthalmol 2005; 89: 820-4. 10. Li W, He M, Zhou HL, Bourne JW, Liang P. Mutational data
128
11.
12.
13.
14.
15.
16.
17.
18.
integration in gene-oriented files of Hermansky-Pudlak syndrome database. Hum Mutat 2006; 27: 402-7. Mayeur H, Roche O, Vetu C, et al. Eight previously unidentified mutations found in the OA1 ocular albinism gene. BMC Med Genet 2006; 7: 41. Roma C, Ferrante P, Guardiola O, Ballabio A, Zollo M. New mutations identified in the ocular albinism type 1 gene. Gene 2007; 402: 20-7. Iannaccone A, Gallaher KT, Buchholz J, Jennings BJ, Neitz M, Sidjanin DJ. Identification of two novel mutations in families with X-linked ocular albinism. Mol Vis 2007; 13: 185661. Liu JY, Ren X, Yang X, et al. Identification of a novel GPR143 mutation in a large Chinese family with congenital nystagmus as the most prominent and consistent manifestation. J Hum Genet 2007; 52: 565-70. He M, Li W. China genetic counseling network (CGCN): A website on genetic counseling and genetic education. Hereditas (Beijing) 2007; 29: 381-4. Rossetti S, Englisch S, Bresin E, Pignatti PF, Turco A. Detection of mutations in human genes by a new rapid method: cleavage fragment length polymorphism analysis (CFLPA). Mol Cell Probes 1997; 11: 155-60. Maquat LE. Nonsense-mediated mRNA decay: splicing, translation and mRNP dynamics. Nat Rev Mol Cell Biol 2004; 5: 89-99. Bassi MT, Bergen AA, Bitoun P, et al. Diverse prevalence of large deletions within the OA1 gene in ocular albinism type 1 patients from Europe and North. America Hum Genet 2001; 108: 51-4.
