Idiopathic Pulmonary Fibrosis - ATS Journals

Supplement Idiopathic Pulmonary Fibrosis Naftali Kaminski, John A. Belperio, Peter B. Bitterman, Li Chen, Stephen W. Chensue, Augustine M.K. Choi, Sanja Dacic, James H. Dauber, Roland M. du Bois, Jan J. Enghild, Cheryl L. Fattman, Jan C. Grutters, Astrid Haegens, Lana E. Hanford, Nicolas Heintz, Peter M. Henson, Cory Hogaboam, Valerian E. Kagan, Michael P. Keane, Steven L. Kunkel, Susan Land, James E. Loyd, Nicholas Lukacs, Maximilian MacPherson, Brian Manning, Nicole Manning, Marcella Martinelli, David R. Moller, Danielle Morse, Brooke Mossman, Paul W. Noble, Norma Nowak, Tim D. Oury, Annie Pardo, Andrew Perez, Thomas L. Petty, Sem H. Phan, Maria E. Ramos-Nino, Prabir Ray, Robert M. Rogers, Hiroe Sato, Luca Scapoli, Lisa M. Schaefer, Moise´s Selman, Maria Stern, Diane C. Strollo, Vladimir A. Tyurin, Zuzana Valnickova, Kenneth I. Welsh, Frank A. Witzmann, Samuel A. Yousem, and Robert M. Strieter

CONTENTS

S3

Introduction. Augustine M.K. Choi

S47

Pulmonary Fibrosis in Families. James E. Loyd

S4

To the Pittsburgh International Lung Conference with Love. Thomas L. Petty

S51

Gene Profiling and Kinase Screening in Asbestos-Exposed Epithelial Cells and Lungs. Maria E. Ramos-Nino, Nicolas Heintz, Luca Scapoli, Marcella Martinelli, Susan Land, Norma Nowak, Astrid Haegens, Brian Manning, Nicole Manning, Maximilian MacPherson, Maria Stern, and Brooke Mossmann

S59

The Importance of Sarcoidosis Genotype to Lung Phenotype. Jan C. Grutters, Hiroe Sato, Kenneth I. Welsh, and Roland M. du Bois

S63

Cytokine Phenotypes Serve as a Paradigm for Experimental Immune-Mediated Lung Diseases and Remodeling. Steven L. Kunkel, Stephen W. Chensue, Nicholas Lukacs, and Cory Hogaboam

S67

CXC Chemokines in Vascular Remodeling Related to Pulmonary Fibrosis. Robert M. Strieter, John A. Belperio, and Michael P. Keane

S70

Possible Roles for Apoptosis and Apoptotic Cell Recognition in Inflammation and Fibrosis. Peter M. Henson

S5

Histologic Classification of Idiopathic Chronic Interstitial Pneumonias. Sanja Dacic and Samuel A. Yousem

S10

Imaging of the Idiopathic Interstitial Lung Diseases: Concepts and Conundrums. Diane C. Strollo

S19

The Prognosis of Idiopathic Pulmonary Fibrosis. Andrew Perez, Robert M. Rogers, and James H. Dauber

S27

Idiopathic Pulmonary Fibrosis: New Insights into Classification and Pathogenesis Usher in a New Era in Therapeutic Approaches. Paul W. Noble

S32

Microarray Analysis of Idiopathic Pulmonary Fibrosis. Naftali Kaminski

S37

Pulmonary Fibrosis of Sarcoidosis: New Approaches, Old Ideas. David R. Moller

S42

Proteomic and Inducible Transgenic Approaches to Study Disease Processes. Prabir Ray, Li Chen, Vladimir A. Tyurin, Valerian E. Kagan, and Frank A. Witzmann

Am. J. Respir. Cell Mol. Biol. Vol. 29, pp. S1–S105, 2003 DOI: 10.1165/rcmb.2003-0159SU Internet address: www.atsjournals.org

S2

AMERICAN JOURNAL OF RESPIRATORY CELL AND MOLECULAR BIOLOGY VOL. 29 2003

S77

Regulation of Receptor for Advanced Glycation End Products during BelomycinInduced Lung Injury. Lana E. Hanford, Cheryl L. Fattman, Lisa M. Schaefer, Jan J. Enghild, Zuzana Valnickova, and Tim D. Oury

S82

The Role of Heme Oxygenase-1 in Pulmonary Fibrosis. Danielle Morse

S87

Fibroblast Phenotypes in Pulmonary Fibrosis. Sem H. Phan

S93

The Epithelial/Fibroblastic Pathway in the Pathogenesis of Idiopathic Pulmonary Fibrosis: Tying Loose Ends. Moise´s Selman and Annie Pardo

S98

Molecular Targets for Drug Discovery in Idiopathic Pulmonary Fibrosis: Work in Progress. Peter B. Bitterman

S102

Pittsburgh International Lung Conference at Nemacolin: Summary. Robert M. Strieter

Idiopathic Pulmonary Fibrosis

S3

Introduction The discipline of respiratory medicine is experiencing an era of unprecedented advance in our understanding of the fundamental basis of human lung disease. Exponential growth in basic lung biology, fueled by the elucidation of the human genome sequence, is successfully coupled with unique human disease applications of this knowledge. This fusion of basic genetics and clinical medicine promises to change our understanding of lung disease diagnosis and treatment. With this promise come major challenges. Our brightest investigators are faced with significant pressures related to academic and clinical productivity, financial stability, and competition. In this backdrop, we have created the Pittsburgh International Lung conference. Our goal is to establish a forum for junior and senior lung investigators to isolate themselves, focus on “state of the art” investigation in a selected area of lung disease, and foster collaborative, collegial, and productive interactions. In proposing this conference, we have turned to the gold standard. For over 40 years, the Aspen Lung Conference has served, with great distinction, a unique role for lung investigators. Inaugurated in 1958 as a conference to understand emphysema and chronic bronchitis, this annual meeting has evolved as a premier forum for basic scientists, physician investigators, and clinicians, to consider progress in the full range of lung diseases. Conference topics have included chronic obstructive and interstitial lung disorders, the acute respiratory distress syndrome (ARDS), genetically determined lung diseases such as cystic fibrosis, and environmental lung disease. The Aspen conference provides a unique level of focus, scientific leadership, and collegiality not traditionally available at other major pulmonary conferences. We believe the dramatic growth in lung investigation warrants a second annual conference with aligned goals and spirit. We are truly indebted to Drs. Thomas Petty and Marvin Schwarz for their guidance and direction in the development of the Pittsburgh International Lung Conference. The Pittsburgh Conference planning committee will maintain a close dialog with the Aspen Conference organizers to avoid redundancy and promote synergy of the selected topics for these two lung conferences on an annual basis.

The topic chosen for the inaugural year of the Pittsburgh International Lung Conference was Idiopathic Pulmonary Fibrosis. Few lung disorders have seen a renewed investigative focus like IPF. A historical paradigm of lung inflammation leading to fibrosis is being rapidly revised, incorporating an expanding knowledge base in the topic areas of genetics, lung fibrosis, injury, and repair. National clinical trials, often considered impossible in this disorder, now rapidly explore promising yet unproven therapies. Advancing techniques in lung imaging and noninvasive assessment provide clinicians exciting new tools to diagnose and monitor disease progression. We were honored to assemble an international group of leading investigators to focus on the current and future state of our knowledge in IPF. Our motivation for the topic of IPF is also personal. In 2002, the Simmons family of Pittsburgh provided financial support to the University of Pittsburgh to establish the Dorothy P. and Richard P. Simmons Center for Interstitial Lung Disease. This family grew to appreciate the terrible difficulties of IPF from Dorothy’s viewpoint during her entirely too brief course with this disease. Recognizing the existing limitations in our treatments, the family has focused their resources on the promotion of investigation and education in IPF. The initial event of the Pittsburgh International Lung Conference this year was the appointment of Dr. Naftali Kaminski to the Simmons Chair for ILD at the University Of Pittsburgh School Of Medicine. Each year we hope to provide a summary of the conference proceedings in the AJRCMB. The presenters for this year’s conference were truly outstanding, and we are indebted to their commitment and collegiality in this inaugural year. We were inspired by your scientific creativity, and motivated by your vibrant and selfless interactions. Augustine M. K. Choi, M.D. Division of Pulmonary, Allergy, and Critical Care Medicine University of Pittsburgh School of Medicine Pittsburgh, Pennsylvania

S4


To the Pittsburgh International Lung Conference with Love An important new International Lung Conference was inaugurated in October by Professor Augustine Choi (Head of the Division of Pulmonary, Allergy and Critical Care Medicine) and his colleagues at the University of Pittsburgh Medical Center. Its goal is to provide a research forum to focus on the challenging problem of idiopathic pulmonary fibrosis (IPF)-related disorders. A major driving stimulus for this new program was the generosity of Mr. Richard Simmons, who lost his dear wife, Dorothy, to IPF recently. It was my deep honor to be asked by Augustine to offer some remarks about the Aspen Lung Conferences, which began as a series of emphysema conferences in 1958. At that time, the goal was to begin to understand emphysema and chronic bronchitis. Considerable progress has been made since then. The Aspen Lung Conferences, as they were later named, evolved as a forum with the purpose of bringing together basic and applied scientists, as well as clinicians, to consider progress in COPD, asthma, and later the acute respiratory distress syndrome (ARDS). Also, interstitial lung diseases, genetically determined lung diseases such as cystic fibrosis, and less focused topics, such as the environment and the lung, were tackled in the resort atmosphere of Aspen, Colorado. The Aspen conferences were successful, and offered something unique and beyond what was available at major pulmonary conferences in North America and Europe.

The newly inaugurated Pittsburgh Conference offers to do similar things that will help bridge the gap between known clinical challenges in lung disease, and ultimately help to provide solutions to diseases such as IPF. This is how we may emerge from a bewildering wilderness. Only by understanding genetically determined and other risk factors, and the impact of environmental exposures that conspire to inflict both acute and chronic lung injuries resulting in progressive fibrosis, will we make significant progress. We must discover the basic molecular and biochemical process involved in IPF as the foundation for developing new therapeutic targets. Armed with muchneeded facts about mechanisms of lung damage and destruction, the pharmaceutical industry will be able to design and develop new pharmacologic agents that will prevent or forestall the progress of IPF. Thus, new progress can be made and solutions found. On behalf of the Aspen Lung Conference Steering Committee and as its official historian, I welcome Pittsburgh International Lung Conference into the arena of struggle and discovery. “Fac –et spera” means work and hope. It is with this spirit and my personal optimism that I wish this new conference God speed. Thomas L. Petty, M.D. University of Colorado Medical Center and Rush-Presbyterian Medical Center


S5

Histologic Classification of Idiopathic Chronic Interstitial Pneumonias Historical Perspectives The diagnosis and management of idiopathic interstitial pneumonia (IIP) have challenged physicians since their description more than a century ago. Significant progress in the understanding of interstitial lung diseases was made in the mid-1960s with recognition of collagen vascular diseases (CVD), drugs, and occupational exposures as potential causes. However, a large group of entities still remained idiopathic, and in 1968 Liebow and Carrington were first to classify chronic IIPs into the following five histopathologic subgroups: usual interstitial pneumonia (UIP), bronchiolitis interstitial pneumonia (BIP), desquamative interstitial pneumonia (DIP), giant cell interstitial pneumonia (GIP), and lymphoid interstitial pneumonia (LIP) (1). In the ensuing twenty years, new entities were described and the original IIPs studied in greater depth. The results were then codified in the classification schema described in 1998 by Katzenstein and Myers (2). Their classification scheme recognized five entities: usual interstitial pneumonia (UIP), desquamative interstitial pneumonia (DIP), respiratory bronchiolitis–associated interstitial lung disease (RBILD), nonspecific interstitial pneumonia (NSIP), and acute interstitial lung disease (AIP) (former Hamman-Rich syndrome). The most recent classification by the American Thoracic Society and European Respiratory Society (ATS/ERS) emphasizes the importance of an integrated clinical, radiologic, and pathologic approach to the diagnosis of IIP (3). In particular, it is vitally important that biopsy findings are correlated with high-resolution computed tomography (HRCT), as heterogeneity of lung injury patterns are common in IIP (4–6). This classification expands on the histopathologic terms defined by Katzenstein and Myers, but more precisely defines the relationship between clinico-radiographic findings and histopathology.

Fundamental Rules for Pathologic Classification Although the clinical and radiographic diagnosis of IIP can be made in some cases, many patients still require open lung biopsy to determine their underlying histopathologic pattern. Pathologic classification is a very dynamic process requiring close clinico-radiographic correlation. For most practicing pulmonary pathologists, the diagnosis of chronic interstitial lung disease is made at low magnification. Several questions relating to the histologic review of the lung biopsies need to be answered to make a correct diagnosis (Figure 1). The first question is whether the disease process is diffuse or patchy. The process is patchy if there are alternating zones of normal and inflammatory/fibrosing lung parenchyma. In contrast, if the entire pulmonary parenchyma

This section was written by Sanja Dacic and Samuel A. Yousem (Department of Pathology, Division of Anatomic Pathology, University of Pittsburgh Medical Center, Presbyterian University Hospital, Pittsburgh, Pennsylvania).

appears affected by the inflammatory process and there is very little or no normal lung parenchyma associated with the disease, the process is classified as diffuse. The second important issue is to identify the primary anatomic sites of the lobule/acinus affected by the inflammatory or fibrosing process. The anatomic locations affected by the common chronic inflammatory lung diseases are summarized in the Table 1. Subpleural or paraseptal distribution reflects injury in the distal portion of the lobule and acinus, and is defined by the extension of the inflammation and fibrosis from the subpleural region centripetally into the pulmonary parenchyma. With a bronchiolocentric distribution, the periphery of the pulmonary lobule is relatively spared and the inflammatory process is primarily localized to the bronchovascular bundle with extension into the contiguous peribronchiolar alveolar septa. Alveolar septal distribution is defined by thickened alveolar septa, either by inflammation or fibrosis, throughout the lobule. The process is lymphangitic if the inflammation tracks along the visceral pleura, interlobular septa, and bronchovascular bundles with relative sparing of the septa. The third basic concept in the understanding of interstitial lung disease is the concept of temporal homogeneity and temporal heterogeneity. Temporal homogeneity indicates that the age of lung injury is approximately the same (acute, subacute, or chronic), and there are no mixtures of all three injury patterns in the same biopsy. In contrast, in temporally heterogenous lung injury one can identify areas of honeycombing (chronic), interstitial or air space fibromyxoid connective tissue (subacute), and alveolar epithelial cell necrosis and hyaline membranes (acute). Finally, one needs to define the overall phase of interstitial injury that may play an important role in predicting responsiveness to therapy: acute, interstitial edema with alveolar pneumocyte necrosis, fibrin, and hyaline membranes; subacute, airspace or interstitial loose fibromyxoid granulation tissue; or scar, remodeled or densely fibrotic lung where architecture is often destroyed, remodeled, or thickened by dense eosinophilic collagen. Once the above described features are identified, histologic classification of IIP should be relatively straightforward in most cases, particularly when correlated with radiographic and clinical findings (Table 2). It is important to emphasize that subclassification of IIP requires exclusion of known causes of these patterns of injury. This mandates close communication between clinicians, radiologists, and pathologists, and could result in reclassification of an interstitial pneumonia if additional information becomes available.

Usual Interstitial Pneumonia/Idiopathic Pulmonary Fibrosis UIP is characterized by patchy subpleural and paraseptal distribution of parenchymal injury. Temporal heterogeneity is seen at low magnification, with alternating areas of normal lung parenchyma, interstitial mononuclear infiltrates, septal fibromyxoid tissue (fibroblastic foci), and honeycomb lung

S6


Figure 1. Diagnostic approach and pathology interpretation of open lung biopsies in clinically suspected cases of chronic interstitial pneumonia.

(Figure 2). Secondary changes, such as pulmonary hypertension and mucous plugs, are frequently present (2, 7, 8). Open lung biopsies may occasionally show a combination of UIP pattern and subacute (cryptogenic organizing pneumonitis [COP]) or acute diffuse alveolar damage (DAD) lesions (9, 10). If no underlying cause can be determined for such presentation, this histology reflects an accelerated phase or acute exacerbation of UIP (6, 7). Occasionally, moderate number of interstitial or airspace eosinophils may be seen, but they are typically focal, and eosinophilic pneumonia can be excluded (11).

TABLE 1

Anatomic compartments affected by common chronic inflammatory lung diseases Anatomic Compartment

Chronic Inflammatory Lung Disease

Subpleural/Peripheral lobular Usual interstitial pneumonia Bronchiolocentric Respiratory bronchiolitis Hypersensitivity pneumonitis Bronchiectasis Cryptogenic organizing pneumonia Small airways disease Alveolar septal Nonspecific interstitial pneumonitis Desquamative interstitial pneumonitis Diffuse alveolar damage Lymphoid interstitial pneumonia Lymphangitic Lymphangitic carcinoma Sarcoidosis Lymphangioleiomyomatosis Low grade lymphoma (MALT type)

It is important to remember that the pattern of interstitial inflammation and fibrosis in patients with CVD, druginduced interstitial disease, chronic hypersensitivity pneumonitis or asbestosis can be histologically indistinguishable from the idiopathic pulmonary fibrosis (IPF), and the clinico-radiologic–pathologic correlation is essential in such instances.

Nonspecific Interstitial Pneumonia NSIP is an idiopathic interstitial pneumonia that does not meet the diagnostic criteria for UIP, DIP, RB-ILD, AIP, or COP. The lung injury is typically diffuse, but may be patchy, and has an alveolar septal pattern. It is characterized by temporally homogenous mild to moderate interstitial mononuclear inflammation (cellular pattern) with dense interstitial fibrosis (fibrosing pattern) (Figure 3). Some cases may show mixed cellular and fibrosing pattern (12–15). Lymphoid aggregates are common. Fibroblastic foci and honeycombing are absent or inconspicuous. Histologic patterns of NSIP can be associated with CVD, hypersensitivity pneumonitis, drug reactions, and infections including HIV, and those clinical conditions should be clinically excluded.

Desquamative Interstitial Pneumonia DIP is characterized by diffuse, temporally homogenous alveolar septal inflammation and fibrosis with uniform airspace filling by smokers’ macrophages (16). The alveolar septa are lined by reactive pneumocytes and are thickened by mononuclear infiltrate and mild increase in septal collagen (Figure 4). It has the appearance of NSIP with all airspaces filled with alveolar macrophages, often of the smokers type.


S7

TABLE 2

Histologic classification of idiopathic interstitial pneumonias (IIP) IIP

UIP NSIP DIP

Site of Injury

D/P

Subpleural/peripheral lobular P Alveolar septal D* Alveolar septal D

RB/ILD Bronchiolocentric COP Bronchiolocentric LIP Alveolar septal

P P D*

Homo/Hetero

Hetero Homo Homo Homo Homo Homo

Age of Injury

Special Features

Cells/fibroblastic foci/scar Cells ⫹ mild diffuse septal fibrosis Cells ⫹ mild diffuse septal fibrosis

— — Uniform airspace filling by alveolar macrophages Cells ⫹ mild bronchiolocentric fibrosis Centrilobular alveolar macrophages Airspace ⫹ interstitial granulation tissue — Cells —

Definition of abbreviations: D, diffuse; Hetero, temporally heterogenous; Homo, temporally homogenous; P, patchy. * Some cases can be patchy.

Because many patients with other IIP are often current or former smokers, DIP-like pattern can be seen focally in UIP, RB-ILD, NSIP, eosinophilic pneumonia, chronic hemorrhage, and veno-occlusive disease.

The presence of airspace neutrophils, acute bronchiolitis, granulomas, necrosis, hyaline membranes, and prominent eosinophilic inflammatory infiltrate strongly argues against the diagnosis of primary COP.

Respiratory Bronchiolitis-Associated Interstitial Lung Disease

Lymphoid Interstitial Pneumonia

COP is a patchy bronchiolocentric temporally homogenous process characterized by fibromyxoid connective tissue plugs in lumens of airways and airspaces (Figure 6). There is a mild peribronchiolar and interstitial mononuclear inflammatory infiltrate. The lung architecture is relatively preserved (21–29).

LIP is characterized by a dense diffuse temporally homogenous lymphoid infiltration predominantly alveolar septal in distribution (Figure 7). The lymphoid infiltrate is comprised mostly of T lymphocytes, plasma cells, and macrophages. Some architectural distortion, including honeycombing, nonnecrotizing granulomas, and small foci of organizing pneumonia, may be present. Lymphoid hyperplasia (MALT hyperplasia) is a frequently associated finding (30–34). The major differential diagnosis from a clinical standpoint is the separation of LIP from low-grade lymphoma, particularly extranodal marginal zone B-cell lymphoma of MALT. Malignant lymphoma usually show a monomorphous lymphoid infiltrate distributed along lymphatic routes, often associated with destruction of alveolar architecture, Dutcher bodies, and pleural infiltration. Immunohistochemical and molecular gene rearrangement studies may be necessary to exclude lymphoproliferative disorder (3).

Figure 2. Usual interstitial pneumonia pattern. Temporally heterogenous lung injury characterized by alternating zones of normal lung parenchyma, interstitial mononuclear infiltrates, and fibroblastic foci (H&E; original magnification: ⫻4).

Figure 3. Nonspecific interstitial pneumonia. The alveolar walls are thickened by mild fibrosis and mild to moderate chronic inflammatory infiltrate (H&E; original magnification: ⫻4).

The histologic changes of RB-ILD are patchy and bronchiolocentric in distribution. It is characterized by a temporally homogenous peribronchiolar mononuclear infiltrate with rare eosinophils, inconspicuous septal mononuclear cells, and irregular, centrilobular airspace filling by finely pigmented macrophages (Figure 5). Mild peribronchiolar fibrosis is also seen (17–20). DIP and RB-ILD, once considered distinct entities, are related lesions which differ only in the severity, distribution, and extent of the histopathologic abnormality.

Cryptogenic Organizing Pneumonia

S8


Figure 4. Desquamative interstitial pneumonia. Temporally homogenous alveolar septal chronic inflammation and fibrosis with diffuse airspace filling by smokers macrophages (H&E; original magnification: ⫻4, insert: ⫻40).

LIP also must be differentiated histologically from follicular bronchiolitis, nodular lymphoid hyperplasia, infection (especially Pneumocystis carinii pneumonia), and other interstitial lung disorders such as NSIP, organizing pneumonia, and UIP. The cited references provide a very detailed description of lymphoid hyperplasia of the lung that is beyond the scope of this very brief summary.

Role of Surgical Lung Biopsy ATS/ERS recently published a consensus statement describing major and minor criteria for the clinical diagnosis of IPF. The panel noted that in the absence of surgical lung biopsy findings, the diagnosis of IPF remains unproven, and that a definitive diagnosis of IIP can be established only with the aid of a surgical lung biopsy (3). In addition, the role of HRCT as an integral part of the evaluation of the

Figure 5. Respiratory bronchiolitis interstitial lung disease. Peribronchiolar chronic inflammation and mild fibrosis with finely pigmented alveolar macrophages in the lumen of respiratory bronchiole and the adjacent airspaces (H&E; original magnification: ⫻10).

Figure 6. Cryptogenic organizing pneumonia. Patchy bronchiolocentric fibromyxoid connective tissue plugs within the bronchiole and the adjacent airspaces (H&E; original magnification: ⫻4).

patient with suspected IIP has been emphasized. The primary role of HRCT is to separate patients with UIP from those with other IIP such as NSIP, RB-ILD, DIP etc. HRCT may also be helpful in identifying patients with other diseases such as sarcoidosis, lymphangioleiomyomatosis, eosinophilic granuloma and hypersensitivity pneumonitis (3). The role of transbronchial biopsy in the diagnosis of IIP in most cases is to exclude sarcoidosis, lymphangitic carcinoma, infections, DAD, and some rare conditions such as alveolar proteinosis, lymphangioleiomyomatosis, and Langerhans’ cell histiocytosis (35–41). Most pulmonary pathologists would agree that the assessment of IIP requires a surgical (open or thoracoscopic) lung biopsy. It is important for the surgeon not to biopsy the radiologically or grossly palpable “worst” areas. This is often nondiagnostic and most times shows nonspecific end-stage honeycomb lung. The open lung biopsy should be taken from more than one lobe of the lung. It is still controversial whether to biopsy lingula and right middle

Figure 7. Lymphocytic interstitial pneumonia pattern. Diffuse thickening of alveolar walls by a marked lymphoplasmacytic infiltrate (H&E; original magnification: ⫻4).


lobe, as both of these sites frequently show nonspecific fibrosis (39–44). The biopsy should be large in the size, and in our experience at least 5 cm in greatest dimension. It should be obtained at the edge of the grossly abnormal areas of the lung to include grossly normal lung parenchyma. Most important is that the biopsy must be deep, extending well into the “medulla” of the subpleural lung parenchyma. Shallow subpleural biopsies are frequently nondiagnostic. This allows one to escape nonspecific subpleural scarring and obtain actively injured lung parenchyma to assess the features that are important in making a diagnosis of IIP. References 1. Liebow, A. A., and C. B. Carrington. 1969. The interstitial pneumonias. In Frontiers of Pulmonary Radiology. M. Simon, E. J. Potchen, and M. LeMay, editors. Grune and Stratton Inc., New York. 102–141. 2. Katzenstein, A. L., and J. L. Myers. 1998. Idiopathic pulmonary fibrosis: clinical relevance of pathologic classification. Am. J. Respir. Crit. Care Med. 157:1301–1315. 3. American Thoracic Society/European Respiratory Society. 2002. International multidisciplinary consensus classification of idiopathic interstitial pneumonias: general principles and recommendations. Am. J. Respir. Crit. Care Med. 165:277–304. 4. Akira, M., M. Sakatani, and E. Ueda. 1993. Idiopathic pulmonary fibrosis: progression of honeycombing at thin-section CT. Radiology 189:687–691. 5. Kazerooni, E. A., F. J. Martinez, A. Flint, D. A. Jamadar, B. H. Gross, D. L. Spizarny, P. N. Cascade, R. I. Whyte, J. P. Lynch, and G. Toews. 1997. Thin-section CT obtained at 10-mm increments versus limited three-level thin-section CT for idiopathic pulmonary fibrosis: correlation with pathologic scoring. Am. J. Roentgenol. 169:977–983. 6. Kim T. S., K. S. Lee, M. P. Chung, J. Han, J. S. Park, J. H. Hwang, O. J. Kwon, and C. H. Rhee. 1998. Nonspecific interstitial pneumonia with fibrosis: high-resolution CT and pathologic findings. Am. J. Roentgenol. 171:1645–1650. 7. Ryu, J. H., T. V. Colby, and T. E. Hartman. 1998. Idiopathic pulmonary fibrosis: current concepts. Mayo Clin. Proc. 73:1085–1101. 8. Katzeinstein, A. L., D. A. Zisman, L. A. Litzky, B. T. Nguyen, and R. M. Kotloff. 2002. Usual interstitial pneumonia: histologic study of biopsy and explant specimens. Am. J. Surg. Pathol. 26:1567–1577. 9. Kondoh, Y., H. Taniguchi, Y. Kawabata, T. Yokoi, K. Suzuki, and K. Takagi. 1993. Acute exacerbation in idiopathic pulmonary fibrosis: analysis of clinical and pathologic findings in three cases. Chest 103:1808–1812. 10. Muller, N. L., M. L. Guerry-Force, C. A. Staples, J. L. Wright, B. Wiggs, C. Coppin, P. Pare, J. C. Hogg. 1987. Differential diagnosis of bronchiolitis obliterans with organizing pneumonia and usual interstitial pneumonia: clinical, functional, and radiologic findings. Radiology 162:151–156. 11. Yousem, S. A. 2000. Eosinophilic pneumonia-like areas in idiopathic usual interstitial pneumonia. Mod. Pathol. 13:1280–1284. 12. Katzenstein, A. L., and R. F. Fiorelli. 1994. Nonspecific intersitial pneumonia/ fibrosis: histologic patterns and clinical significance. Am. J. Surg. Pathol. 18:136–147. 13. Travis, W. D., K. Matsui, J. Moss, and V. J. Ferrans. 2000. Idiopathic nonspecific interstitial pneumonia: prognostic significance of cellular and fibrosing patterns: survival comparison with usual interstitial pneumonia and desquamative interstitial pneumonia. Am. J. Surg. Pathol. 24:19–33. 14. Katzenstein, A. L., and J. Myers. 2000. Nonspecific interstitial pneumonia and the other idiopathic interstitial pneumonias: classification and diagnostic criteria (editorial). Am. J. Surg. Pathol. 24:1–3. 15. Nagai, S., M. Kitaichi, H. Itoh, K. Nishimura, T. Izumi, and T. V. Colby. 1998. Idiopathic nonspecific interstitial pneumonia/fibrosis: comparison with idiopathic pulmonary fibrosis and BOOP. Eur. Respir. J. 12:1010–1019. 16. Liebow, A. A., A. Steer, and J. G. Billingsley. 1965. Desquamative interstitial pneumonia. Am. J. Med. 39:369–404. 17. Yousem, S. A., T. V. Colby, and E. A. Gaensler. 1989. Respiratory bronchiolitis-associated interstitial lung disease and its relationship to desquamative interstitial pneumonia. Mayo Clin. Proc. 64:1373–1380. 18. Myers, J. L., C. F. Veal, M. S. Shin, and A. L. Katzenstein. 1987. Respiratory bronchiolitis causing interstitial lung disease: a clinicopathologic study of six cases. Am. Rev. Respir. Dis. 135:880–884. 19. Fraig, M., U. Shreesha, D. Savici, and A. L. Katzenstein. 2002. Respiratory

S9

20.

21. 22.

23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33.

34. 35. 36.

37. 38. 39. 40. 41.

42. 43. 44.

bronchiolitis: a clinicopathologic study in current smokers, ex-smokers, and never-smokers. Am. J. Surg. Pathol. 26:647–653. Heyneman, L. E., S. Ward, D. A. Lynch, M. Remy-Jardin, T. Johkoh, and N. L. Muller. 1999. Respiratory bronchiolitis, respiratory bronchiolitisassociated interstitial lung disease, and desquamative interstitial pneumonia: different entities or part of the spectrum of the same disease process? Am. J. Roentgenol. 173:1617–1622. Epler, G. R., T. V. Colby, T. C. McLoud, C. B. Carrington, and E. A. Gaensler. 1985. Bronchiolitis obliterans organizing pneumonia. N. Engl. J. Med. 312:152–158. Daniil, Z. D., F. C. Gilchrist, A. G. Nicholson, D. M. Hansell, J. Harris, T. V. Colby, and R. M. du Bois. 1999. A histologic pattern of nonspecific interstitial pneumonia is associated with a better prognosis than usual interstitial pneumonia in patients with cryptogenic fibrosing alveolitis. Am. J. Respir. Crit. Care Med. 160:899–905. Kitaichi, M. 1992. Differential diagnosis of bronchiolitis obliterans organizing pneumonia. Chest 102:44S–49S. King, T. E., Jr., and R. L. Mortenson. 1992. Cryptogenic organizing pneumonia: the North American experience. Chest 102:8S–13S. Izumi, T., M. Kitaichi, K. Nishimura, and S. Nagai. 1992. Bronchiolitis obliterans organizing pneumonia: clinical features and differential diagnosis. Chest 102:715–719. Nagai, S., and T. Izumi. 1996. Bronchiolitis obliterans with organizing pneumonia. Curr. Opin. Pulm. Med. 2:419–423. Yousem, S. A., R. H. Lohr, and T. V. Colby. 1997. Idiopathic bronchiolitis obliterans organizing pneumonia/cryptogenic organizing pneumonia with unfavorable outcome: pathologic predictors. Mod. Pathol. 10:864–871. Dina, R., and M. N. Sheppard. 1993. The histological diagnosis of clinically documented cases of cryptogenic organizing pneumonia: diagnostic features in transbronchial biopsies. Histopathology 23:541–545. Colby, T. V. 1992. Pathologic aspects of bronchiolitis obliterans organizing pneumonia. Chest 102:38S–43S. Koss, M. N., L. Hochholzer, J. M. Langloss, W. D. Wehunt, and A. A. Lazarus. 1987. Lymphoid interstitial pneumonitis: clinicopathologic and immunopathologic findings in 18 patients. Pathology 19:178–185. Kradin, R. L., and E. J. Mark. 1983. Benign lymphoid disorders of the lung, with a theory regarding their development. Hum. Pathol. 14:857–867. Strimlan, C. V., E. C. Rosenow, L. H. Weiland, and L. R. Brown. 1978. Lymphocytic interstitial pneumonitis. Review of 13 cases. Ann. Intern. Med. 88:616–621. Julsrud, P. R., L. R. Brown, C. Y. Li, E. C. Rosenow, and J. K. Crowe. 1978. Pulmonary processes of mature-appearing lymphocytes: pseudolymphoma, well-differentiated lymphocytic lymphoma and lymphocytic interstitial pneumonitis. Radiology 127:289–296. Grieco, M. H., and P. Chinoy-Acharya. 1985. Lymphocytic interstitial pneumonia associated with the acquired immune deficiency syndrome. Am. Rev. Respir. Dis. 131:952–955. Collard, H., and T. King. 2001. The clinical significance of histopathologic subgroups in idiopathic interstitial pneumonia: is surgical lung biopsy essential? Semin. Respir. Crit. Care. Med. 22:347–356. Burt, M. E., M. W. Flye, B. L. Webber, and R. A. Wesley. 1981. Prospective evaluation of aspiration needle, cutting needle, transbronchial, and open lung biopsy in patients with pulmonary infiltrates. Ann. Thorac. Surg. 32: 146–153. Gilman, M. J., and K. P. Wang. 1980. Transbronchial lung biopsy in sarcoidosis. Am. Rev. Respir. Dis. 122:721–724. Wall, C. P., E. A. Gaensler, C. B. Carrington, and J. A. Hayes. 1981. Comparison of transbronchial and open biopsies in chronic infiltrative lung disease. Am. Rev. Respir. Dis. 123:280–285. Gaensler, E. A., and C. B. Carrington. 1980. Open biopsy for chronic diffuse infiltrative lung disease; clinical, roentgenographic, and physiological correlations in 502 patients. Ann. Thorac. Surg. 30:411–426. Bensard, D. D., R. C. McIntyre, B. J. Waring, and J. S. Simon. 1993. Comparison of video thoracoscopic lung biopsy to open lung biopsy in the diagnosis of interstitial lung disease. Chest 103:765–770. Hunninghake, G. W., M. B. Zimmerman, D. A. Schwartz, T. E. King, J. Lynch, R. Hegele, J. Waldron, T. Colby, N. Muller, D. Lynch, J. Galvin, B. Gross, J. Hogg, G. Toews, R. Helmers, J. A. Cooper, R. Baughman, C. Strange, and M. Millard. 2001. Utility of a lung biopsy for the diagnosis of idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 164:193–196. Newman, S. L., R. P. Michel, and N. S. Wang. 1985. Lingular lung biopsy: is it representative? Am. Rev. Respir. Dis. 132:1084–1086. Miller, R. R., B. Nelems, N. L. Muller, K. G. Evans, and D. N. Ostrow. 1987. Lingular and right middle lobe biopsy in the assessment of diffuse lung disease. Ann. Thorac. Surg. 44:269–273. Temes, R. T., N. E. Joste, N. L. Allen, R. E. Crowell, H. A. Dox, and J. A. Wernly. 2000. The lingula is an appropriate site for lung biopsy. Ann. Thorac. Surg. 69:1016–1018.

S10


Imaging of the Idiopathic Interstitial Lung Diseases Concepts and Conundrums The interstitial lung diseases (ILD) are a diverse group of inflammatory-fibrosing disorders that affect predominantly the pulmonary interstitium rather than the airspaces. The etiology of most ILD is known, such as collagen vascular diseases, drug-induced lung diseases, infectious and noninfectious granulomatous diseases, inhalation of organic and inorganic materials and noxious gases, and proliferative and malignant neoplastic processes (1). The diagnosis of ILD, in some instances, may be established from clinical, laboratory, and radiologic data, without lung biopsy (2). The insult that produces idiopathic ILD remains unknown, and the disease is limited to the lungs and is typically immune mediated. Despite the variety of insults that may induce the initial injury of ILD, the pathogenesis and endstage morphologic changes may be similar, although the rate of disease progression may vary considerably (1). The current clinico-pathologic classification of idiopathic nongranulomatous ILD includes a disparate group of lung diseases that have at least some degree of interstitial cellular inflammation and may culminate in pulmonary fibrosis (3) (Table 1). This grouping of diseases includes idiopathic pulmonary fibrosis (IPF), nonspecific interstitial pneumonitis (NSIP), respiratory bronchiolitis–interstitial lung disease (RB-ILD), desquamative interstitial pneumonitis (DIP), cryptogenic organizing pneumonia (COP), and acute interstitial pneumonitis (AIP). The etiology is not always idiopathic. Whereas IPF and NSIP are predominantly diseases of the interstitium, RB-ILD and DIP represent a continuum of smoking-related diseases of the small airways, interstitium, and alveoli. COP is an idiopathic inflammation of the small airways and airspaces with minor involvement of the interstitium. AIP is an idiopathic form of diffuse alveolar damage and involves the alveoli and the interstitium. NSIP is a relatively new histologic category, and like DIP, may not represent a distinct clinicopathologic syndrome (4). In some instances, when an ILD may not be easily or concisely characterized, it may be labeled as “unclassifiable ILD.”

Imaging of Idiopathic ILD The primary role of imaging is to identify the presence and extent of pulmonary fibrosis, as this portends a less favorable prognosis regardless of etiology. In addition, certain patterns of lung involvement may suggest a specific disease category (5). Diseases that involve the interstitium (IPF, NSIP) may result in pulmonary fibrosis and manifest with reticulations (innumerable interlacing linear opacities typically due to intralobular interstitial thickening), “honeycomb” change (cystic dilatation of distal bronchioles and airspaces that share common thickened walls), and traction

This section was written by Diane C. Strollo, M.D. (Dorothy P. and Richard P. Simmons Center for Research and Education in Interstitial Lung Disease, Department of Radiology, University of Pittsburgh Medical Center, Pittsburgh, Pennsylvania).

bronchiectasis or bronchiolectasis (irregular dilatation of bronchi and bronchioles, typically associated with reticulations or honeycomb cysts) (6). Processes that affect the airspaces (DIP, COP, AIP) may exhibit consolidation, defined as a homogeneous increase of lung attenuation that obscures the margins of vessels and airways. Bronchiolocentric diseases (RB-ILD, COP) may exhibit dilated and/or thickened bronchioles. Any process with active inflammation or fibrosis may exhibit “ground glass” attenuation, defined as hazy increased lung attenuation that does not obscure or distort the underlying lung architecture. Ground glass attenuation may precede the development of pulmonary fibrosis (7, 8). When pulmonary fibrosis is the predominant pattern, associated ground glass attenuation typically reflects microscopic changes of fibrosis (9). Computed tomography (CT) and high-resolution CT (HRCT) are the mainstays of the noninvasive evaluation of ILD and play a critical role in its early detection, characterization, and differentiation from other lung diseases. A normal HRCT does not always exclude early and clinically significant ILD, especially when physiologic testing is abnormal (10). The radiologic findings of pulmonary fibrosis on HRCT correlate strongly with fibrosis on histology (P ⫽ 0.0001), and pure ground-glass attenuation in patients with suspected ILD correlates well with interstitial inflammation (P ⫽ 0.03) (5, 11). CT may be used to select an optimal site of lung biopsy and to exclude patients with severe endstage fibrosis who may not benefit from biopsy (5, 12). Radiologic and pathologic features of idiopathic ILD may be identical to those of ILD of known etiology (13). Idiopathic Pulmonary Fibrosis IPF is characterized by relentlessly progressive chronic ILD that is ultimately fatal within three years of diagnosis (14). Patients are typically in the 6th decade or older, and present with exertional dyspnea of insidious onset. The radiologic features of IPF reflect the variegated histologic pattern of usual interstitial pneumonitis (UIP), characterized by temporal heterogeneity with areas of mature fibrosis juxtaposed to active fibroblastic foci and normal lung. The histopathology reflects interstitial injuries that have occurred at different points in time and are at various stages of healing. IPF has a striking predilection for the basilar and peripheral aspects of the lungs and is more severe and rapidly progressive than UIP due to connective tissue diseases. Chest radiography is almost always abnormal and reveals diminished lung volumes and symmetric, bibasilar, and peripheral reticulations (3, 15). Honeycomb cysts and traction bronchiectasis may be present (14) (Figures 1 and 2). The accelerated stepwise deterioration of IPF is characterized by patchy, peripheral, or diffuse consolidation, superimposed on pulmonary fibrosis (16) (Figure 3). Up to 60% of patients with IPF have secondary pulmonary artery hypertension (17). When IPF is superimposed on emphysematous changes, lung volumes may be preserved or increased (18).


S11

TABLE 1

Classification of idiopathic interstitial lung diseases Diagnosis

Acuity

Pathologic Features

IPF/UIP

Chronic

NSIP RB-ILD

Subacute Subacute

DIP

Subacute

COP

Subacute

Temporal heterogeneity Fibroblastic foci Fibrotic and normal lung Interstitial inflammation Alveolar macrophages in interstitium, small airways Alveolar macrophages in airspaces Granulation tissue plugs

AIP

Acute

Hyaline membranes Fibroproliferation

On CT, IPF typically exhibits features of pulmonary fibrosis with little active inflammation (Figure 4). Honeycomb cysts (96%), distorted intralobular reticulations (80%), and traction bronchiolectasis (50%) have a striking predilection for the lung periphery and bases, and may involve all lobes in advanced disease (14, 19). Ground-glass attenuation (75%) is typically admixed with fibrosis and is rarely the dominant pattern (Figures 5 and 6). Mildly enlarged reactive mediastinal lymph nodes are common, and correlate with greater disease severity (20, 21). Following single lung transplantation of patients with IPF, the native lung may exhibit progressive fibrosis (22). It has been reported that ⵑ 10% of patients with IPF, typically older male smokers, may develop lung cancer (23). Squamous cell carcinoma is the most common histologic type. Lung cancer typically arises within areas of fibrosis and manifests as a peripheral pulmonary nodule or mass or as a subtle, poorly defined area of consolidation or asym-

Figure 1. IPF. Posteroanterior (PA) chest radiograph of a 57-yrold male with 2-yr history of progressive dyspnea. The lungs have diminished volume and bibasilar and peripheral reticulations and honeycomb change (arrow).

Disease Distribution

Radiologic Features

Basilar, peripheral

Fibrosis, honeycomb

Basilar, peripheral Upper lungs Bronchocentric Basilar, peripheral Alveolar Patchy upper lungs Small airways, alveolar Diffuse, random

Ground glass ⫾ fibrosis Bronchiolectasis Ground glass Ground glass Consolidation Ground glass, nodules Consolidation Ground glass Consolidation

metric fibrosis, which may make early detection difficult (23, 24) (Figure 7). Nonspecific Interstitial Pneumonitis NSIP has varying amounts of subacute interstitial inflammation (cellular NSIP) and fibrosis (fibrotic NSIP) that do not meet the histologic criteria of UIP or other ILD (25–27). The histopathologic pattern of NSIP exhibits temporal homogeneity that results from a single lung insult, with all areas of reparation at the same stage of healing. Compared with IPF, patients with NSIP pattern tend to be younger and have milder symptoms of shorter duration, with a more favorable prognosis. The radiologic features of NSIP reflect the varied amounts of inflammation and fibrosis. NSIP has a predilection for the basilar and peripheral portions of the lungs, similar to IPF, but tends to have a greater component of inflammation and potentially reversible disease (14). Chest radiography may be normal, but characteristically

Figure 2. IPF. PA chest radiograph of a 69-yr-old male with worsening dyspnea of 10-mo duration. The lungs have diffuse reticulations and honeycomb change.

S12


Figure 3. IPF. PA chest radiograph of a 61-yr-old male with clinical deterioration due to accelerated IPF. The lungs have severe volume loss and bibasilar and peripheral pulmonary fibrosis and patchy consolidation.

reflects decreased lung volumes (70%) and symmetric bibasilar peripheral ground glass attenuation, consolidation, and/or fibrosis (28) (Figure 8). CT features of NSIP may have significant overlap with those of IPF/UIP, DIP, and COP, and cases of NSIP are commonly misdiagnosed on CT (25, 29). Cellular NSIP typically exhibits prominent ground glass attenuation (70– 100%). Fibrotic NSIP may show fine reticulations, thickened septal and pleural lines, traction bronchiolectasis, and honeycomb cysts, which may be identical to those of IPF (25, 29–31). Bronchocentric consolidation, similar to that of COP, is occasionally detected (32). Radiologic and clinical features of NSIP may improve following corticosteroid therapy (33).

Figure 4. IPF. HRCT (lung window) of a 52-yr-old male with dyspnea. Distorted reticulations and mild honeycomb change (arrow) have a basilar and peripheral distribution. Extensive mediastinal fat (asterisk) is secondary to corticosteroid therapy.

Figure 5. IPF. Chest CT (lung window) of a 58-yr-old male with progressive dyspnea. Moderately severe bibasilar and peripheral reticulations (arrow) have a secondary component of ground glass attenuation (arrowhead).

Respiratory Bronchiolitis–Interstitial Lung Disease and Desquamative Interstitial Pneumonitis RB, RB-ILD, and DIP likely represent a continuum of subacute small airways disease in heavy cigarette smokers in the 4th to 5th decades of life. DIP may also result as a nonspecific reaction to a variety of lung insults. DIP was initially thought to represent pneumocytes that had been “desquamated” into the alveoli. It is now recognized that these entities are due to progressive deposition of pigmented alveolar macrophages within the respiratory bronchioles (RB) with patchy extension into the adjacent interstitium (RB-ILD), or rarely, homogeneous deposition within the alveoli (DIP) (34, 35). RB (smokers’ bronchiolitis) is usually an incidental histologic finding in asymptom-

Figure 6. IPF. HRCT (lung window) of a 61-yr-old male with severe dyspnea. The lungs have diffuse reticulations, honeycomb change, and traction bronchiolectasis (arrows).

Figure 7. IPF and primary squamous cell carcinoma of lung. Chest CT (lung window) of a 57-yr-old female smoker. The malignancy developed as an indeterminant pulmonary nodule (arrow) within an area of pulmonary fibrosis.

Figure 9. RB-ILD. PA chest radiograph of a 40-yr-old male smoker with severe dyspnea. The lungs are diffusely emphysematous with reticulations and areas of ground glass attenuation in the lower lungs. A trans-tracheal catheter is present.

atic smokers, whereas patients with RB-ILD typically have symptoms of dyspnea and cough (34). Patients with DIP are more severely symptomatic, and may develop pulmonary fibrosis despite therapy and smoking cessation (35). Imaging features of RB and RB-ILD typically overlap, and may be normal or show subtle areas of ground glass attenuation, fine linear reticulations, and/or emphysematous changes (Figure 9). CT may also reveal small airways disease with mildly thickened and dilated bronchioles, “soft” centrilobular nodules, and ground glass attenuation that may be centrilobular or diffuse (Figures 10 and 11). These abnormalities are typically greatest in the upper aspects of the lungs and may improve or resolve following

Figure 8. Cellular NSIP. (A) PA chest radiograph and (B) HRCT (lung window) of a 53-yr-old male with a 6-mo history of dyspnea. The lung volumes are normal. Moderate areas of ground glass attenuation with minimal reticulations and cystic change suggest interstitial inflammation rather than fibrosis. Note the peripheral distribution on CT. The diagnosis was established via thoracoscopic wedge resections.

Figure 10. RB-ILD. HRCT (lung window) of 33-yr-old female smoker with mild dyspnea and cough of 4-mo duration. The upper aspects of the lungs have mild bronchiolectasis (straight arrow) and “soft” centrilobular nodules (curved arrow).

S14


Figure 11. RB-ILD. Chest CT (lung window) of a 45-yr-old male smoker with persistent cough. The anterior aspects of the lungs have dense ground glass attenuation and mild reticulations. Small pleural effusions are present.

smoking cessation (35). Honeycomb change and traction bronchiectasis are uncommon. Imaging of patients with DIP may be normal or demonstrate predominantly ground glass attenuation and/or consolidation that may be bibasilar and peripheral, or less commonly, diffuse (36) (Figure 12). A smaller component of reticulations and honeycomb change reflect pulmonary fibrosis. Emphysematous changes may also be present. Cryptogenic Organizing Pneumonia COP is a subacute febrile noninfectious disease of the small airways and airspaces that may mimic pneumonia. Patients typically present in the 5th to 6th decades of life with cough and dyspnea of approximately three months duration. COP typically improves dramatically following corticosteroid therapy, but may quickly relapse when the dosage is reduced or discontinued (37, 38). COP is the preferred nomenclature, but is still used interchangeably with the older term of bronchiolitis obliterans organizing pneumonia (BOOP) (37). Injury of the small airways results in mucosal ulcerations that heal with granulation tissue plugs (proliferative “bronchiolitis obliterans”) that extend into the alveoli (“organizing pneumonia”), with a smaller component of interstitial inflammation. Proliferative bronchiolitis of COP is a distinct entity from constrictive bronchiolitis obliterans, which is a common injury of lung and bone marrow transplant recipients and results in irreversible scarring of the bronchiolar walls with secondary air trapping. On chest radiography, COP typically manifests as decreased lung volumes and multifocal subsegmental patchy consolidations with a juxta-pleural or bronchocentric distribution (38) (Figure 13). On CT, COP typically exhibits mixed consolidations and areas of ground glass attenuation that may be triangular, patchy, and peripheral in distribu-

Figure 12. DIP. (A ) PA chest radiograph and (B ) HRCT (lung window) of a 28-yr-old male smoker with a 2-yr history of gradual onset of dyspnea and dry cough. The lungs have moderately severe volume loss and large peripheral areas of ground glass attenuation. Note the emphysematous changes (arrow). The diagnosis was established via bilateral thoracoscopic wedge resections.

tion or extend centrifugally from plugged airways (37, 38). A nodular component, defined by the secondary pulmonary lobule, may have a patent bronchus or feeding vessel (39, 40). Both unilateral and migratory lung involvement have been reported (38). In addition, a subset of patients with COP may exhibit a fulminant clinical course that culminates in severe pulmonary fibrosis and/or death (41). Bibasilar juxta-pleural reticulations are uncommon, and generally correlate with fibrosis and a less favorable outcome (37, 38, 42). Reactive mediastinal lymph nodes may be mildly enlarged. Acute Interstitial Pneumonitis (formerly Hammon Rich Syndrome) AIP is an acute fulminant lung injury due to idiopathic diffuse alveolar damage (43). Patients typically develop rapidly progressive hypoxemia and respiratory failure that re-


Figure 13. COP. (A ) PA chest radiograph and (B ) chest CT (lung window) of a 70-yr-old-female with a subacute history of cough and dyspnea, unresponsive to antibiotic therapy. Patchy linear areas of consolidation and vague nodularity on radiography are irregular and flame-shaped on CT (arrow). The diagnosis of COP was subsequently established via thoracoscopic wedge resection.

quire mechanical ventilation. At least 50% of patients die in the weeks following disease onset. Hamman and Rich originally described AIP as a rapidly progressive and typically fatal form of pulmonary fibrosis (44). AIP is now recognized as a distinct entity from IPF. AIP is characterized acutely by alveolar hyaline membrane formation and mild interstitial inflammation, followed by type 2 pneumocyte proliferation, and typically culminates in interstitial and alveolar fibrosis (14, 44). The histopathologic pattern of AIP is identical to that of adult respiratory distress syndrome due to sepsis, shock, multi-system trauma, and multiple other insults. Chest radiographic abnormalities typically lag behind signs and symptoms of respiratory failure by 24–48 h, then manifest with decreased lung volumes and mild diffuse

S15

Figure 14. AIP. (A ) AP chest radiograph and (B ) HRCT (lung window) of a 64-yr-old female with a 3-wk history of progressive severe respiratory distress. The lungs have diminished volume and diffuse reticulations and ground glass attenuation. Several secondary pulmonary lobules (arrows) are spared. The diagnosis was established via thoracoscopic wedge resections.

ground glass attenuation that may rapidly progress to symmetric and diffuse or bibasilar air space consolidation (45) (Figure 14). On CT, AIP is characterized by random extensive ground glass attenuation (100%) and consolidation (67%), with focal sparing of scattered second pulmonary lobules (43, 46). Interlobular septal thickening and traction bronchiolectasis may also be present, but honeycomb change is uncommon (44). In the infrequent survivor, AIP may heal with no residua or with variable degrees of fibrosis (45, 46). Differential Diagnoses The radiologic features of the idiopathic ILD overlap and may be identical to ILD of known etiology. UIP secondary to connective tissue diseases (Figure 15) and asbestosis (Figure 16) may mimic IPF. Chronic aspiration may be a common cause of limited bibasilar fibrosis (Figure 17). Granulomatous ILD typically manifests as small nodules,

S16


Figure 15. Pulmonary fibrosis (presumptive UIP) due to connective tissue disease. HRCT (lung window) of 40-yr-old female with scleroderma and dyspnea. The esophagus (arrow) is dilated with retained debris, and the lungs are severely fibrotic with reticulations, traction bronchiolectasis, and ground glass attenuation. Lung biopsy was not performed.

which are “hard” and of lymphatic distribution in sarcoidosis (Figure 18), versus “soft” and centrilobular in patients with hypersensitivity pneumonitis (Figure 19). In addition, hypersensitivity pneumonitis may exhibit patchy consolidation and air trapping that mimics RB-ILD or COP. The drug-induced and neoplastic ILD (lymphocytic interstitial pneumonitis and lymphangetic metastases) may also exhibit reticulations and ground glass attenuation. Secondary findings may provide important clues to the etiology of ILD, such as a dilated esophagus with scleroderma, pleural plaques with asbestos exposure, lymphadenopathy with sar-

Figure 16. Asbestosis. Chest CT (lung window) of a 48-yr-old male construction worker with mild dyspnea. Mild juxta-pleural pulmonary fibrosis and a large calcified pleural plaque (arrow) implicate asbestos exposure. Lung biopsy was not performed.

Figure 17. Recurrent aspiration. Chest CT (lung window) of 76yr-old male with recurrent aspiration and dyspnea. The dependent portions of the lower lobes have patchy consolidation and mild bronchiolectasis, with relative sparing of the remainder of the lungs. Lung biopsy was not performed.

coidosis or lymphangetic metastases, and increased liver attenuation with amiodarone drug-induced lung disease. Conclusions The primary role of imaging of ILD is to identify the presence and extent of fibrosis, to detect secondary findings characteristic of ILD of known etiology, and to direct the optimal sites of lung biopsy. The diagnosis of idiopathic ILD requires a multidisciplinary approach and integration of the clinical features, to include disease duration and prevalence, with the radiologic pattern and distribution

Figure 18. Sarcoidosis. HRCT (lung window) of a 49-yr-old male with dyspnea. The upper aspects of the lungs have numerous discrete tiny pulmonary nodules (arrow) that also stud the pleura (curved arrow). Features of pulmonary fibrosis are absent. The diagnosis was made via bronchoscopic biopsy.


S17

8. 9.

10.

11. 12.

Figure 19. Hypersensitivity pneumonitis. HRCT (lung window) of a 52-yr-old female with subacute bird fanciers’ disease. The upper lungs have diffuse ground glass attenuation and “soft” pulmonary nodules (arrow). Features of pulmonary fibrosis are absent. The diagnosis was made via thorascopic wedge resections.

13. 14. 15. 16.

(47). In the clinical setting of progressive chronic ILD, the diagnosis of UIP/IPF can be made with confidence on HRCT. However, in many instances, the clinical and radiologic features of the various ILD overlap, and surgical lung biopsies may be needed. The temporal heterogeneity of UIP pattern is the defining histopathologic feature of IPF; all other ILD have temporal homogeneity. NSIP and DIP may have a similar peripheral and basilar distribution as IPF, but typically have more cellular inflammation on histopathology and ground glass attenuation on CT. RB-ILD is characterized by small airways disease in the upper aspects of the lungs, and smoking cessation with follow-up CT to document disease resolution may pre-empt a lung biopsy. COP clinically may mimic pneumonia of several months duration, is a diagnosis of exclusion, and typically manifests on CT as patchy peripheral nodular consolidations that resolve following corticosteroid therapy. AIP is a rare explosive lung disease that rapidly progresses to respiratory failure and death. Lung biopsy is usually needed to confirm the diagnosis and exclude infectious or other treatable entities. References 1. Dunnill, M. S. 1990. Pulmonary fibrosis. Histopathology 16:321–329. 2. Hogg, J. C. 1991. Benjamin Felson lecture. Chronic interstitial lung disease of unknown cause: a new classification based on pathogenesis. AJR Am. J. Roentgenol. 156:225–233. 3. American Thoracic Society. 2000. Idiopathic pulmonary fibrosis: diagnosis and treatment. International consensus statement. American Thoracic Society (ATS), and the European Respiratory Society (ERS). Am. J. Respir. Crit. Care Med. 161:646–664. 4. Cottin, V., A. V. Donsbeck, D. Revel, R. Loire, and J. F. Cordier. 1998. Nonspecific interstitial pneumonia: individualization of a clinicopathologic entity in a series of 12 patients. Am. J. Respir. Crit. Care Med. 158: 1286–1293. 5. Kazerooni, E. A., F. J. Martinez, A. Flint, D. A. Jamadar, B. H. Gross, D. L. Spizarny, P. N. Cascade, R. I. Whyte, J. P. Lynch, III, and G. Toews. 1997. Thin-section CT obtained at 10-mm increments versus limited threelevel thin-section CT for idiopathic pulmonary fibrosis: correlation with pathologic scoring. AJR Am. J. Roentgenol. 169:977–983. 6. Austin, J. H., N. L. Muller, P. J. Friedman, D. M. Hansell, D. P. Naidich, M. Remy-Jardin, W. R. Webb, and E. A. Zerhouni. 1996. Glossary of terms for CT of the lungs: recommendations of the Nomenclature Committee of the Fleischner Society. Radiology 200:327–331. 7. Crystal, R. G., J. E. Gadek, V. J. Ferrans, J. D. Fulmer, B. R. Line, and

17.

18. 19. 20. 21. 22. 23.

24. 25.

26.

27. 28. 29.

30.

31.

G. W. Hunninghake. 1981. Interstitial lung disease: current concepts of pathogenesis, staging and therapy. Am. J. Med. 70:542–568. Terriff, B. A., S. Y. Kwan, M. M. Chan-Yeung, and N. L. Muller. 1992. Fibrosing alveolitis: chest radiography and CT as predictors of clinical and functional impairment at follow-up in 26 patients. Radiology 184:445–449. Remy-Jardin, M., F. Giraud, J. Remy, M. C. Copin, B. Gosselin, and A. Duhamel. 1993. Importance of ground-glass attenuation in chronic diffuse infiltrative lung disease: pathologic-CT correlation. Radiology 189:693– 698. Orens, J. B., E. A. Kazerooni, F. J. Martinez, J. L. Curtis, B. H. Gross, A. Flint, and J. P. Lynch, III. 1995. The sensitivity of high-resolution CT in detecting idiopathic pulmonary fibrosis proved by open lung biopsy: a prospective study. Chest 108:109–115. Lee, J. S., J. G. Im, J. M. Ahn, Y. M. Kim, and M. C. Han. 1992. Fibrosing alveolitis: prognostic implication of ground-glass attenuation at high-resolution CT. Radiology 184:451–454. Muller, N. L., R. R. Miller, W. R. Webb, K. G. Evans, and D. N. Ostrow. 1986. Fibrosing alveolitis: CT-pathologic correlation. Radiology 160:585–588. Muller, N. L., and T. V. Coiby. 1997. Idiopathic interstitial pneumonias: high-resolution CT and histologic findings. Radiographics 17:1016–1022. Gross, T. J., and G. W. Hunninghake. 2001. Idiopathic pulmonary fibrosis. N. Engl. J. Med. 345:517–525. Staples, C. A., N. L. Muller, S. Vedal, R. Abboud, D. Ostrow, and R. R. Miller. 1987. Usual interstitial pneumonia: correlation of CT with clinical, functional, and radiologic findings. Radiology 162:377–381. Akira, M., H. Hamada, M. Sakatani, C. Kobayashi, M. Nishioka, and S. Yamamoto. 1997. CT findings during phase of accelerated deterioration in patients with idiopathic pulmonary fibrosis. AJR Am. J. Roentgenol. 168:79–83. Zompatori, M., L. Fasano, M. R. Rimondi, V. Poletti, A. M. Pacilli, M. Battaglia, R. Canini, and C. Stambazzi. 1996. The assessment of the activity of idiopathic pulmonary fibrosis by high-resolution computed tomography. Radiol. Med. (Torino) 91:238–246. Doherty, M. J., M. G. Pearson, E. A. O’Grady, V. Pellegrini, and P. M. Calverley. 1997. Cryptogenic fibrosing alveolitis with preserved lung volumes. Thorax 52:998–1002. Lim, M. K., J. G. Im, J. M. Ahn, J. H. Kim, S. K. Lee, K. M. Yeon, and M. C. Han. 1997. Idiopathic pulmonary fibrosis vs. pulmonary involvement of collagen vascular disease: HRCT findings. J. Korean Med. Sci. 12:492–498. Jung, J. I., H. H. Kim, Y. J. Jung, S. H. Park, J. M. Lee, and S. T. Hahn. 2000. Mediastinal lymphadenopathy in pulmonary fibrosis: correlation with disease severity. J. Comput. Assist. Tomogr. 24:706–710. Bergin, C., and R. A. Castellino. 1990. Mediastinal lymph node enlargement on CT scans in patients with usual interstitial pneumonitis. AJR Am. J. Roentgenol. 154:251–254. Wahidi, M. M., J. Ravenel, S. M. Palmer, and H. P. McAdams. 2002. Progression of idiopathic pulmonary fibrosis in native lungs after single lung transplantation. Chest 121:2072–2076. Aubry, M. C., J. L. Myers, W. W. Douglas, H. D. Tazelaar, T. L. Washington Stephens, T. E. Hartman, C. Deschamps, and V. S. Pankratz. 2002. Primary pulmonary carcinoma in patients with idiopathic pulmonary fibrosis. Mayo Clin. Proc. 77:763–770. Lee, H. J., J. G. Im, J. M. Ahn, and K. M. Yeon. 1996. Lung cancer in patients with idiopathic pulmonary fibrosis: CT findings. J. Comput. Assist. Tomogr. 20:979–982. Hartman, T. E., S. J. Swensen, D. M. Hansell, T. V. Colby, J. L. Myers, H. D. Tazelaar, A. G. Nicholson, A. U. Wells, J. H. Ryu, D. E. Midthun, R. M. du Bois, and N. L. Muller. 2000. Nonspecific interstitial pneumonia: variable appearance at high-resolution chest CT. Radiology 217:701–705. Flaherty, K. R., W. D. Travis, T. V. Colby, G. B. Toews, E. A. Kazerooni, B. H. Gross, A. Jain, R. L. Strawderman, A. Flint, J. P. Lynch, and F. J. Martinez. 2001. Histopathologic variability in usual and nonspecific interstitial pneumonias. Am. J. Respir. Crit. Care Med. 164:1722–1727. Katzenstein, A. L., and R. F. Fiorelli. 1994. Nonspecific interstitial pneumonia/fibrosis: histologic features and clinical significance. Am. J. Surg. Pathol. 18:136–147. Nishiyama, O., Y. Kondoh, H. Taniguchi, K. Yamaki, R. Suzuki, T. Yokoi, and K. Takagi. 2000. Serial high resolution CT findings in nonspecific interstitial pneumonia/fibrosis. J. Comput. Assist. Tomogr. 24:41–46. MacDonald, S. L., M. B. Rubens, D. M. Hansell, S. J. Copley, S. R. Desai, R. M. du Bois, A. G. Nicholson, T. V. Colby, and A. U. Wells. 2001. Nonspecific interstitial pneumonia and usual interstitial pneumonia: comparative appearances at and diagnostic accuracy of thin-section CT. Radiology 221:600–605. Kim, E. Y., K. S. Lee, M. P. Chung, O. J. Kwon, T. S. Kim, and J. H. Hwang. 1999. Nonspecific interstitial pneumonia with fibrosis: serial highresolution CT findings with functional correlation. AJR Am. J. Roentgenol. 173:949–953. Johkoh, T., N. L. Muller, T. V. Colby, K. Ichikado, H. Taniguchi, Y. Kondoh, K. Fujimoto, M. Kinoshita, H. Arakawa, H. Yamada, M. Suga, M. Ando, M. Koyama, and H. Nakamura. 2002. Nonspecific interstitial pneumonia: correlation between thin-section CT findings and pathologic subgroups in 55 patients. Radiology 225:199–204.

S18


32. Akira, M., G. Inoue, S. Yamamoto, and M. Sakatani. 2000. Non-specific interstitial pneumonia: findings on sequential CT scans of nine patients. Thorax 55:854–859. 33. Park, J. S., K. S. Lee, J. S. Kim, C. S. Park, Y. L. Suh, D. L. Choi, and K. J. Kim. 1995. Nonspecific interstitial pneumonia with fibrosis: radiographic and CT findings in seven patients. Radiology 195:645–648. 34. Sadikot, R. T., J. Johnson, J. E. Loyd, and J. W. Christman. 2000. Respiratory bronchiolitis associated with severe dyspnea, exertional hypoxemia, and clubbing. Chest 117:282–285. 35. Heyneman, L. E., S. Ward, D. A. Lynch, M. Remy-Jardin, T. Johkoh, and N. L. Muller. 1999. Respiratory bronchiolitis, respiratory bronchiolitisassociated interstitial lung disease, and desquamative interstitial pneumonia: different entities or part of the spectrum of the same disease process? AJR Am. J. Roentgenol. 173:1617–1622. 36. Akira, M., S. Yamamoto, H. Hara, M. Sakatani, and E. Ueda. 1997. Serial computed tomographic evaluation in desquamative interstitial pneumonia. Thorax 52:333–337. 37. Alasaly, K., N. Muller, D. N. Ostrow, P. Champion, and J. M. FitzGerald. 1995. Cryptogenic organizing pneumonia: a report of 25 cases and a review of the literature. Medicine 74:201–211. 38. Lee, K. S., P. Kullnig, T. E. Hartman, and N. L. Muller. 1994. Cryptogenic organizing pneumonia: CT findings in 43 patients. AJR Am. J. Roentgenol. 162:543–546. 39. Nishimura, K., and H. Itoh. 1992. High-resolution computed tomographic

40.

41. 42. 43. 44.

45. 46. 47.

features of bronchiolitis obliterans organizing pneumonia. Chest 102:26S– 31S. Bouchardy, L. M., J. E. Kuhlman, W. C. Ball, Jr., R. H. Hruban, F. B. Askin, and S. S. Siegelman. 1993. CT findings in bronchiolitis obliterans organizing pneumonia (BOOP) with radiographic, clinical, and histologic correlation. J. Comput. Assist. Tomogr. 17:352–357. Cohen, A. J., T. E. King, Jr., and G. P. Downey. 1994. Rapidly progressive bronchiolitis obliterans with organizing pneumonia. Am. J. Respir. Crit. Care Med. 149:1670–1675. Epler, G. R. 1995. Bronchiolitis obliterans organizing pneumonia. Semin. Respir. Infect. 10:65–77. Hansell, D. M. 2002. Acute interstitial pneumonia: clues from the white stuff. Am. J. Respir. Crit. Care Med. 165:1465–1466. Ichikado, K., T. Johkoh, J. Ikezoe, N. Takeuchi, N. Kohno, J. Arisawa, H. Nakamura, T. Nagareda, H. Itoh, and M. Ando. 1997. Acute interstitial pneumonia: high-resolution CT findings correlated with pathology. AJR Am. J. Roentgenol. 168:333–338. Vourlekis, J. S., K. K. Brown, C. D. Cool, D. A. Young, R. M. Cherniack, T. E. King, and M. I. Schwarz. 2000. Acute interstitial pneumonitis. Case series and review of the literature. Medicine 79:369–378. Primack, S. L., T. E. Hartman, J. Ikezoe, M. Akira, M. Sakatani, and N. L. Muller. 1993. Acute interstitial pneumonia: radiographic and CT findings in nine patients. Radiology 188:817–820. Lee, K. S., and M. P. Chung. 2000. Diagnostic accuracy of thin-section CT in idiopathic interstitial pneumonia. Radiology 215:918–919.


S19

The Prognosis of Idiopathic Pulmonary Fibrosis Idiopathic pulmonary fibrosis (IPF) is a relentlessly progressive disease that usually leads to death within 5 yr of diagnosis (1–4). Because a response to current therapeutic agents is unusual, treatment is unlikely to alter outcome in most patients (5). Nonetheless, prognosis will have an effect on the decision of whether or not to treat. Some individuals with this disease will survive for many years, a fact that highlights the variability of the natural history of this disease (4, 6). Determining factors that predict the outcome has become increasingly important because lung transplantation is now an accepted therapy for selected candidates (7). In addition, patients typically seek advice about how long they might live so that they and their families may plan for the future and establish appropriate supportive care for advanced disease (8). For these reasons, clinicians have attempted to develop indicators that will reliably predict longevity in patients with IPF. Early studies (1, 9–12) identified a number of factors (Table 1) that seem to affect survival, but these studies must be interpreted in light of their limitations. These include: retrospective design, lack of histologic confirmation of usual interstitial pneumonia (UIP), lack of high-resolution computed tomography (HRCT) scans to assess inflammation and fibrosis in a semiquantitative manner, relatively small numbers of subjects, and inadequate duration of follow-up. Recent efforts to clarify the histopathology of idiopathic interstitial pneumonias (13) and the advent of more advanced imaging and lung biopsy techniques allows for a more rigorous approach to the diagnosis of IPF. A consensus statement recently released by the American Thoracic Society and European Respiratory Society details the present understanding of the pathogenesis of IPF and offers rational recommendations for confirming the diagnosis and for therapy (7). This report highlights the challenges in making a confident diagnosis of IPF. Contemporaneous reports emphasize the differences in survival between IPF and the other idiopathic interstitial pneumonias such as nonspecific interstitial pneumonia (NSIP) (3, 13–15). Incorrect inclusion of patients with the latter disease into outcome studies for the former disease will certainly confound the results by overestimating the survival in IPF. With the emergence of the new classification for idiopathic interstitial pneumonias, it is necessary to consider only studies that use the currently accepted diagnostic criteria in determining the factors affecting survival for patients with IPF. The purpose of this short review is to summarize the results of such studies and to suggest additional quantitative methods for determining extent of disease and its impact on outcome.

Assessing Survival by Routine Testing In 1997, Erbes and colleagues (6) published results of a study involving 99 subjects with biopsy-documented IPF who

This section was written by Andrew Perez, Robert M. Rogers, and James H. Dauber (Simmons Center for Interstitial Lung Diseases; and University of Pittsburgh, Pittsburgh, Pennsylvania).

were followed from 1973 to 1988 at their institution in Berlin, Germany. The mean age of the group was 53.2 ⫾ 15.4 yr, and 56 were current smokers, with the remaining 43 being nonsmokers for at least 5 yr. The most common symptoms were cough and dyspnea. These symptoms were noted for a longer time in nonsmokers compared with current smokers, but on average were present for 21 ⫾ 41 mo before diagnosis. Only two subjects did not have abnormal pulmonary function results at the time of diagnosis. Mean values for PaO2, total lung capacity (TLC), and forced vital capacity (FVC) were normal in smokers and abnormally low for the nonsmokers. All of their subjects were treated initially with corticosteroids starting at 0.5–1.0 mg/kg with a maximum dose of 60 mg/d for 1 mo, and then tapering by 10 mg/mo to 15 mg/d. The overall duration of therapy was not specified. Subjects who did not respond to corticosteroids were given azathioprine. The mean for follow-up was 5.5 yr, with a range of 6.6 mo to 18 yr. Inclusion in this study was discontinued in 1993. The 5-yr survival rate was 62%, with the mean survival time from presentation of 41 ⫾ 41 mo for all of the patients who died during the study. The two factors that had a negative impact on survival were (i ) age of ⬎ 50 yr, and (ii) TLC and FVC ⬍ 78% of predicted (Figure 1). Sex, DlCO/ Va and the (A-a)O2 gradient during exercise did not have an impact on survival. The main criticism that may be leveled against this study is the inclusion of subjects with other forms of idiopathic interstitial pneumonias that have a better prognosis. Because the survival rate was generally higher than what now is thought to be the case with IPF (3, 4, 7, 13, 16), it is possible that not all of the subjects had IPF. This is not surprising, because during the course of the study, the histologic features that typify the various forms of idiopathic interstitial pneumonia were less well clarified than they are today. Despite the new classification that was enunciated in 2000, however, there is still variation in the blind reading of the same slide by different highly experienced pathologists (17). The strengths of the study are the number of subjects that had been well characterized physiologically and treated in a relatively uniform fashion.

HRCT and Pathology Gay and colleagues (2) published a study in 1998 that correlated the survival of patients with IPF with the results of HRCT scanning of the chest in addition to pathologic scores on surgical lung biopsy specimens. This study comprised only 38 subjects with histologically confirmed idiopathic pulmonary fibrosis. The mean age of 54 ⫾ 2.2 yr was similar to the study of Erbes and coworkers, as was the mean duration of symptoms before diagnosis (2.6 ⫾ 0.6 yr). Only 11 were never–smokers, and the remainder current or exsmokers. The mean values for FVC, FEV1 and DlCO were 69.7 ⫾ 2.5% of predicted, 72.9 ⫾ 2.3% of predicted, and 49.9 ⫾ 2.4% of predicted, respectively. Surgical lung biopsy specimens were scored for cellularity, desquamation, granu-

S20


TABLE 1

Risk factors for rapid progression and shortened survival reported in early studies on prognosis Age older than 50 years Male sex Severity of dyspnea on presentation Severity of lung function abnormalities at presentation More fibrosis on histologic evaluation Lack of response to therapy

lation, and fibrosis using previously published criteria (18). The authors also employed a method for scoring the severity of ground glass infiltrates and fibrosis in all of the lobes of the lungs by HRCT that they had developed earlier and averaged the score for the individual lobes to arrive a whole lung score (19). All subjects received prednisone at 1 mg/kg/d for at least 3 mo. Those that responded by demonstrating improvement in their clinical, radiologic, and physiologic score (20) were continued on prednisone, but in a tapering dose for up to 18 mo. Prednisone was quickly tapered in subjects who progressed or who did not improve. They were then crossed over to oral cyclophosphamide therapy (2 mg/kg/d) for 6 mo. After 3 mo of prednisone, 10 subjects (26%) responded, 14 (37%) remained stable, and 14 progressed. Of this latter group, seven subjects died within the first 3 mo of therapy. Two subjects in the stable group and one in the responder group died after 3 mo and were put into the nonresponder group. The most relevant parameters that contrasted the responder-stable group from the nonresponder group in long term follow-up were age (48.6 ⫹ 0.4 versus 62.3 ⫹ 2.1 yr, P ⫽ 0.0006), HRCT fibrosis score (1.2 ⫹ 0.2 versus 2.0 ⫹ 0.1, P ⫽ 0.001), and pathology fibrosis score (8.7 ⫹ 1.0 versus 13.3 ⫹ 0.7, P ⫽ 0.001). They also found in ROC analyses that the only factors demonstrating statistical significance in predicting the likelihood of death were the initial HRCT fibrosis score and fibrotic pathology score (Figure 2). The authors also demonstrated that survival as measured by a Kaplan-Meier analysis was less in subjects with a HRCT score of greater than 2 (Figure 3). The major finding of this study is the value of the HRCT fibrosis score for predicting survival. Although the scoring

Figure 1. Survival of patients with IPF stratified by age. The thin solid line represents survival for normal individuals 50 yr of age. The broad solid line depicts survival for all patients with IPF. The long dashed line depicts survival of patients with IPF who are under the age of 50 yr, whereas the short dashed line depicts survival in patients with IPF over the age of 50 yr. Clearly, patients under the age of 50 yr enjoyed much better survival than patients above this age. The 5-yr survival for the entire group by this analysis was nearly 8 yr, which is longer than reported in more recent series suggesting that some of the subjects may have had more benign types of idiopathic interstitial pneumonia. (Reproduced from Ref. 6.)

system is at best semiquantitative, in the hands of experienced radiologists there was good agreement between individual readers. These results also suggested that there is a correlation between the pathologic fibrosis score and the HRCT fibrosis score, which validates the value of the HRCT scoring system to the assessment of patients with IPF. The major criticisms of this study are the relatively small number of subjects (n ⫽ 38) and the rather large percentage of patients who responded to prednisone. At 26% it is higher that what is generally expected, which is usually only 10–15%. The major strength of this study is the demonstration of the value of HRCT in the evaluation of patients with IPF. This has been supported in the recent study from Flaherty and colleagues (21, 22), where they have studied the

Figure 2. (A ) Receiver–Operator curves (ROC) for survival based on CT fibrosis score (thick line) and pathologic fibrosis score (thin line) for 38 subjects with IPF. Both curves are statistically significant (P ⫽ 0.009 and 0.03, respectively). (B ) ROC for the CT-fibrosis (solid thin line) score and the CPR score (dashed line) in the same population as in A. The curves are not statistically significant. (Figure reproduced from Ref. 2.)


Figure 3. Kaplan-Meier analysis of survival for subjects with IPF. Survival for subjects with CT-fibrosis score of ⬍ 2 (thick solid line) is much better than that for subjects with a score of ⬎ 2 (thin dashed line). (Figure reproduced from Ref. 2.)

ability of disease pattern on HRCT to predict survival. They looked at the HRCTs of 96 patients with histologically characterized UIP or NSIP. They showed that patients with a HRCT pattern of UIP were likely to have UIP on histology, but patients with an indeterminate pattern could have either UIP or NSIP. Furthermore, those patients with histologic UIP and a HRCT pattern consistent with UIP had a worse outcome than those patients with histologic UIP and indeterminate pattern on HRCT. Median survivals were 2.08 yr versus 5.76 yr, respectively. These results further support the utility of the HRCT fibrosis score in determining the outcome in IPF.

Clinical Physiologic Scoring Two reports detailing factors influencing survival in IPF appeared in 2001. The first (23) comprised 87 subjects with confirmation of UIP by surgical biopsy. All data were collected prospectively between 1982 and 1993. The clinical, radiographic, and physiological (CRP) score at the time of diagnosis was calculated using standard definitions (20), and 80 subjects were treated with either corticosteroids alone or a combination of corticosteroids and immunosuppressive therapy. HRCT scans were not available at the time of diagnosis on all subjects, because the technology was not available at the time they presented. The surgical biopsies were scored for four features: fibrosis, interstitial cellularity, alveolar space cellularity and granulation, and young connective tissue. Pulmonary function assessment consisted of spirometry, lung volumes, diffusion, lung mechanics, and gas exchange at rest and with maximum exercise. The population was very representative for IPF based on age and severity of lung function abnormalities at the time of presentation. Sixty-three patients died during follow-up. Ten were censored because the cause of death was due to an illness other than IPF (n ⫽ 6) or they underwent a lung transplant (n ⫽

S21

Figure 4. Kaplan-Meier analysis of survival for subjects with IPF (n ⫽ 87) stratified on the basis of smoking history. Current smokers appear to have a better early survival than never and current smokers. (Reproduced from Ref. 23.)

4). Median survival was 47.5 mo, with a 95% confidence interval of 33.4–73.4 mo. A multivariate analysis done with factors shown to have an impact on survival in univariate analyses revealed that the following variables were significant: smoking status, granulation/connective tissue factor (P ⬍ 0.0001), coefficient of retraction (maximal transpulmonary pressure/total gas volume, P ⬍ 0.0001), and to a much lesser extent, the dyspnea score (P ⫽ 0.017). Interestingly, current smokers had better survival in the Kaplan-Meier analysis than did former and never-smokers (Figure 4). The risk of death in current smokers was 22% less than that for never–smokers, whereas former smokers had an 88% increase in the risk of death compared with never-smokers. When factors such as granulation/connective tissue score, level of dyspnea, and coefficient of retraction were held constant, current and former smokers appeared to have a poorer survival rate compared with never-smokers. In the second study (4), these authors revised the CRP scoring system for IPF they had reported earlier (20). In devising the new CRP score, they assigned weight to variables found to have a significant impact on survival in a hierarchical multivariate analysis performed on a cohort of 183 patients for whom all pertinent data were available, including a surgical biopsy. These variables included age, smoking status, clubbing, profusion of infiltrates and findings of pulmonary hypertension on plain chest radiograph, TLC as % predicted, and pO2 at maximal exercise. Because it is not always practical to perform maximal exercise testing on subjects with advanced disease, the authors also crafted an abbreviated CRP score in a cohort of 228 subjects, which comprised all of the above variables except for pO2 at maximal exercise. The maximal score in the two models were 100 and 89.5, respectively. In this second study, which contained nearly twice as many subjects as their previous study, they found a similar relationship between survival and smoking

S22


Figure 5. Kaplan-Meier analysis of subjects with IPF (n ⫽ 228) stratified by abbreviated CRP score, which excludes pulmonary mechanics and exercise results. There are marked differences in survival based on abbreviated CRP score at the time of presentation. The authors did not indicate the size of the group with scores shown. (Reproduced from Ref. 4.)

status, but in this instance the difference in survival for the never-smokers and past smokers was not as great as noted in the previous study (23). The impact of the new CRP score on survival is shown in Figure 5. The difference in survival is quite dramatic for subjects on the high and low end of the scoring system. The probability of survival based on the abbreviated score was quite similar to that predicted by the complete CRP score. The strengths of these studies are the careful diagnosis of the IPF, numbers of subjects, duration of follow-up, and rigor of the statistical analyses. They make the results very convincing and provide clinicians with an approach to predicting survival of patients with this discouraging disease. The drawback of the new “complete” CRP is the requirement for maximum exercise testing, which is not always feasible or safe for patients with advanced disease, particularly when they have a significant oxygen requirement. The lack of this requirement for the new “abbreviated” CRP score and its relatively high predictive ability makes this approach attractive to the average clinician. Substituting the DlCO for the pO2 at maximal exercise in the multivariate analysis likely would strengthen the predictive ability of the abbreviated CRP, because the former is strongly correlated to the latter and can be measured in most patients. The authors also pointed out that inclusion of HRCT results would likely strengthen the scoring system, because assessment of the profusion score and detection of pulmonary hypertension on the plain chest radiograph is subjective. Nonetheless, the authors are to be commended for providing this approach for the assessment of patients with IPF. The recently published study by Wells and coworkers

(24) attempts to further the development of composite scoring by correlating their results with HRCT. They studied 212 patients with a clinical/CT diagnosis of IPF. They divided the patients evenly into two groups, using the first group to develop a composite physiologic index (CPI), which was correlated with a semiquantitiative scoring system which they had developed. They determined the appropriate weight of variables from pulmonary function testing (FVC, FEV1, and DlCO). Thus the CPI is based solely on physiologic results. The CPI was tested against the second group of patients and correlated more strongly with extent of disease than the individual PFT variables. The CPI’s primary advantage was the ability to account for coexistence of emphysema by including the FEV1, which tends to be higher in patients with coexistent emphysema. Furthermore, when they studied prognostic factors in a subgroup of patients with histologically proven UIP; the CPI was strongly linked to mortality (P ⬍ 0.005). Decreased percentage FVC and increases in alveolar–arterial oxygen gradient were also strongly associated; however, DlCO was not shown to have a significant association. The advantages of this scoring system are (i ) it does not require that a full exercise test be administered, and (ii) it does not require experienced readers of HRCT. Therefore, it has the potential to stage the severity of disease and predict outcome in most clinical practices. The study also reinforces the utility of HRCT in assessing prognosis.

HRCT Predicting Need for Transplant The focus of this study (5) was slightly different than that of the previous studies, which looked at survival in all sub-


S23

TABLE 2

Probability of surviving 2 yr after evaluation for IPF based on DlCO expressed as a percent of predicted and the fibrosis score on HRCT scan HRCT Fibrosis Score DlCO % predicted

25 32 35 40 45 50 55 60 65 70 75

1

1.5

2

2.5

3

0.79 0.83 0.86 0.89 0.91 0.92 0.94 0.95 0.96 0.97 0.97

0.71 0.76 0.80 0.84 0.87 0.89 0.91 0.93 0.94 0.95 0.96

0.62 0.68 0.73 0.78 0.82 0.85 0.88 0.90 0.92 0.94 0.95

0.50 0.57 0.64 0.70 0.75 0.79 0.83 0.86 0.89 0.91 0.93

0.37 0.45 0.52 0.60 0.66 0.72 0.77 0.81 0.84 0.87 0.90

jects with IPF. In this instance, the authors limited the study to patients with IPF who were considered to be candidates for transplantation. Their goal was to define the appropriate time for transplantation based on anticipated survival. The study group consisted of 115 patients with well-documented IPF who were also below the age of 65 yr. Only about one third (38%) underwent surgical biopsy for confirmation. The diagnosis in the remainder (62%) was made on clinical grounds and findings typical for IPF on HRCT. Median follow-up was 26.2 mo, with a range of 1–97 mo. Median survival was 55 mo, and the major cause of death was respiratory failure from progression of IPF. Three out of the 46 deaths were due to bronchogenic carcinoma. This population was similar to those described in the previous studies, but they were slightly younger due to the exclusion of patients over the age of 65 yr. In addition, their degree of impairment based on FVC and DlCO expressed as a percent of predicted appeared to be slightly less. The pulmonary fibrosis scores were derived according to the technique of Kazerooni and colleagues (19) that Gay and coworkers used in their study (2). The authors performed univariate analyses based on spirometry, lung volumes, diffusion, and HRCT fibrosis scores. When they performed a multivariate analysis with the parameters found to correlate with survival in univariate analyses, the only factors found to be significant were DlCO percent of predicted and fibrosis score on HRCT. For every 1% decrease in DlCO percent predicted, the hazard of death increases by 8% (CI 1–14%). For each unit increase in the HRCT fibrosis score, the hazard of death increases by 527% (CI 32–2,890%). ROC analyses confirmed the value of combining the DlCO and HRCT fibrosis score in predicting survival compared with FVC, DlCO, or HRCT fibrosis score alone (area under the curves were 0.907, 0.693, 0.802, and 0.863, respectively) (Figure 6). Finally the authors derived a prediction model for survival of 2 yr based on the DlCO percent predicted and HRCT fibrosis score. They presented a “lookup” table in the article, which is depicted in Table 2. The strengths of this study include the relatively robust

Figure 6. ROC analysis of survival based on the following parameters: Forced Vital Capacity as % predicted (FVCPP, dot and dashed line) single breath diffusion capacity for carbon monoxide expressed as % predicted (DLCOPP, dotted line), HRCT-fibrosis score (HRCT-FS, dashed line), and the prediction model based on multivariate analysis (Model, solid line). The area under the curve is significant for all variables but highest for the prediction model. (Reproduced from Ref. 5.)

number of patients who had a sound initial characterization and adequate follow-up. In addition, the authors employed standard clinical testing to derive the factors used in their survival prediction model. Finally, standard and well-accepted statistical analyses were employed to derive the survival prediction model. The major weakness is that only 38% had confirmation of UIP by surgical lung biopsy. The authors acknowledge this problem and constructed a survival prediction model based on this smaller subset of patients. They found that only the HRCT fibrosis score was an independent predictor of survival, with the hazard of death increasing by 375% for each unit increase in HRCT fibrosis score. These results further support the utility of the HRCT fibrosis score in determining the outcome in IPF.

Summary The recent studies summarized above largely confirm what had been presented earlier regarding factors that influence survival in individuals with IPF (Table 1). The only factor that the recent studies failed to confirm to affect outcome was male sex. Perhaps this reflects under-representation of females in the earlier studies. The advantages of the recent studies over previous studies in predicting survival result from a clearer definition of the histologic abnormalities in IPF. The implications of a significant amount of young granulation tissue on the biopsy, which probably includes “fibroblastic foci,” has become much clearer of late (13, 16, 23). There is controversy about the importance of the fibrosis score on surgical lung biopsy (2, 23, 25), but the finding in two studies that survival is related to the HRCT fibrosis score suggests that the total amount of fibrosis is an important prognostic finding. Given the size of the surgical biopsy specimen, it is not surprising that it may not convey accurate information about the total amount of fibrosis. Further-

S24


Figure 7. Frequency distribution of the specific volume of all voxels in CT scans from a normal individual (solid line) and patient with IPF (dotted line). Note the shift toward both lower and higher specific volumes in the patient with IPF. (Reproduced from Ref. 29.)

more, the amount of fibrosis may reflect the timing of the diagnosis (i.e., late in the disease), because symptoms develop only after significant impairment is present. Unfortunately, we do not know the pathology of the early lesions in IPF. It is also reassuring that standard clinical testing such as the DlCO contribute to the accuracy of prediction models.

Future Survival Prediction Models Looking to the future, it is important to develop a survival prediction model that uses clinical results that can be obtained at most medical centers. One disadvantage of the DlCO is the lack of standardization in performing the technique, and different sets of normal values (26). The strong predictive ability of this test, however, argues for continued efforts at the development and application of universal standards for the performance of this test and analysis of the results (27). The disadvantage of the pathology fibrosis score is that it requires a pathologist who is skilled in reading and scoring biopsies demonstrating UIP. Most medical centers cannot boast of the presence of pathologists who have expertise with interstitial lung disease. In addition, the scoring

is by nature semiquantitative and open to variability between readers. For these reasons, there likely will be less emphasis on the pathology fibrosis score in the future, unless a consortium of skilled pathologists willing to score surgical biopsy specimens is relatively accessible to the majority of physicians caring for these patients. The HRCT fibrosis score may be less prone to variability between readers but is still semiquantitative. Differences between centers may arise for several reasons. First, different imaging algorithms may be used on various models of scanners. Second, the volume of lung assessed on HRCT is usually only 10% of the total. This could lead to under- or overestimation of the fibrosis score. Third, the more volume analyzed the greater the time required, which may discourage busy chest radiologists from undertaking such a task. Nonetheless, a fibrosis scoring system using HRCT may be the approach that is most reliably standardized in the future, but remains a semiquantitative method. Several methods are being developed to quantitatively assess the morphologic features on CT of the entire lung; one such method is CT Morphometry (CTM) (28–30). CT scans can provide information about lung morphometry when analyzed to provide an estimate of specific volume of lung units (29). Because the attenuation of X-rays is linearly related to density within the biological range, any variation in the quantity of lung components (blood, tissue, air) will be reflected in the density of the lung. CTM uses attenuation data to estimate the inflation of the lung, in terms of volume of gas per gram of tissue. Because CTM studies the lung in its entirety, we would have a tool that may be better at recognizing interval changes than traditional HRCT, which usually obtains samples at intervals. CTM is performed by segmenting the lung parenchyma from the chest wall and central vessels for each slice. The volume of the slice is estimated by summing the volume of all voxels in the slice. (A voxel is a three-dimensional pixel.) The density of lung tissue in the voxel is estimated by adding 1,024 to the Hounsfield units of each voxel and dividing the sum by 1,024 (28). Lung weight equals the product of mean lung density, determined from the densities of all voxels, and volume of the entire lung, which is the volume

Figure 8. CT scans from an individual with UIP on surgical lung biopsy. (A ) Scan done at the time of diagnosis. (B ) Scan following 4 mo of therapy with prednisone. Note that the intensity and extent of the subpleural infiltrates has improved after therapy. Similar changes were noted on multiple slices revealing subpleural infiltrates.


S25

Figure 9. Special volume (ml/gm) before (solid line) and after (dotted line) treatment. Frequency distribution of the specific volume of all voxels in the patient depicted in Figure 8. Note the shift toward an increased number of voxels with intermediate specific volumes following a response to prednisone (dotted line).

sum of all voxels. The specific volume of the lung is the inverse of density, expressed as milliliters of gas per gram of lung tissue. It is calculated by the following formula: mL (gas)/ g (tissue) ⫽ Specific Volume (tissue & gas) ⫺ Specific Volume (tissue). The volume of lung tissue and gas is calculated from the CT, and the volume of tissue is the inverse of the density of the lung tissue. The density of tissue is assumed to be 1.065 gm/ml (31). The inflation of each lung voxel is categorized by the cutoffs of 2, 4, 6, 8, and 10.2 mL (gas)/gm (tissue). The amount of lung between the cutoffs is determined and is used for comparison between different scans. The scans must be obtained at similar lung volumes to compensate for changes in specific volume related to the degree of inspiration. A distribution of the specific volume for all voxels may be constructed. In the case of fibrotic lung disease, there is a shift to the left toward lower specific volumes in lungs affected by IPF (Figure 7) when compared with normal. The potential value of this technique is that when software is developed to automate the process of segmenting the lung from chest wall and central vessels, the entire analysis will not be confounded by variations in reading and interpretation. We recently had the opportunity to apply CTM to a patient with a recent onset of interstitial lung disease whose biopsy revealed a pattern consistent with UIP. The initial diagnosis was IPF, but further studies revealed a diagnosis of overlap syndrome of connective tissue disease. Before the detection of his CTD, he was treated with 60 mg/d of prednisone. Fortunately the patient responded to this therapy, essentially normalizing his pulmonary function test results. The extent and density of infiltrates on the CT scan also decreased (Figure 8). A distribution of specific volumes derived from the pre- and post-treatment CT scans is shown in Figure 9. Before therapy, the histogram reveals a shift toward an increase in both the low specific volume voxels (⬍ 2 ml/gm tissue) and in the high specific volume voxels (⬎ 12 ml/gm tissue). Presumably, the low specific volume voxels were detected in areas of the lung where connective tissue predominated. The high specific volume voxels may represent areas of hyperinflated lung or even areas of honeycomb fibrosis. Following therapy, the number of high

specific volume voxels diminished and the proportion of voxels in the mid-range of specific volume increased. The estimated weight of the lung decreased from 1,865 to 1,558 g, and the mean specific volume from 4.97 to 3.35 ml/gm of tissue. The total volume of lung with specific volume of greater than 8 ml/g decreased dramatically from 1,469 ml to 103 ml. At the present time, the significance of these shifts in specific volume are unknown, but this example demonstrates that sizable shifts do occur in the distribution of specific volume when the lung is involved with interstitial lung disease and when the disease responds to therapy. Use of a methodology such as CTM may not improve our diagnostic accuracy with interstitial lung disease. Using a method which does not depend upon visual analysis and the reader’s interpretation of interval change would allow widespread uniform application at multiple centers. It is clear that further development of this method using textural or three-dimensional analyses may lead to the ability to distinguish honeycombing from septal thickening or emphysema, rather than just relying upon volumetric numbers. Quantification of the extent of such patterns may have potential in predicting prognosis. But development of a method which uses information from the entire lung is important, rather than relying upon semiquantitative assessment. Such an approach could prove important in staging and the prediction of outcome, particularly when coupled with the composite scoring methods outlined previously. Further investigation is warranted and ongoing. References 1. Schwartz, D. A., R. A. Helmers, J. R. Galvin, D. S. Van Fossen, K. L. Frees, C. S. Dayton, L. F. Burmeister, and G. W. Hunninghake. 1994. Determinants of survival in idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 149:450–454. 2. Gay, S. E., E. A. Kazerooni, G. B. Toews, J. P. Lynch, III, B. H. Gross, P. N. Cascade, D. L. Spizarny, A. Flint, M. A. Schork, R. I. Whyte, J. Popovich, R. Hyzy, and F. J. Martinez. 1998. Idiopathic pulmonary fibrosis: predicting response to therapy and survival. Am. J. Respir. Crit. Care Med. 157:1063–1072. 3. Bjoraker, J. A., J. H. Ryu, M. K. Edwin, J. L. Myers, H. D. Tazelaar, D. R. Schroeder, and K. P. Offord. 1998. Prognostic significance of histopathologic subsets in idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 157:199–203. 4. King, T. E., Jr., J. A. Tooze, M. I. Schwarz, K. R. Brown, and R. M. Cherniack.

S26

5.

6. 7.

8. 9.

10. 11. 12. 13. 14.

15.

16.

17.

18.


2001. Predicting survival in idiopathic pulmonary fibrosis: scoring system and survival model. Am. J. Respir. Crit. Care Med. 164:1171–1181. Mogulkoc, N., M. H. Brutsche, P. W. Bishop, S. M. Greaves, A. W. Horrocks, and J. J. Egan. 2001. Pulmonary function in idiopathic pulmonary fibrosis and referral for lung transplantation. Am. J. Respir. Crit. Care Med. 164: 103–108. Erbes, R., T. Schaberg, and R. Loddenkemper. 1997. Lung function tests in patients with idiopathic pulmonary fibrosis. Are they helpful for predicting outcome? Chest 111:51–57. American Thoracic Society. 2000. Idiopathic pulmonary fibrosis: diagnosis and treatment. International consensus statement. American Thoracic Society (ATS), and the European Respiratory Society (ERS). Am. J. Respir. Crit. Care Med. 161:646–664. Abrahm, J. L., and J. Hansen-Flaschen. 2002. Hospice care for patients with advanced lung disease. Chest 121:220–229. Johnson, M. A., S. Kwan, N. J. Snell, A. J. Nunn, J. H. Darbyshire, and M. Turner-Warwick. 1989. Randomised controlled trial comparing prednisolone alone with cyclophosphamide and low dose prednisolone in combination in cryptogenic fibrosing alveolitis. Thorax 44:280–288. Turner-Warwick, M., B. Burrows, and A. Johnson. 1980. Cryptogenic fibrosing alveolitis: response to corticosteroid treatment and its effect on survival. Thorax 35:593–599. Turner-Warwick, M., B. Burrows, and A. Johnson. 1980. Cryptogenic fibrosing alveolitis: clinical features and their influence on survival. Thorax 35:171–180. Tukiainen, P., E. Taskinen, P. Holsti, O. Korhola, and M. Valle. 1983. Prognosis of cryptogenic fibrosing alveolitis. Thorax 38:349–355. Katzenstein, A. L., and J. L. Myers. 1998. Idiopathic pulmonary fibrosis: clinical relevance of pathologic classification. Am. J. Respir. Crit. Care Med. 157:1301–1315. Daniil, Z. D., F. C. Gilchrist, A. G. Nicholson, D. M. Hansell, J. Harris, T. V. Colby, and R. M. du Bois. 1999. A histologic pattern of nonspecific interstitial pneumonia is associated with a better prognosis than usual interstitial pneumonia in patients with cryptogenic fibrosing alveolitis. Am. J. Respir. Crit. Care Med. 160:899–905. Nicholson, A. G., T. V. Colby, R. M. du Bois, D. M. Hansell, and A. U. Wells. 2000. The prognostic significance of the histologic pattern of interstitial pneumonia in patients presenting with the clinical entity of cryptogenic fibrosing alveolitis. Am. J. Respir. Crit. Care Med. 162:2213–2217. Nicholson, A. G., L. G. Fulford, T. V. Colby, R. M. du Bois, D. M. Hansell, and A. U. Wells. 2002. The relationship between individual histologic features and disease progression in idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 166:173–177. Flaherty, K. R., G. B. Toews, W. D. Travis, T. V. Colby, E. A. Kazerooni, B. H. Gross, A. Jain, R. L. Strawderman, III, R. Paine, A. Flint, J. P. Lynch, III, and F. J. Martinez. 2002. Clinical significance of histological classification of idiopathic interstitial pneumonia. Eur. Respir. J. 19: 275–283. Cherniack, R. M., T. V. Colby, A. Flint, W. M. Thurlbeck, J. Waldron, L. Ackerson, and T. E. King, Jr. 1991. Quantitative assessment of lung pathology in idiopathic pulmonary fibrosis. The BAL Cooperative Group Steering Committee. Am. Rev. Respir. Dis. 144:892–900.

19. Kazerooni, E. A., F. J. Martinez, A. Flint, D. A. Jamadar, B. H. Gross, D. L. Spizarny, P. N. Cascade, R. I. Whyte, J. P. Lynch, III, and G. Toews. 1997. Thin-section CT obtained at 10-mm increments versus limited threelevel thin-section CT for idiopathic pulmonary fibrosis: correlation with pathologic scoring. AJR Am. J. Roentgenol. 169:977–983. 20. Watters, L. C., T. E. King, M. I. Schwarz, J. A. Waldron, R. E. Stanford, and R. M. Cherniack. 1986. A clinical, radiographic, and physiologic scoring system for the longitudinal assessment of patients with idiopathic pulmonary fibrosis. Am. Rev. Respir. Dis. 133:97–103. 21. Flaherty, K. R., E. L. Thwaite, E. A. Kazerooni, B. H. Gross, G. B. Toews, T. V. Colby, W. D. Travis, J. A. Mumford, S. Murray, A. Flint, J. P. Lynch, III, and F. J. Martinez. 2003. Radiological versus histological diagnosis in UIP and NSIP: survival implications. Thorax 58:143–148. 22. Flaherty, K. R., J. A. Mumford, S. Murray, E. A. Kazerooni, B. H. Gross, T. V. Colby, W. D. Travis, A. Flint, G. B. Toews, J. P. Lynch, and F. J. Martinez. 2003. Prognostic implications of physiologic and radiographic changes in idiopathic interstitial pneumonia. Am. J. Respir. Crit. Care Med. 168:543–548. 23. King, T. E., Jr., M. I. Schwarz, K. Brown, J. A. Tooze, T. V. Colby, J. A. Waldron, Jr., A. Flint, W. Thurlbeck, and R. M. Cherniack. 2001. Idiopathic pulmonary fibrosis: relationship between histopathologic features and mortality. Am. J. Respir. Crit. Care Med. 164:1025–1032. 24. Wells, A. U., S. R. Desai, M. B. Rubens, N. S. Goh, D. Cramer, A. G. Nicholson, T. V. Colby, R. M. Du Bois, and D. M. Hansell. 2003. Idiopathic pulmonary fibrosis: a composite physiologic index derived from disease extent observed by computed tomography. Am. J. Respir. Crit. Care Med. 167:962–969. 25. Flaherty, K. R., T. V. Colby, W. D. Travis, G. B. Toews, J. Mumford, S. Murray, V. J. Thannickal, E. A. Kazerooni, B. H. Gross, J. P. Lynch, III, and F. J. Martinez. 2003. Fibroblastic foci in usual interstitial pneumonia: idiopathic versus collagen vascular disease. Am. J. Respir. Crit. Care Med. 167:1410–1415. 26. Graham, B. L., J. T. Mink, and D. J. Cotton. 2002. Effects of increasing carboxyhemoglobin on the single breath carbon monoxide diffusing capacity. Am. J. Respir. Crit. Care Med. 165:1504–1510. 27. Cotton, D. J., G. R. Soparkar, and B. L. Grahan. 1996. Diffusing capacity in the clinical assessment of chronic airflow limitation. Med. Clin. North Am. 80:549–564. 28. Coxson, H. O., J. R. Mayo, H. Behzad, B. J. Moore, L. M. Verburgt, C. A. Staples, P. D. Pare, and J. C. Hogg. 1995. Measurement of lung expansion with computed tomography and comparison with quantitative histology. J. Appl. Physiol. 79:1525–1530. 29. Coxson, H. O., J. C. Hogg, J. R. Mayo, H. Behzad, K. P. Whittall, D. A. Schwartz, P. G. Hartley, J. R. Galvin, J. S. Wilson, and G. W. Hunninghake. 1997. Quantification of idiopathic pulmonary fibrosis using computed tomography and histology. Am. J. Respir. Crit. Care Med. 155:1649–1656. 30. Rogers, R. M., H. O. Coxson, F. C. Sciurba, R. J. Keenan, K. P. Whittall, and J. C. Hogg. 2000. Preoperative severity of emphysema predictive of improvement after lung volume reduction surgery: use of CT morphometry. Chest 118:1240–1247. 31. Hogg, J. C., and S. Nepszy. 1969. Regional lung volume and pleural pressure gradient estimated from lung density in dogs. J. Appl. Physiol. 27:198–203.


S27

Idiopathic Pulmonary Fibrosis New Insights into Classification and Pathogenesis Usher in a New Era in Therapeutic Approaches Idiopathic pulmonary fibrosis (IPF) is a fascinating and poorly understood disease with devastating consequences to those afflicted that has undergone several revisions in the last 30 yr. IPF is a clinical, physiologic, radiographic, and pathologic entity that has been difficult to characterize as a homogenous “disease” (1). A major reason for the difficulty in defining IPF has been the lack of a gold standard in the diagnosis. Unlike cancer, infection, or pulmonary embolism, in which it is possible to unequivocally obtain documentation of disease, it has been debated whether lung biopsy provides a gold standard in IPF. There are (at least) three major reasons for this ambiguity: (i ) not all patients with radiographic suspicion of pulmonary fibrosis have a lung biopsy performed, (ii) the lung biopsy only samples small regions of the lung, and (iii) pathologists have differed in their description of the pathologic findings in IPF. The pathologic description of IPF was originally delineated by Leibow and colleagues, and termed “usual interstitial pneumonia (UIP)” (2). Over the last 30 yr, there has been a refinement in the pathologic description of Idiopathic Interstitial Pneumonias, and the most recent classification represents a consensus of leading experts in the field (2). The major refinement has been that the mere presence of fibrosis in the lung biopsy does not necessary mean that the patient has IPF. What has been reproducible in several large retrospective series of patients with presumed IPF is that the mean survival after recognition is between 2 and 5 yr, with the most recent studies suggesting a mean of 2.8 yr (3). UIP has been recognized as a distinct pathological entity characterized by the presence of (i ) patchy chronic interstitial inflammation; (ii) oldest disease (fibrosis) is peripheral in the lung acinus or lobule; (iii) transitions to uninvolved lung in the biopsy, i.e, temporal heterogeneity; and (iv) a leading edge of fibroblastic foci and microscopic honeycombing. In studies in which this description has been identified by skilled observers in lung biopsies from patients with the clinical, physiologic, and radiographic findings characteristic of IPF, the majority of patients have demonstrated progressive disease and died despite treatment with high doses of corticosteroids and/or potent cytotoxic immunosuppressants such as cyclophosphamide and azathioprine. This is in contrast to patients that have distinct pathologic descriptions as well as distinguishing clinical, physiologic, and radiographic features that allow for the characterization of nonspecific interstitial pneumonia (NSIP), desquamative interstitial pneumonia (DIP), respiratory bronchiolitis–associated interstitial lung disease (RBILD), or acute interstitial pneumonia (AIP). NSIP has been subdivided into cellular and fibrotic forms that differ in prognosis (4).

This section was written by Paul W. Noble, M.D. (Yale University School of Medicine, Section of Pulmonary and Critical Care Medicine, New Haven, Connecticut).

With the exception of AIP, the other idiopathic interstitial pneumonias (IIPs) have a better prognosis and improve with corticosteroid/immunosuppressive more frequently than observed with UIP. Important observations from Flaherty and colleagues have suggested that patients with IIP may have both UIP and NSIP-fibrotic patterns in different regions of the lung (5). However, the presence of UIP appears to be dominant in terms of clinical outcome. That is, patients with both NSIP-fibrotic and UIP patterns on biopsy have a poor prognosis relative to those with only NSIP-fibrotic (5). This work raises the interesting question as to the relationship between NSIP and UIP. Future studies will be needed to determine if these are a continuum or distinct pathologic and clinical entities. The combination of the unique pathologic features of UIP on biopsy, the inexorable progression to death, and resistance to anti-inflammatory therapy constitute the cardinal manifestations of what is now termed IPF/UIP, and have led to recent suggestions that new therapies should be directed at regulating fibroblast functions rather than targeting the inflammatory response per se (6).

New Paradigms in the Pathogenesis of IPF Recent observations have led to new concepts in the biology of progressive pulmonary fibrosis. These observations have occurred both in patients with IPF and in animal models of fibrosis. The concept that dominated the field in the 1970s and 1980s has been described the “inflammatory” concept of pulmonary fibrosis. The paradigm was based largely on the observation that bronchoalveolar lavage fluid from patients with IPF had increased numbers of inflammatory cells (mostly neutrophils and eosinophils) relative to normal individuals (7). The concept that permeated the literature in that era was that IPF resulted from an unremitting inflammatory response to an exogenous insult, culminating in progressive fibrosis. By targeting the inflammatory response, the belief was that the fibrosis could be limited and/ or prevented. Unfortunately, it now appears that the data are more likely explained by structural abnormalities in lung architecture (traction bronchiectasis) such that inflammatory cell trafficking is altered. That is to say, the airway inflammation is likely a result, rather than a cause, of the fibrosis. Several key observations have led to a revised hypothesis of the key elements in the pathogenesis of progressive pulmonary fibrosis. Although the role of inflammation in the pathology of IPF remains controversial, it is difficult to ignore the lack of efficacy of corticosteroids.

Epithelial Cell Apoptosis An emerging body of literature has accumulated in recent years to suggest that alveolar type II cell injury and apoptosis may be an important early feature in the pathogenesis of pulmonary fibrosis. Ultrastructural studies have demon-

S28


strated alveolar type II cell injury and apoptosis in lung biopsies from patients with IPF (8). Studies from Hara and colleagues have demonstrated increased expression of proapoptotic proteins in alveolar epithelial cells from patients with IPF (9). In addition, proof of principle experiments using the bleomycin model of lung injury and fibrosis in animal models have suggested that inhibiting epithelial cell apoptosis, with a variety of approaches including inhibiting the Fas-Fas ligand pathway, inhibiting production of angiotensin, and blocking caspase activation all abrogate the development of experimental fibrosis (10). Important studies from Uhal and colleagues have suggested that IPF fibroblasts produce angiotensin peptides that promote epithelial cell apoptosis (11). More recently, transforming growth factor-␤ has been demonstrated to promote epithelial cell apoptosis (12). An additional mechanism proposed to explain epithelial cell apoptosis is increased production of oxidants in IPF (13). Several studies have shown excessive oxidant production in IPF, as well as deficiencies in glutathione production (14–15). These observations have led to an ongoing clinical trial in Europe currently evaluating the role of antioxidant therapy with N-acetyl cysteine (U. Costabel, personal communication). In addition to the potential regulators of epithelial cell apoptosis listed above, tumor necrosis factor (TNF)-␣ has been shown to promote apoptosis in alveolar epithelial cells (16). Furthermore, TNF-␣ receptor knockout mice are resistant to bleomycin-induced lung fibrosis, and overexpression of TNF-␣ in animal models is associated with increased lung fibrosis (17). TNF-␣ expression has also been shown to be increased in alveolar type II cells in patients with IPF. Collectively, these data suggest a potential role for TNF-␣ in the pathogenesis of IPF, and an anti–TNF-␣ therapy is currently being evaluated in a phase II trial. Many observers agree that an essential and unique element in the progressive pulmonary fibrosis of IPF is loss of the integrity of the subepithelial basement membrane (8). This is a unique feature of IPF. Loss of the alveolar epithelial protective barrier could lead to exposure of the underlying basement membrane to oxidative injury, resulting in degradation of key constituents of basement membrane. The loss of basement membrane integrity could be an important signal for epithelial cell regeneration. Hyperplastic alveolar type II cells are a common feature of the pathology of UIP (8). “Frustrated” epithelial cell generation could be an essential proximal signal for mesenchymal cell recruitment. The rationale for this is that a variety of growth factors accumulate following epithelial cell injury to promote epithelial cell proliferation. These include keratinocyte growth factor, transforming growth factor ␣, transforming growth factor ␤, insulin-like growth factor-1, plateletderived growth factors, fibroblast growth factor, and hepatocyte growth factor. Many of these growth factors activate tyrosine kinase signaling pathways that promote fibroblast proliferation and matrix production. Therefore, a downstream consequence of “frustrated” epithelial cell regeneration would be recruitment of fibroblasts and myofibroblasts.

Angiogenesis Parallels have been drawn between the biology of IPF and the biology of cancer. The unremitting recruitment and main-

tenance of the altered fibroblast phenotype with generation of myofibrobasts that fail to die is reminiscent of the transformation of cancer cells. A hallmark of tumorigenesis is the production of new blood vessels to facilitate tumor growth. A number of therapies targeting angiogenesis are in varying stages of clinical development for cancer. The concept that an important aspect of progressive fibrosis is angiogenic activity has been championed by Strieter and colleagues (18). They have demonstrated increased angiogenic activity in the lung tissue of IPF and experimental fibrosis (18). This increased angiogenic activity has been attributed to an imbalance of pro-angiogenic chemokines (interleukin [IL]-8) and anti-angiogenic C-X-C chemokines (IP-10). IP-10 is induced by interferon (IFN)-␥. Several studies in both animals and humans have suggested that IFN-␥ inhibits progressive pulmonary fibrosis (19, 20). However, other molecules that inhibit endothelial cell apoptosis, such as vascular endothelial cell growth factor (VEGF), may also contribute to increased angiogenesis. In contrast to the concept that progressive IPF is associated with increased angiogenesis are the recent reports that there is decreased expression of expression of VEGF and endothelial cell proliferative indices in IPF. In particular, it has been suggested that there is a paucity of expression of pro-angiogenic proteins in the fibroblastic foci in UIP in comparison to the granulation tissue in organizing pneumonia (21–23). It may be that there is enhanced angiogenesis in the earlier stages of the development of UIP, whereas there is a loss of blood vessels in the more advanced stages. These will be important areas of focus in the future.

Abnormal Matrix Turnover The essential hallmark of IPF is an exorbitant production of extracellular matrix molecules including collagen, tenascin, and proteoglycans. There is clearly an imbalance between the production and degradation of extracellular matrix. Data from Selman and Pardo have suggested that there is increased production of inhibitors of matrix degradation (TIMPs), accounting for the inability to degrade matrix (24). One of the properties of transforming growth factor-␤ (TGF-␤) is promoting matrix production while inhibiting TIMP production. It is therefore unclear if the decreased production of TIMPs is an inherent defect in IPF (such as a polymorphism) or a consequence of excessive TGF-␤.

Th1 versus Th2 Cytokines One of the rationales for corticosteroids and immunosuppressive therapy for IPF has been to target the immune system. This therapy has proven effective in autoimmune disorders such as Wegener’s granulomatosis and systemic vasculitides, but IPF does not appear to be in the same category. However, data have been obtained suggesting that a cytokine imbalance may exist in IPF. RT-PCR studies have suggested that there is increased Th2 cytokines (IL-4, IL-5, and IL-13) in lung tissue of patients with IPF (25). In addition, preliminary data suggesting that IPF may represent a relative IFN-␥ deficiency have recently been reported (19). In this preliminary report, patients with IPF who received IFN-␥ for 12 mo were found to have an improvement


in lung function relative to the patients who did not receive IFN-␥. With the goal of validating these preliminary results a randomized, double-blinded, placebo-controlled trial in 330 patients evaluating the efficacy of IFN-␥1b has recently been completed, and the results have been reported in abstract form (26). The study failed to confirm the Vienna results, and IFN-␥1b was found to have no effect on the either forced vital capacity or the resting alveolar–arterial oxygen gradient at 48 wk. However, an unanticipated trend toward a survival benefit was observed, and this effect was most apparent in the patients who adhered to the treatment regimen and had higher forced vital capacity (26). These results warrant further investigation, and this important study has provided valuable data that will benefit future clinical investigations in IPF. The link between Th2 cytokines and tissue fibrosis has been established in animal models, but the data in humans that there is a cause and effect relationship are lacking. Recently, overexpression of IL-13 in the lung using transgenic mice has been shown to result in accumulation of active TGF-␤ and increased tissue fibrosis (27). Thus, data do exist to suggest that directing therapies to restore the balance of Th1 and Th2 cytokines is not an unreasonable approach in IPF.

Growth Factor Production A variety of growth factors that influence fibroblast and myofibroblast functions have been shown to be produced in the lung tissue of patients with IPF, and to mediate the pathogenesis of experimental fibrosis. TGF-␤1 has been shown to be a critical mediator of lung fibrosis in animal models (28). A number of studies have shown that antagonizing TGF-␤1 prevents the development of tissue fibrosis (28). However, concerns have been raised about potential consequences of TGF-␤1 blockade because of the finding that TGF-␤1 knockout mice die of unremitting inflammation (29). In addition, failure to activate TGF-␤1 following fibrotic lung injury has been shown to not only prevent fibrosis, but result in unremitting lung inflammation. However, recent data in mice have shown that long-term treatment with a TGF-␤1 antagonist did not result in significant immune disturbances (30). Targeted overexpression of TGF-␤1 has been shown to produce progressive fibrosis (31). Therefore, targeting growth factor–signaling pathways, such as TGF␤1, PDGF, or IGF-1 with small molecules such as perfenidone, or tyrosine kinase inhibitors such as imatinib mesylate, are important potential therapeutic strategies for IPF. A phase II trial to evaluate Gleevec (imatinib mesylate) in patients with IPF is underway. A number of other growth factors such as IGF-1, PDGF A and B, and CTGF are expressed in IPF lung tissue, but the direct contribution of these mediators to progressive fibrosis is unknown. In addition to effects on fibroblast proliferation, growth factors such as IGF-1 may promote fibroblast (and myofibroblast) survival. IGF-1 has been shown to inhibit apoptosis by activating the Akt pathway. This may have important consequences for maintenance of a profibrotic environment.

Altered Fibroblast Phenotypes The concept that fibroblasts from patients with IPF have a unique phenotype is generally accepted, although the spe-

S29

cifics of the phenotype have been different in various studies (32–34). Raghu and colleagues made the important observation that fibroblasts from different regions of the lung corresponding to new versus old fibrosis had different growth rates (33). Subsequent studies have shown altered production of TIMPs and other mediators, suggesting that IPF fibroblasts have different properties than normal lung fibroblasts. Some discrepancies exist on whether IPF fibroblasts proliferate more or less in comparison with normal lung fibroblasts (35). In addition, some studies have suggested increased rates of apoptosis consistent with rapidly turning over subpopulations (35). Studies examining the response of IPF fibroblasts to apoptotic stimuli have not been reported. In addition, the pattern of expression of pro-apoptotic proteins and inhibitors of apoptosis (IAP) have not been examined in IPF fibroblasts.

Myofibroblast Recruitment and Maintenance Much attention has been focused recently on the role of the myofibroblast in the pathogenesis of IPF. Kuhn and McDonald described myofibroblasts in a contractile phase in fibroblastic foci from IPF lung biopsies in 1991 (36). Recent attention was generated by the observation from three different groups that the frequency of fibroblastic foci in lung biopsies from patients with IPF correlates with poor prognosis (37). The defining characteristic of the myofibroblast in the fibroblastic foci is the production of new collagen and fibronectin at the leading edge of existing scar. Myofibroblasts have contractile properties and stain positive for ␣-smooth muscle actin. In normal wound healing, myofibroblasts appear transiently, but mechanisms that regulate the phenotype and maintenance of myofibroblasts are largely unknown (38–39). Recently it has been shown that the NH2-terminal peptide of ␣-smooth muscle actin inhibits myofibroblast contractile activity (40). Myofibroblasts have been shown to accumulate in bleomycin-induced lung fibrosis (41). Immunohistochemical studies have suggested that they are important in the production of newly synthesized collagen (41). However, myofibroblasts are present transiently following bleomycin-induced lung fibrosis, and are largely vanished from lung tissue by Day 21 (41). It is not known whether normal fibroblasts differentiate into myofibroblasts in vivo, but TGF-␤ has been shown to induce the expression of ␣-smooth muscle actin in normal lung fibroblasts and promote contractile activity (42). In addition, TGF-␤ has been shown to inhibit apoptosis of myofibroblasts that is stimulated by IL-1 (43). PDGF-A has been shown to be required for lung alveolar myofibroblast development (44). An interesting observation that may shed insight into the importance of myofibroblasts apoptosis is the observation that ␣-smooth muscle actin staining fibroblasts are present in both Masson bodies of organizing pneumonia and the fibroblastic foci of UIP. The difference is that the myofibroblasts from the Masson body undergo apoptosis, whereas the UIP myofibroblasts persist. It is also interesting that organizing pneumonia responds well to corticosteroids, whereas UIP does not. In addition to growth factors, thrombin has been shown to differentiate normal lung fibroblasts to a myofibroblast phenotype in vitro (45). Taken together, these studies suggest that myofibroblasts may have an im-

S30


portant role in mediating lung fibrosis, However, in vivo studies demonstrating that targeting myofibroblast function can regulate the progression of lung fibrosis have not been obtained.

The Paradox of Pulmonary Fibrosis: Increased Apoptosis in Epithelial Cells and Decreased Apoptosis in Myofibroblasts The challenge of future targets for therapeutic intervention is to reconcile the two potentially opposing observations that, on the one hand, increased epithelial cell apoptosis can contribute to fibrosis, while at the same time decreased fibroblast or myofibroblast apoptosis promotes fibrosis. This is where experimental model systems can be useful. It is important to distinguish studies that demonstrate a decrease in bleomycin-induced pulmonary fibrosis achieved by a loss-of-function intervention (either gene deletion or inhibitor studies) from studies where a gain-of-function intervention causes pulmonary fibrosis. Bleomycin in particular is a very interesting but puzzling model system for studying pulmonary fibrosis. Bleomycin is not a good model of IPF because the fibrosis is not progressive. The initial pathologic lesions in bleomycin lung injury are focal areas of diffuse alveolar damage. These lesions subsequently heal into selflimited foci of collagen deposition. Myofibroblasts are present transiently. Although it is important to acknowledge the limitations of the bleomycin model and be cognizant that inhibiting fibrosis after bleomcycin treatment is not curing IPF, it is also an informative model because the injury appears to mimic the microscopic injury pattern that is believed to characterize the stepwise progression in fibrosis observed in IPF. Bleomycin is a product of fungi, and bleomycin hydrolase exists in both mouse and humans. One cannot help but wonder if there is not some significance to this naturally occurring antimetabolite of the environment for which processing enzymes exist. It is therefore reasonable to use bleomycin injury as a “mimic” of the acute injury pattern that occurs in patients with IPF. A useful model system for IPF would be to identify genetic mutations in mice that lead to progressive rather than self-limited fibrosis after bleomcyin injury. Model systems to dissect the relative contribution of epithelial apoptosis and myofibroblast survival will help unravel the relative contributions of these opposing forces in the overall pathogenesis of pulmonary fibrosis.

Summary We appear to be entering a new era in the understanding of the classification, pathogenesis, and biology of IPF. New therapeutic targets include the epithelial cell, myofibroblast, and chronic inflammation. The acceptance that “standard” therapy of corticosteroids and cytotoxic medications is rarely effective, coupled with new insights into pathogenesis, has led to new therapeutic approaches that hold out great hope for the future.

2.

3.

4.

5.

6. 7. 8. 9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

References 1. Watters, L. C., T. E. King, M. I. Schwarz, J. A. Waldron, R. E. Stanford, and R. M. Cherniack. 1986. A clinical, radiographic, and physiologic

25.

scoring system for the longitudinal assessment of patients with idiopathic pulmonary fibrosis. Am. Rev. Respir. Dis. 133:97–103. American Thoracic Society/European Respiratory Society International Multidisciplinary Consensus Classification of the Idiopathic Interstitial Pneumonias. 2002. Am. Rev. Respir. Crit. Care Med. 165:277–304. Bjoraker, J. A., J. H. Ryu, M. K. Edwin, J. L. Myers, H. D. Tazelaar, D. R. Schroeder, and K. P. Offord. 1998. Prognostic significance of histopathologic subsets in idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 157:199–203. Katzenstein, A. L., and J. L. Myers. 2000. Nonspecific interstitial pneumonia and other idiopathic interstitial pneumonias: classification and diagnostic criteria. Am. J. Surg. Pathol. 24:1–3. Flaherty, K. R., W. D. Travis, T. V. Colby, G. B. Toews, E. A. Kazerooni, B. H. Gross, A. Jain, R. L. Strawderman, A. Flint, J. P. Lynch, and F. J. Martinez. 2001. Histopathologic variability in usual and nonspecific interstitial pneumonias. Am. J. Respir. Crit. Care Med. 164(9):1722–1727. Selman, M., and A. Pardo. 2002. Idiopathic pulmonary fibrosis: an epithelial/ fibroblastic cross-talk disorder. Respir. Res. 3:3–12. Merrill, W. W., and H. Y. Reynolds. 1983. Bronchial lavage in inflammatory lung disease. Clin. Chest Med. 4:71–84. Katzenstein, A. L. 1985. Pathogenesis of “fibrosis” in interstitial pneumonia: an electron microscopic study. Hum. Pathol. 16:1015–1024. Maeyama, T., K. Kuwano, M. Kawasaki, R. Kunitake, N. Hagimoto, T. Matsuba, M. Yoshimi, I. Inoshima, K. Yoshida, and N. Hara. 2001. Upregulation of Fas-signalling molecules in lung epithelial cells from patients with idiopathic pulmonary fibrosis. Eur. Respir. J. 17:180–189. Kuwano, K., N. Hagimoto, M. Kawasaki, T. Yatomi, N. Nakamura, S. Nagata, T. Suda, R. Kunitake, T. Maeyama, H. Miyazaki, and N. Hara. 1999. Essential roles of the Fas-Fas ligand pathway in the development of pulmonary fibrosis. J. Clin. Invest. 104:13–19. Wang, R., O. Ibarra-Sunga, L. Verlinski, R. Pick, and B. D. Uhal. 2000. Abrogation of bleomycin-induced epithelial apoptosis and lung fibrosis by captopril or by a caspase inhibitor. Am. J. Physiol. Lung Cell. Mol. Physiol. 279:L143–L151. Kuwano, K., R. Kunitake, T. Maeyama, N. Hagimoto, M. Kawasaki, T. Matsuba, M. Yoshimi, I. Inoshima, K. Yoshida, and N. Hara. 2001. Attenuation of bleomycin-induced pneumopathy in mice by a caspase inhibitor. Am. J. Physiol. Lung Cell. Mol. Physiol. 280:L316–L325. Hagimoto, N., K. Kuwano, I. Inoshima, M. Yoshimi, N. Nakamura, M. Fujita, T. Maeyama, and N. Hara. 2002. TGF-beta 1 as an enhancer of Fasmediated apoptosis of lung epithelial cells. J. Immunol. 168:6470–6478. Cantin, A. M., R. C. Hubbard, and R. G. Crystal. 1989. Glutathione deficiency in the epithelial lining fluid of the lower respiratory tract in idiopathic pulmonary fibrosis. Am. Rev. Respir. Dis. 139:370–372. Crystal, R. G. 1991. Oxidants and respiratory tract epithelial injury: pathogenesis and strategies for therapeutic intervention. Am. J. Med. 91: 39S–44S. Wang, R., G. Alam, A. Zagariya, C. Gidea, H. Pinillos, O. Lalude, G. Choudhary, D. Oezatalay, and B. D. Uhal. 2000. Apoptosis of lung epithelial cells in response to TNF-alpha requires angiotensin II generation de novo. J. Cell. Physiol. 185:253–259. Ortiz, L. A., J. Lasky, R. F. Hamilton, A. Holian, G. W. Hoyle, W. Banks, J. J. Peschon, A. R. Brody, G. Lungarella, and M. Friedman. 1998. Expression of TNF and the necessity of TNF receptors in bleomycin-induced lung injury in mice. Exp. Cell Res. 24:721–743. Keane, M. P., D. A. Arenberg, J. P. Lynch, III, R. I. Whyte, M. D. Iannettoni, M. D. Burdick, C. A. Wilke, S. B. Morris, M. C. Glass, B. DiGiovine, S. L. Kunkel, and R. M. Strieter. 1997. The CXC chemokines, IL-8 and IP-10, regulate angiogenic activity in idiopathic pulmonary fibrosis. J. Immunol. 159:1437–1443. Ziesche, R., E. Hofbauer, K. Wittmann, V. Petkov, and L. H. Block. 1999. A preliminary study of long-term treatment with interferon gamma-1b and low-dose prednisolone in patients with idiopathic pulmonary fibrosis. N. Engl. J. Med. 341:1264–1269. Giri, S. N., D. M. Hyde, and B. J. Marafino, Jr. 1986. Ameliorating effect of murine interferon gamma on bleomycin-induced lung collagen fibrosis in mice. Biochem. Med. Metab. Biol. 36:194–197. Renzoni, E. A., D. A. Walsh, M. Salmon, A. U. Wells, P. Sestini, A. G. Nicholson, S. Veeraraghaven, A. E. Bishop, H. M. Romanska, P. Pantelidis, C. M. Black, and R. M. Du Bois. 2003. Interstitial vascularity in fibrosing alveolitis. Am. J. Respir. Crit. Care Med. 167:438–443. Lapi-Blanco, E., Y. Soini, V. Kinnula, and P. Paakko. 2002. VEGF and bFGF are highly expressed in intraluminal fibromyxoid lesions in bronchiolitis obliterans organizing pneumonia. J. Pathol. 196:220–227. Koyama, S., E. Sato, M. Haniuda, H. Numanami, S. Nagai, and T. Izumi. 2002. Decreased level of vascular endothelial growth factor. Am. J. Respir. Crit. Care Med. 166:382–385. Ramos, C., M. Montano, J. Garcia-Alvarez, V. Ruiz, B. D. Uhal, M. Selman, and A. Pardo. 2001. Fibroblasts from idiopathic pulmonary fibrosis and normal lungs differ in growth rate, apoptosis, and tissue inhibitor of metalloproteinases expression. Am. J. Respir. Cell Mol. Biol. 24:591–598. Ando, M., E. Miyazaki, T. Fukami, T. Kumamoto, and T. Tsuda. 1999.


26.

27.

28. 29. 30.

31.

32.

33. 34. 35.

Interleukin-4-producing cells in idiopathic pulmonary fibrosis: an immunohistochemical study. Respirology 4:383–391. Raghu, G., K. Brown, W. Bradford, K. Starko, P. Noble, D. Schwartz, and T. King. 2003. Phase III, randomized, double-blind, placebo-controlled trial of interferon-␥-1b in patients with idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 167:A167. (Abstr.) Lee, C. G., R. J. Homer, Z. Zhu, S. Lanone, X. Wang, V. Koteliansky, J. M. Shipley, P. Gotwals, P. Noble, Q. Chen, R. M. Senior, and J. A. Elias. 2001. Interleukin-13 induces tissue fibrosis by selectively stimulating and activating transforming growth factor beta(1). J. Exp. Med. 194:809–821. Khalil, N., and A. H. Greenberg. 1991. The role of TGF-beta in pulmonary fibrosis. Ciba Found. Symp. 157:194–207. Letterio, J. J., and A. B. Roberts. 1996. Transforming growth factor-beta1deficient mice: identification of isoform-specific activities in vivo. J. Leukoc. Biol. 59:769–774. Yang, Y. A., O. Dukhanina, B. Tang, M. Mamura, J. J. Letterio, J. MacGregor, S. C. Patel, S. Khozin, Z. Y. Liu, J. Green, M. R. Anver, G. Merlino, and L. M. Wakefield. 2002. Lifetime exposure to a soluble TGF-beta antagonist protects mice against metastasis without adverse side effects. J. Clin. Invest. 109:1607–1615. Sime, P. J., Z. Xing, F. L. Graham, K. G. Csaky, and J. Gauldie. 1997. Adenovector-mediated gene transfer of active transforming growth factor- beta1 induces prolonged severe fibrosis in rat lung. J. Clin. Invest. 100:768–776. Vancheri, C., M. A. Sortino, V. Tomaselli, C. Mastruzzo, F. Condorelli, G. Bellistri, M. P. Pistorio, P. L. Canonico, and N. Crimi. 2000. Different expression of TNF-alpha receptors and prostaglandin E(2)Production in normal and fibrotic lung fibroblasts: potential implications for the evolution of the inflammatory process. Am. J. Respir. Cell Mol. Biol. 22: 628–634. Zhao, H. W., C. J. Lu, R. J. Yu, and X. M. Hou. 1999. An increase in hyaluronan by lung fibroblasts: a biomarker for intensity and activity of interstitial pulmonary fibrosis? Respirology 4:131–138. Raghu, G., Y. Y. Chen, V. Rusch, and P. S. Rabinovitch. 1988. Differential proliferation of fibroblasts cultured from normal and fibrotic human lungs. Am. Rev. Respir. Dis. 138:703–708. Ramos, C., M. Montano, J. Garcia-Alvarez, V. Ruiz, B. D. Uhal, M. Selman, and A. Pardo. 2001. Fibroblasts from idiopathic pulmonary fibrosis and

S31

36.

37.

38. 39. 40. 41.

42.

43. 44.

45.

normal lungs differ in growth rate, apoptosis, and tissue inhibitor of metalloproteinases expression. Am. J. Respir. Cell Mol. Biol. 24:591–598. Kuhn, C., and J. A. McDonald. 1991. The roles of the myofibroblast in idiopathic pulmonary fibrosis. Ultrastructural and immunohistochemical features of sites of active extracellular matrix synthesis. Am. J. Pathol. 138:1257–1265. King, Jr., T. E., M. I. Schwarz, K. Brown, J. A. Tooze, T. V. Colby, J. A. Waldron, A. Flint, W. Thurlbeck, and R. M. Cherniack. 2001. Idiopathic pulmonary fibrosis: relationship between histopathologic features and mortality. Am. J. Respir. Crit. Care Med. 164:1025–1032. Tomasek, J. J., G. Gabbiani, B. Hinz, C. Chaponnier, and R. A. Brown. 2002. Myofibroblasts and mechano-regulation of connective tissue remodelling. Nat. Rev. Mol. Cell Biol. 3:349–363. Low, R. B. 1999. Modulation of myofibroblast and smooth-muscle phenotypes in the lung. Curr. Top. Pathol. 93:19–26. Hinz, B., G. Gabbiani, and C. Chaponnier. 2002. The NH2-terminal peptide of alpha-smooth muscle actin inhibits force generation by the myofibroblast in vitro and in vivo. J. Cell Biol. 157:657–663. Zhang, K., M. D. Rekhter, D. Gordon, and S. H. Phan. 1994. Myofibroblasts and their role in lung collagen gene expression during pulmonary fibrosis. A combined immunohistochemical and in situ hybridization study. Am. J. Pathol. 145:114–125. Zhang, H. Y., M. Gharaee-Kermani, K. Zhang, S. Karmiol, and S. H. Phan. 1996. Lung fibroblast alpha-smooth muscle actin expression and contractile phenotype in bleomycin-induced pulmonary fibrosis. Am. J. Pathol. 148:527–537. Roy, S. G., Y. Nozaki, and S. H. Phan. 2001. Regulation of alpha-smooth muscle actin gene expression in myofibroblast differentiation from rat lung fibroblasts. Int. J. Biochem. Cell Biol. 33:723–734. Bostrom, H., K. Willetts, M. Pekny, P. Leveen, P. Lindahl, H. Hedstrand, M. Pekna, M. Hellstrom, S. Gebre-Medhin, M. Schalling, M. Nilsson, S. Kurland, J. Tornell, J. K. Heath, and C. Betsholtz. 1996. PDGF-A signaling is a critical event in lung alveolar myofibroblast development and alveogenesis. Cell 85:863–873. Bogatkevich, G. S., E. Tourkina, R. M. Silver, and A. Ludwicka-Bradley. 2001. Thrombin differentiates normal lung fibroblasts to a myofibroblast phenotype via the proteolytically activated receptor-1 and a protein kinase C-dependent pathway. J. Biol. Chem. 276:45184–45192.

S32


Microarray Analysis of Idiopathic Pulmonary Fibrosis Idiopathic pulmonary fibrosis (IPF) is a refractory and lethal interstitial lung disease characterized by fibroblast proliferation, extracellular matrix deposition, and progressive lung scarring. The incidence of IPF is estimated at 15–40 cases per 100,000 per year, and the mean survival from the time of diagnosis is 3–5 yr regardless of treatment (1). Much of our understanding of the mechanisms of pulmonary fibrosis comes from studies of the classical model of bleomycininduced lung injury and fibrosis in animals, as well as several newer models that have yet to gain widespread acceptance. Additionally, the application of these models to genetically modified animals greatly enhanced our understanding of the mechanism of lung fibrotic responses. However, the relevance of some of these studies to IPF or other human fibrotic lung diseases is still unclear, and there are many gaps in our understanding of the human disease (2). The advent of high throughput genomic profiling technologies such as microarrays, combined with advanced computational approaches, provides scientists with the ability to create high-resolution expression profiles of distinct disease states and to dissect molecular networks that underlie a diseased phenotype. Microarrays are now routinely used in almost every line of biomedical research. The most impressive examples are in the area of cancer research, where gene expression patterns obtained from microarray experiments allowed identification of new classes of lymphoma (3), prediction of metastasis in breast cancer (4), and prognosis determination in lung cancer and pediatric leukemias and lymphomas (5–7). Furthermore, many molecular pathways have been better characterized, and new targets for therapeutic intervention have been identified. The aim of this section is to provide an overview of the few works that applied microarrays to the study of pulmonary fibrosis; they range from studies of animal models of disease to analysis of human tissues. The specific challenges inherent to microarray analysis of lung disease are presented, and future directions are discussed.

Testing the Water: Analysis of Animal Models of Lung Fibrosis In our initial set of experiments using microarrays, we analyzed changes in gene expression in response to bleomycin using oligonucleotide microarrays that contained probe sets for ⵑ 6,000 murine genes and expressed sequence tags (8). Changes in gene expression were monitored after bleomycin treatment in wild-type C57bl/6 and 129 mice. Microarray analysis demonstrated that bleomycin induced a drastic effect on gene expression patterns in the lung, with the expected increases in inflammatory mediators, components of the extracellular matrix, and transforming growth factor-␤1

This section was written by Naftali Kaminski (Dorothy P. and Richard P. Simmons Center for Interstitial Lung Disease, Pulmonary, Allergy and Critical Care Medicine, University of Pittsburgh Medical Center, Pittsburgh, Pennsylvania).

(TGF-␤1)–inducible genes (8). Many genes that were not known to be associated with bleomycin-induced lung injury and fibrosis were identified, including osteopontin (a cytokine involved in a variety of inflammatory states), the new CC chemokine C10, and heme oxygenase. Interestingly, each one of these genes has recently been implicated in pulmonary fibrosis. Neutralization of C10, a macrophage inflammatory protein-1␥ homolog highly chemotactic for monocytes and T cells, reduced the fibrotic response to bleomycin. This attenuated fibrotic response was associated with a reduction in intrapulmonary macrophages, suggesting that the pro-fibrotic effect of C10 is mediated through macrophage recruitment (9). Similarly, use of antibodies to osteopontin, a multifunctional secreted glycosylated phosphoprotein that is strongly chemotactic for macrophages, T cells, and fibroblasts, attenuated the fibrotic response to bleomycin (10). Osteopontin’s role in pulmonary fibrosis may be more complex, considering that it has also effects that are protective against fibrosis, such as promotion of epithelial cell survival and activation of Th1 responses (11). Although the role of heme oxygenase is unclear in fibrosis, it has been suggested that carbon monoxide, the main enzymatic product of heme oxygenase, has an anti-inflammatory effect in a variety of models of lung and tissue injury (12). Recently, carbon monoxide been demonstrated to have a direct effect on extracellular matrix production by primary lung fibroblasts, suggesting that the early induction of heme oxygenase in bleomycin-induced fibrosis may serve as a defense mechanism (D. Morse, personal communication). Different insights were derived from comparing gene expression patterns in response to bleomycin of 129 mice homozygous for a null mutation of the integrin ␤6 subunit gene (␤6⫺/⫺) and wild-type 129 mice. We had previously shown that ␤6⫺/⫺ mice developed inflammation, but not fibrosis, in response to bleomycin (13). This current experiment was aimed to use this feature to identify genes that are specifically characteristic of the fibrotic process. A simple hierarchical clustering procedure identified two clusters: one that contained mainly inflammatory genes, and another that contained mostly genes related to fibrosis, suggesting that the other genes in the cluster were also fibrosis-related genes (8). Applying self-organizing maps to the same dataset, we recently obtained a finer distinction of the clusters (Figure 1). The genes induced by bleomycin fell into three distinct clusters. A cluster of 75 genes preferentially induced in wild-type mice and indeed contains many fibrosis-related genes (Figure 1, Cluster A). A cluster of 34 genes induced similarly in both mouse strains (Cluster B) potentially reflects a specific response to bleomycin that does not lead to fibrosis. A cluster of 55 genes that are induced by bleomycin but are higher in the ␤6⫺/⫺ compared with wild-type in every time point, contains many genes that are associated with exaggerated inflammatory infiltrate seen in ␤6⫺/⫺ both at baseline and after bleomycin. The data is available at http://genechip.ucsf.edu/. Katsuma and coworkers analyzed


S33

Figure 1. Self-organizing maps of the response to bleomycin in wild type and ␤6⫺/⫺ mice. Genes were normalized to a mean ⫽ 0, variance ⫽ 1. Infogram to the left depicts global gene expression patterns. Yellow is increased and blue is decreased (see color scale). A, B, C, and D are gene expression plots of all the genes in the corresponding cluster. Plots for all genes in a cluster are presented as average and standard deviation. Experiments are numbered along the x-axis of each plot. 1, baseline, wild type; 2, 7 d after bleomycin, wild type; 3, 14 d after bleomycin, wild type; 4, baseline, knockout; 5, 7 d after bleomycin, knockout; 6, 14 d after bleomycin, knockout.

Figure 2. Expression levels of MMP-7 in fibrotic lungs and in lung cancer samples, the y-axis is the fold ratio compared with a geometric mean of all controls. Old means values were obtained from Affymetrix Hu68K microarrays and new means values from Affymetrix U95Av2 microarrays.

Figure 3. Genes that behave similarly in mice and humans. Dashed line is the line of equality. Green means increased in humans but not in mice, red means increased in both humans and mice. Expression levels are expressed in arbitrary fluorescence units.

S34


bleomycin-induced response in C57BL/6 mice using a lung cDNA array that they have created from a normalized lung library (14). They identified 89 nonredundant genes that changed; 25 changed after 2 d, and the rest changed at later stages. They identified a group of 12 genes that behaved in a manner similar to those discussed our previously published results, including osteopontin, whereas the rest of the genes did not change concordantly. It is unlikely that this difference is related to mouse strain, because we did get a 63% concordance rate between the genes increased in 129 mice and C57BL/6 (8). Potential causes for this disagreement may be the different RNA extraction methods used, the different microarray platforms, or potentially a different analytic scheme. In our experience, experiments that involve analyzing the injury and an intervention (inhibitor, gene knockout, etc.), are more productive in terms of the ability to generate biologically meaningful hypotheses. These two very different papers represent a common problem with microarrays, which is the difficulty in translating data across different microarray platforms. Microarray platforms differ in the type of the probes on the arrays (fragments of cDNA, different size of oligonucleotides), the design of the probes (probes that are 3⬘ biased, probes that utilize alternative sequence resources, multiple or single probes per gene), and the labeling techniques (single-dye, competitive dual-dye, direct and indirect labeling). Any of these technical differences could lead to significant variability. The improvement in sequence information availability, the introduction of standards for data storage and publication, and most importantly the move away from cDNA arrays and the more widespread use oligonucleotide probes, should improve the ability of researchers to perform cross platform analysis. A simple strategy to overcome the crossplatform problem is to share samples between groups that use different platforms and to generate parallel datasets in more than one platform. This has the additional benefit of providing a global verification of the results. Naturally, as it is beyond the resources of a single group to analyze all models for pulmonary fibrosis and all relevant knockouts and transgenic mice, an effort must be made to deposit all microarray data in standard formats in public data repositories.

fibroblast foci typical of the disease. In concordance with our results in mouse lungs, we observed an increase in genes that encode for extracellular matrix proteins in fibrotic lungs, including Collagen I, III, tenascin C, and fibronectin. Surprisingly, we identified a coordinated increase in the levels of several matrix metalloproteases (MMPs). MMP-1, MMP-2, MMP-7, and MMP-9 were all significantly increased in fibrotic lungs. MMP-7 was the most significantly upregulated gene in our dataset (15). Cosgrove and colleagues presented their results in two conference abstracts and reported similar impressive increase in MMP-7; however, they did not observe an increase in other MMPs (17), and focused on angiogenic signaling in the fibrotic lung (18). Because MMP-7 has also been implicated in cancer progression (19, 20), and patients with IPF have a higher risk of cancer (21), we looked at MMP-7 levels in lung tumors, but did not find a significant increase (Figure 2). Recently, we have repeated the experiments using a different microarray platform and more samples, and verified that MMP-7 was highly upregulated in most IPF lungs (data not shown). The mechanism by which of MMP-7 plays a role in pulmonary fibrosis is unknown. Some possible mechanisms recently reported that may play a role in fibrosis include regulation of neutrophil migration into the lung through MMP-7 effect on syndecan shedding (22), an effect on epithelial repair through MMP-7 effect on e-cadherin ectodomain shedding during epithelial injury (23), or even an effect on TGF-␤1 activation (G. Cosgrove, personal communication). One of the benefits of having a dataset in mice and humans is that it allows for attempts at cross-species transcriptional comparisons. Simply put, it is now possible to identify the genes that behave similarly in mice and humans presuming that they are more fundamental to the studied process. We identified the genes that were increased in IPF lungs and that were on the mouse array. Most of these genes were concordant in their expression levels, including collagens I and III, tenascin C, IGFBP 2 and 5, and osteopontin. Osteopontin was the top increased gene in both mouse and humans. Tenascin X, IGFBP-5, and MN-SOD were discordant in their expression patterns.

Data Verification and Generated Hypotheses Dealing with Reality: Microarray Analysis of Human IPF Tissues To determine the relevance of our results to human fibrotic lung disease as well as the feasibility of analyzing human fibrotic lung disease we analyzed gene expression patterns in 5 lungs of patients with IPF (15). For controls, we used normal histology lung samples resected from patients with cancer, and a pool of RNA obtained commercially. Despite the variability of the patients, we observed an impressive difference in gene expression patterns. To determine the most informative genes (genes that best characterize the IPF samples), we applied scoring methods previously reviewed by us (16). Among the most informative increased genes we identified genes encoding for proteins expressed in smooth muscle differentiation and muscle contractile machinery, potentially representing the transcriptional signal of myofibroblasts and fibroblasts in myofibroblast/

Contrary to the current trend of validating microarray results by real-time RT-PCR, we prefer to do a biologically meaningful verification by determining the protein level of the gene of interest. If we need to verify global changes in gene expression, we advocate repeating at least a part of the experiment with another microarray platform (e.g., if the main platform is single-dye verify by a two-dye platform or vice versa). A more important validation step is an experiment designed to study the role of the protein in the process studies. This was the strategy that we applied to the study of the human IPF lungs. We verified the protein levels of MMP-2, MMP-7, and MMP-9 (see http://www.pnas.org/cgi/ content/full/99/9/6292/DC1 and Ref. 15), and chose to evaluate the role of MMP-7 in fibrosis by exposing MMP-7 knockout mice to bleomycin. The knockout mice expressed a marked reduction in the fibrotic response in the lung, suggesting that MMP-7 had a role in pulmonary fibrosis (15).


The complete dataset is available at http://fgusheba.cs.huji. ac.il/new_page_1.htm. One of the most exciting aspects of microarrays is that they can be used as tools for actively introducing serendipity to one’s research. For instance, we identified MMP-12 as one of the genes that was substantially increased in ␤6⫺/⫺ mice at baseline. We then analyzed the lung alveolar architecture in these mice and observed that they developed age-dependent spontaneous emphysema. Following up on this observation, a role for TGF-␤ activation by the integrin ␣V␤6 in the progression of MMP-12–dependent emphysema was suggested and verified (24). Such findings demonstrate the significant discovery potential of microarray experiments and the value that can be derived from nonbiased analysis of the results. Furthermore, they provide additional support to the request to make complete microarray datasets freely available to the scientific community, as it is highly likely that researchers from diverse disciplines and fields of biology will obtain completely different insights from the same dataset.

Challenges and Future Directions In this review, we described the few studies that applied microarrays to the study of pulmonary fibrosis. The biologically meaningful information that we derived from our microarray experiments exceeded and continues to exceed our expectations. Furthermore, the free availability of our complete datasets serves as a continuous resource for new hypotheses and discoveries as well as new collaborative projects. In our view, to maximize the impact of microarrays on the research of fibrotic lung diseases, several challenges must be addressed. One challenge, previously mentioned in this section, is the need for data sharing and public availability of raw microarray data in a standardized format that will allow researchers from every discipline to mine the data (25). This will allow the generation of new global models of gene networks in pulmonary fibrosis that are based on multiple experimental models in a variety of organisms and are not limited to a single model or time point. It will also promote the generation of new and unexpected insights overlooked by the original investigators. Examples of such repositories are the ArrayExpress hosted by the European Bioinformatics Institute (http://www.ebi.ac.uk/arrayexpress/) and the Gene Expression Omnibus hosted by the National Center for Biotechnology Information (http://www.ncbi.nlm.nih. gov/geo/). Availability of well characterized human tissue (diseased and control) is a major challenge typical to microarrays experiments that use human lung samples. Large numbers of well-characterized samples are required in order reach statistically significant conclusions and to identify markers of early disease, response to therapy, and prognosis. These samples need to be obtained from patients with a variety of interstitial lung diseases, from patients in different stages of the disease, and from the same patient at diagnosis and transplantation. The controls most often used are normal histology lung samples from lungs resected for cancer. Despite a normal appearance on histologic examination, many

S35

of these samples express abnormal gene expression patterns reflecting a response to the presence of cancer in the lung or even infiltration by tumor cells. Special attention should be given to obtaining controls from a variety of resources. To address these issues, tissue consortia for tissue banking and tissue sharing between institutions must be established, and large multi-institutional datasets need to be created. Methods for obtaining, storing, and characterizing tissues, and for isolating RNA, DNA, and protein must be standardized. This will reduce the variability and provide a framework for comparing results between groups from different institutions. An additional challenge typical to the lung is the plasticity of the lung cellular content. Increases in leukocytes or alveolar macrophages, or changes in fibroblast proliferation rate or in epithelial cell differentiation, may seem like “real” transcriptional changes. Therefore, studies using primary cells generated from the lungs, or high-powered technologies such as laser capture microscopy, should be more widely applied. Several groups, including mine, are now in the process of characterizing IPF fibroblasts (C. Feghali Bostwick, D. Morse, and M. Selman, personal communication) using microarrays. Other investigators are successfully applying laser capture microscopy to IPF tissues (K. Gibson, personal communication). We believe that the creation of large multi-institutional gene expression datasets, application of more refined, cellspecific approaches, and the performance of cross-species comparisons will lead to better understanding of the molecular networks underlying pulmonary fibrosis. Such understanding will lead to identification of new targets for therapeutic interventions in lung fibrosis and design of better and more efficient drugs. Acknowledgments: Dr. Kaminski’s work was supported in part by the Tel-Aviv Chapter of the Israel Lung Association.

References 1. Costabel, U., and T. E. King. 2001. International consensus statement on idiopathic pulmonary fibrosis. Eur. Respir. J. 17:163–167. 2. Crystal, R. G., P. B. Bitterman, B. Mossman, M. I. Schwarz, D. Sheppard, L. Almasy, H. A. Chapman, S. L. Friedman, T. E. King, Jr., L. A. Leinwand, L. Liotta, G. R. Martin, D. A. Schwartz, G. S. Schultz, C. R. Wagner, and R. A. Musson. 2002. Future research directions in idiopathic pulmonary fibrosis: summary of a National Heart, Lung, and Blood Institute working group. Am. J. Respir. Crit. Care Med. 166:236–246. 3. Alizadeh, A. A., M. B. Eisen, R. E. Davis, C. Ma, I. S. Lossos, A. Rosenwald, J. C. Boldrick, H. Sabet, T. Tran, X. Yu, J. I. Powell, L. Yang, G. E. Marti, T. Moore, J. Hudson, Jr., L. Lu, D. B. Lewis, R. Tibshirani, G. Sherlock, W. C. Chan, T. C. Greiner, D. D. Weisenburger, J. O. Armitage, R. Warnke, R. Levy, W. Wilson, M. R. Grever, J. C. Byrd, D. Botstein, P. O. Brown, and L. M. Staudt. 2000. Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling. Nature 403:503–511. 4. van’t Veer, L. J., H. Dai, M. J. van de Vijver, Y. D. He, A. A. Hart, M. Mao, H. L. Peterse, K. van der Kooy, M. J. Marton, A. T. Witteveen, G. J. Schreiber, R. M. Kerkhoven, C. Roberts, P. S. Linsley, R. Bernards, and S. H. Friend. 2002. Gene expression profiling predicts clinical outcome of breast cancer. Nature 415:530–536. 5. Beer, D. G., S. L. Kardia, C. C. Huang, T. J. Giordano, A. M. Levin, D. E. Misek, L. Lin, G. Chen, T. G. Gharib, D. G. Thomas, M. L. Lizyness, R. Kuick, S. Hayasaka, J. M. Taylor, M. D. Iannettoni, M. B. Orringer, and S. Hanash. 2002. Gene-expression profiles predict survival of patients with lung adenocarcinoma. Nat. Med. 8:816–824. 6. Rosenwald, A., G. Wright, W. C. Chan, J. M. Connors, E. Campo, R. I. Fisher, R. D. Gascoyne, H. K. Muller-Hermelink, E. B. Smeland, J. M. Giltnane, E. M. Hurt, H. Zhao, L. Averett, L. Yang, W. H. Wilson, E. S. Jaffe, R. Simon, R. D. Klausner, J. Powell, P. L. Duffey, D. L. Longo, T. C. Greiner, D. D. Weisenburger, W. G. Sanger, B. J. Dave, J. C. Lynch,

S36


J. Vose, J. O. Armitage, E. Montserrat, A. Lopez-Guillermo, T. M. Grogan, T. P. Miller, M. LeBlanc, G. Ott, S. Kvaloy, J. Delabie, H. Holte, P. Krajci, T. Stokke, and L. M. Staudt. 2002. The use of molecular profiling to predict survival after chemotherapy for diffuse large-B-cell lymphoma. N. Engl. J. Med. 346:1937–1947. 7. Yeoh, E. J., M. E. Ross, S. A. Shurtleff, W. K. Williams, D. Patel, R. Mahfouz, F. G. Behm, S. C. Raimondi, M. V. Relling, A. Patel, C. Cheng, D. Campana, D. Wilkins, X. Zhou, J. Li, H. Liu, C. H. Pui, W. E. Evans, C. Naeve, L. Wong, and J. R. Downing. 2002. Classification, subtype discovery, and prediction of outcome in pediatric acute lymphoblastic leukemia by gene expression profiling. Cancer Cell 1:133–143. 8. Kaminski, N., J. D. Allard, J. F. Pittet, F. Zuo, M. J. Griffiths, D. Morris, X. Huang, D. Sheppard, and R. A. Heller. 2000. Global analysis of gene expression in pulmonary fibrosis reveals distinct programs regulating lung inflammation and fibrosis. Proc. Natl. Acad. Sci. USA 97:1778–1783. 9. Belperio, J. A., M. Dy, M. D. Burdick, Y. Y. Xue, K. Li, J. A. Elias, and M. P. Keane. 2002. Interaction of IL-13 and C10 in the pathogenesis of bleomycin-induced pulmonary fibrosis. Am. J. Respir. Cell Mol. Biol. 27:419–427. 10. Takahashi, F., K. Takahashi, T. Okazaki, K. Maeda, H. Ienaga, M. Maeda, S. Kon, T. Uede, and Y. Fukuchi. 2001. Role of osteopontin in the pathogenesis of bleomycin-induced pulmonary fibrosis. Am. J. Respir. Cell Mol. Biol. 24:264–271. 11. Denhardt, D. T., M. Noda, A. W. O’Regan, D. Pavlin, and J. S. Berman. 2001. Osteopontin as a means to cope with environmental insults: regulation of inflammation, tissue remodeling, and cell survival. J. Clin. Invest. 107:1055– 1061. 12. Otterbein, L. E. 2002. Carbon monoxide: innovative anti-inflammatory properties of an age-old gas molecule. Antioxid. Redox Signal. 4:309–319. 13. Munger, J. S., X. Huang, H. Kawakatsu, M. J. Griffiths, S. L. Dalton, J. Wu, J. F. Pittet, N. Kaminski, C. Garat, M. A. Matthay, D. B. Rifkin, and D. Sheppard. 1999. The integrin alpha v beta 6 binds and activates latent TGF beta 1: a mechanism for regulating pulmonary inflammation and fibrosis. Cell 96:319–328. 14. Katsuma, S., K. Nishi, K. Tanigawara, H. Ikawa, S. Shiojima, K. Takagaki, Y. Kaminishi, Y. Suzuki, A. Hirasawa, T. Ohgi, J. Yano, Y. Murakami, and G. Tsujimoto. 2001. Molecular monitoring of bleomycin-induced pulmonary fibrosis by cDNA microarray-based gene expression profiling. Biochem. Biophys. Res. Commun. 288:747–751. 15. Zuo, F., N. Kaminski, E. Eugui, J. Allard, Z. Yakhini, A. Ben-Dor, L. Lollini,

16. 17. 18. 19. 20.

21. 22. 23. 24.

25.

D. Morris, Y. Kim, B. DeLustro, D. Sheppard, A. Pardo, M. Selman, and R. A. Heller. 2002. Gene expression analysis reveals matrilysin as a key regulator of pulmonary fibrosis in mice and humans. Proc. Natl. Acad. Sci. USA 99:6292–6297. Kaminski, N., and N. Friedman. 2002. Practical approaches to analyzing results of microarray experiments. Am. J. Respir. Cell Mol. Biol. 27:125– 132. Cosgrove, G. P., M. I. Schwarz, M. W. Geraci, K. K. Brown, and G. S. Worthen. 2002. Overexpression of matrix metalloproteinase-7 in pulmonary fibrosis. Chest 121:S25–S26. Cosgrove, G. P., K. K. Brown, C. D. Cool, M. W. Geraci, M. I. Schwartz, and G. S. Worthen. 2002. Angiogenesis in Pulmonary Fibrosis. Am. J. Respir. Crit. Care Med. 165:A172.(Abstr.) Adachi, Y., H. Yamamoto, F. Itoh, Y. Hinoda, Y. Okada, and K. Imai. 1999. Contribution of matrilysin (MMP-7) to the metastatic pathway of human colorectal cancers. Gut 45:252–258. Liu, X. P., S. Kawauchi, A. Oga, K. Tsushimi, M. Tsushimi, T. Furuya, and K. Sasaki. 2002. Prognostic significance of matrix metalloproteinase-7 (MMP-7) expression at the invasive front in gastric carcinoma. Jpn. J. Cancer Res. 93:291–295. Park, J., D. S. Kim, T. S. Shim, C. M. Lim, Y. Koh, S. D. Lee, W. S. Kim, W. D. Kim, J. S. Lee, and K. S. Song. 2001. Lung cancer in patients with idiopathic pulmonary fibrosis. Eur. Respir. J. 17:1216–1219. Li, Q., P. W. Park, C. L. Wilson, and W. C. Parks. 2002. Matrilysin shedding of syndecan-1 regulates chemokine mobilization and transepithelial efflux of neutrophils in acute lung injury. Cell 111:635–646. McGuire, J. K., Q. Li, and W. C. Parks. 2003. Matrilysin (matrix metalloproteinase-7) mediates e-cadherin ectodomain shedding in injured lung epithelium. Am. J. Pathol. 162:1831–1843. Morris, D. G., X. Huang, N. Kaminski, Y. Wang, S. D. Shapiro, G. Dolganov, A. Glick, and D. Sheppard. 2003. Loss of integrin alpha(v)beta6-mediated TGF-beta activation causes Mmp12-dependent emphysema. Nature 422: 169–173. Brazma, A., P. Hingamp, J. Quackenbush, G. Sherlock, P. Spellman, C. Stoeckert, J. Aach, W. Ansorge, C. A. Ball, H. C. Causton, T. Gaasterland, P. Glenisson, F. C. Holstege, I. F. Kim, V. Markowitz, J. C. Matese, H. Parkinson, A. Robinson, U. Sarkans, S. Schulze-Kremer, J. Stewart, R. Taylor, J. Vilo, and M. Vingron. 2001. Minimum information about a microarray experiment (MIAME)-toward standards for microarray data. Nat. Genet. 29:365–371.


S37

Pulmonary Fibrosis of Sarcoidosis New Approaches, Old Ideas

The typical features of pulmonary fibrosis in sarcoidosis are different from those of idiopathic pulmonary fibrosis (IPF)/ usual interstitial pneumonia (UIP). In sarcoidosis, pulmonary fibrosis often begins in the mid and upper lung zones, in a slowly progressive process that results in upper lobe volume loss with hilar retraction, traction emphysema, and fibrocystic changes. Honeycombing may occur but is uncommon. Obstructive impairment is often more severe than the restrictive component, though both are usually present. Resting hypoxemia tends to occur late in the disease, unlike in IPF, in which hypoxemia is an early manifestation of the disease. These findings can largely be explained by the location of the granulomatous inflammation in pulmonary sarcoidosis, in which the granulomas are typically found in or around the bronchovascular bundles and perilobular spaces, consistent with a lymphangitic distribution (1). There are few statistics on the frequency of pulmonary fibrosis in sarcoidosis. The prevalence of sarcoidosis ranges from 10–40/100,000 population in both the United States and Europe, with slightly higher rates in women than men (2). The lifetime risk has been calculated to be ⵒ 1% in a Scandinavian population (3). In the United States, one study from a midwestern city estimated the lifetime risk of developing sarcoidosis to be 0.85% in the white population and 2.4% in the local African American population (4). A minimum estimate of the prevalence of fibrotic pulmonary sarcoidosis can be made from studies that suggest ⵒ 10% of patients with sarcoidosis present with a stage IV chest radiograph, that is, evidence of fibrosis (5). (By international convention, chest radiographs in sarcoidosis are classified as stage I [bilateral hilar adenopathy {BHA}], stage II [BHA and interstitial infiltrates], stage III [interstitial infiltrates without BHA], and stage IV, those with evidence of pulmonary fibrosis.) In the recently completed U.S. study of the etiology of sarcoidosis (ACCESS), a stage IV chest radiograph was found in 5.4% of sarcoidosis cases (6). Estimates using these data likely grossly underestimate the problem, given the underdiagnosis of this disease and the relative dearth of statistics on the natural course of pulmonary sarcoidosis. Mortality ranges from 1–5%, with most deaths from sarcoidosis in the United States due to pulmonary complications (7). Although limited, these statistics illustrate that pulmonary fibrosis in sarcoidosis is a significant cause of morbidity and mortality.

Pathogenesis of Granuloma Formation in Sarcoidosis Granuloma formation begins with the tissue deposition of poorly soluble antigenic material. This material is phagocy-

This section was written by David R. Moller (The Johns Hopkins University School of Medicine, Baltimore, Maryland). The work in this section of the supplement was supported in part by Grant No. HL68019 from the National Heart, Lung and Blood Institute, the Hospital for the Consumptives of Maryland (Eudowood), and the Life and Breath Foundation.

tosed or internalized by receptor-mediated endocytosis by mononuclear phagocytic cells, and processed into peptides that are then bound within the ␣-helices of class II major histocompatibility complex (MHC) molecules (8). These MHC-peptide complexes are displayed on the surface of antigen-presenting cells for analysis by CD4⫹ T cells. Cytokines and chemokines produced by these T cells and mononuclear phagocytes guide the development of granuloma formation. Experimental models have shown that the cytokine profiles in immune-mediated granulomatous inflammation may be dominated by either Th1 cytokines (interferon [IFN]-␥, interleukin [IL]-2) or Th2 cytokines (IL-4, IL-5, IL-13) (9). These cytokine profiles are not static, but are regulated in response to the offending agent. In mycobacterial infections, an initial Th1 response is downregulated with emergence of dominant Th2 cytokine production as the immune response is suppressed (10). In the schistosomal antigen model of granulomatous lung disease, a persistent dominant Th2 cytokine profile is seen (9). In experimental models, granulomatous inflammation is downregulated with clearance of antigen. Persistent antigenic stimulation from poor clearance of antigenic material is associated with fibrosis, particularly in the context of Th2 inflammation such as seen with schistosomal antigen– induced granulomatous inflammation (9). In sarcoidosis, abundant evidence supports the concept that the granulomatous inflammation involves a highly polarized Th1 immune response, at least in the initial years of known disease (11). The Th1 cytokines IFN-␥ and IL-2 and the critical Th1 immunoregulatory monokines, IL-12 and IL-18, are upregulated in pulmonary sarcoidosis, providing a positive feedback loop consistent with enhanced Th1 responses (12, 13). IL-15, a cytokine with similar properties to IL-2, also contributes to the T cell activation in the sarcoidosis lung (14). The observation that bronchoalveolar lavage (BAL) T cells express a functional IL-12 receptor composed of both the IL-12 receptor ␤1 and ␤2 subunits is also consistent with a Th1 response (15). The release of these cytokines amplifies the immune response in part by enhancing release of tumor necrosis factor (TNF)-␣, a critical mediator of granulomatous inflammation, but also by enhancing the expression of chemokines that are important in trafficking of immune cells to the inflammatory site (16). Evidence that this inflammatory response is driven by antigenic stimulation is provided by studies that demonstrate oligoclonal expansions of T cells expressing specific T cell receptor (TCR) gene segments at sites of disease in sarcoidosis (17). The best-studied example involves the expansion of V␣2.3 (AV2S3)⫹ T cells in BAL fluid from HLA-DR17(3) Scandinavian patients with sarcoidosis (18). Oligoclonal populations of specific ␣␤⫹T cells have also been detected in tissues and blood, consistent with a conventional antigen-driven process (19, 20). Identification of the specific antigens driving the expansion of these oligoclonal T cell populations has not been accomplished.

S38


In addition to stimulation of Th1 cells, sarcoidosis is characterized by B cell stimulation. Immune complexes are detected in a majority of patients with sarcoidosis (21). Importantly, Lofgren’s syndrome, the only subset of sarcoidosis whose onset of disease is known, is associated with formation of circulating immune complexes essentially 100% of the time (21). One hypothesis is that this humoral response may be key to the fact that Lofgren’s syndrome is associated with remitting sarcoidosis in 80–90% of sarcoidosis patients by enhancing clearance of pathogenic antigens (22). B cell hyperactivity is also demonstrated by the hypergammaglobulinemia found in many cases of sarcoidosis.

Pulmonary Fibrosis of Sarcoidosis Perhaps 50% or more of patients with known sarcoidosis undergo remission. In these patients, the granulomas may resolve, often leaving behind some residual scar tissue. In patients with persistent inflammation, the granulomas may develop fibrotic changes. The fibrosis usually begins at the periphery of the granuloma with gradual envelopment of fibrosis toward the center with hyalinization and collagen deposition (23). The determinants of this outcome are not understood. There are no data on cytokine profiles in late stages of fibrotic sarcoidosis to assess the contribution of Th1 or Th2 cytokines to the fibrotic process. If the dominant Th1 responses seen in sarcoidosis are central to disease pathogenesis, then determining the role of these cytokines becomes critical to understanding the fibrotic outcome. This assessment is complicated by the pleomorphic effects of many of the cytokines involved, including the prototypical Th1 cytokine, IFN-␥. IFN-␥ is directly antifibrotic by downregulating fibroblast production of collagen and transforming growth factor (TGF)-␤ expression, but is also proinflammatory, capable of enhancing oxidant stress and cellular injury (24). In contrast, the Th2 cytokines IL-4 and IL-13 are directly profibrotic by enhancing fibroblast production of collagen (24). Experimental models confirm that Th2mediated granulomatous responses are more fibrotic than Th1-mediated granulomatous inflammation, so in the absence of human data, there is uncertainty as to the relevant immune processes in fibrotic pulmonary sarcoidosis. Conceivably, patients with fibrotic sarcoidosis are those who switch to a more profibrotic Th2 response later in the disease (perhaps in an attempt to downregulate the inflammatory response), or have a persistent dominant Th2 response from the initial stages of disease. Alternatively, it is possible that pulmonary fibrotic processes progress in sarcoidosis within a dominant Th1 cytokine environment. Profibrotic mediators such as TGF-␤, insulin-like growth factor-1, and platelet-derived growth factor are expressed in the sarcoidosis lung, and it is likely these cytokines contribute to a fibrotic outcome regardless of whether Th1 or Th2 cytokines dominate in the sarcoidosis lung (25).

Potential Role of Th1 Cytokines in Pulmonary Fibrosis of Granulomatous Lung Disease Although there are no animal models that recapitulate the type of chronic progressive granulomatous inflammation

seen in sarcoidosis, experimental models may be used to assess the potential role of cytokines in pulmonary fibrogenesis. In the murine model of bleomycin-induced pulmonary fibrosis, the inflammatory and fibrotic outcome has a genetic basis. “Bleomycin-susceptible” C57BL/6 mice develop intense inflammation and fibrosis following intratracheal bleomycin; interestingly, this strain tends to express Th1 cytokines (IFN-␥, IL-12) in response to many infectious agents (26). “Bleomycin-resistant” BALB/c mice have relatively little inflammatory or fibrotic response to bleomycin and tend to express Th2 cytokines (IL-4, IL-5, IL-13) in response to infectious or antigenic stimuli. When we examined the role of IFN-␥ in the bleomycin murine model of pulmonary fibrosis, we found that both IFN-␥ and IL-12 are upregulated in the bleomycin-sensitive but not -resistant strains, and that the inflammatory and fibrotic response to bleomycin in IFN-␥–deficient “knockout” mice was significantly reduced compared with sensitive wild-type controls (27). In contrast, repeated administration of IFN-␥ in this same model has been shown to have anti-fibrotic effects (28). Together, these results suggest that IFN-␥ can play a profibrotic role by enhancing tissue injury and subsequent repair processes, but this effect is dependent on the timing of its expression and the presence of other proinflammatory cytokines. Overall, a role for Th1 cytokines should be considered in the pulmonary fibrosis of Th1-associated interstitial lung diseases such as sarcoidosis, hypersensitivity pneumonitis, pneumoconiosis, and chronic beryllium disease. Human studies are required to determine the net effects of these cytokines in regulating the fibrotic outcome in pulmonary sarcoidosis.

Newer Approaches to Understanding Lung Fibrosis Insights into potential pathogenic mechanisms in the evolution of fibrogenic processes in sarcoidosis may be gleaned from new information on pathways relevant to lung fibrosis in experimental murine models and human IPF. For example, using oligonucleotide microarray gene expression analysis, matrilysin was identified as a major mediator of fibrosis in both murine and human lung fibrosis (29). Consistent with this finding, extensive nuclear accumulation of ␤-catenin indicating activation of the Wnt signaling pathway was found along with upregulation of two of its downstream targets, matrilysin and cyclin-D1, by immunohistochemical analysis of IPF tissues (30). A role for abnormal re-epithelialization and lung remodeling in IPF was suggested by finding expression of truncated isoforms of the p63 gene (which counteract the apoptotic and cell cycle inhibitory functions of p53 after DNA damage) in IPF lungs (31). A role for TNF-enhanced TGF-␤1 expression in fibroproliferative lung disease was confirmed by a recent study that employed a replicationdeficient adenovirus to overexpress TGF-␤1 in the lungs of TNF-receptor knockout mice that are resistant the fibrogenic effects of bleomycin, silica, and inhaled asbestos (32). The cell-surface adhesion molecule and hyaluronan receptor CD44 was shown to play a role in resolving lung inflammation in a murine model of bleomycin-induced pulmonary toxicity, suggesting that the CD44 pathway is important in moderating lung inflammation and subsequent fibrotic


outcomes (33). Given the importance of these pathways in lung fibrogenesis, research to determine their role in fibrotic pulmonary sarcoidosis is clearly indicated.

Treatment Approaches to Pulmonary Fibrosis in Sarcoidosis Most clinicians view sarcoidosis as a treatable disorder that is usually responsive to corticosteroid therapy or other antiinflammatory or immunosuppressive medications. Although unproven by rigorous controlled trials, corticosteroid therapy can improve symptoms and organ function over weeks to months and often years in most patients with sarcoidosis (2). The implications of these observations support the notion that granulomatous inflammation is responsible for the resultant fibrosis; i.e., fibrosis is not an independent process, but progresses as a result of ongoing inflammation and tissue injury. These clinical observations are valid whether Th1 or Th2 cytokine production is dominant in fibrocystic sarcoidosis. There are no data that support the effectiveness of other putative direct antifibrotic agents such as colchicine or perfenidone in fibrocystic sarcoidosis, and antifibrotic biologic agents such as IFN-␥ or IFN-␣ are associated with induction or relapse of sarcoidosis. For now, nonspecific anti-inflammatory drug therapy to suppress granulomatous inflammation remains the central strategy to limit progressive fibrosis in unremitting sarcoidosis. Although glucocorticosteroid therapy remains the cornerstone of sarcoidosis treatment, a therapeutic strategy of using drugs or biologics that inhibit TNF-␣ has been used recently with varying success (34, 35). Another potential approach is to use inhibitors of chemokines and their receptors to suppress granulomatous inflammation and subsequent fibrotic outcomes by mitigating trafficking of immune cells to sites of inflammation. A different strategic approach to suppress the chronic, progressive granulomatous inflammation in sarcoidosis is to reduce antigen deposition, enhance antigen clearance, or inhibit antigen processing and presentation. Therapies that enhance or induce remission of sarcoidosis would, of course, be an ideal way of preventing the complications of chronic progressive pulmonary fibrosis. Recent studies provide for a genetic and immunologic basis of remitting sarcoidosis that could potentially be exploited to enhance the likelihood of disease remission (22). HLA class II genes, particularly HLA-DR3 haplotypes and the linked DQB1*0201 haplotype, have been associated with presentations of sarcoidosis with favorable clinical outcomes or protective against severe sarcoidosis or disease progression (36, 37). In contrast, the DQB1*0602 allele and the closely linked DRB1*1501 have been associated with severe disease (37). Remitting sarcoidosis has been associated with downregulation of the immune responses with reduced TNF and enhanced TGF-␤ production by sarcoidosis alveolar macrophages (38). These findings suggest that targeting specific MHC–T cell interactions may be a beneficial therapeutic strategy. In a similar context, it is reasonable to speculate that an outcome of remitting disease depends on clearance or tolerance of pathogenic tissue antigens. A dominant Th1driven granulomatous response in the initial stages of sar-

S39

coidosis may be not be effective in clearing exogenous granuloma-inducing antigens unless accompanied by an effective humoral response. If this is true, then the immune response to pathogenic tissue antigens in remitting sarcoidosis may be associated with an effective disease-specific or healthy humoral (B cell) response, whereas chronic sarcoidosis may be associated with a dominant Th1 immune response that is ineffective in clearing relevant pathogenic tissue antigens. The possibility of regulating antigen-specific T and B cell responses to enhance the probability of disease remission is encouraged by the study of Grunewald and colleagues (39). These investigators found that higher proportions of AV2S3⫹ lung T cells in DR17(3)⫹ Scandinavian sarcoidosis patients are associated with an acute disease onset and a short (⬍ 2 yr) disease duration (39). Given that these TCR-specific lung T cells may be specific for pathogenic sarcoidosis antigens, it may be possible to regulate this (or other) antigenspecific T cell subsets to either enhance Fc-mediated clearance of exogenous pathogenic antigens or T cell tolerance of disease-relevant autoantigens. However, until the specific pathogenic peptides are identified, it will be difficult to determine whether blockade or stimulation of the specific antigen/MHC/TCR-specific trimolecular complex will be therapeutically useful for enhancing disease remission.

Identification of Candidate Pathogenic Antigens in Sarcoidosis The feasibility of identifying pathogenic tissue antigens in sarcoidosis has both a clinical and scientific basis in the Kveim-Siltzbach reaction (40). In this reaction, a nodular eruption develops 1–3 wk following the intradermal injection of sarcoidosis tissue homogenates in patients with sarcoidosis. Ansgar Kveim noted that histologic examination of skin biopsies of this reaction showed epithelioid granulomas that were essentially identical to granulomas in affected tissues. Louis Siltzbach used splenic suspensions and demonstrated the specificity of the reaction in sarcoidosis. The granulomatous inflammation in the Kveim-Siltzbach reaction site is infiltrated by CD4⫹ T cells, histiocytes, and mononuclear cells, similar to sarcoidosis tissues. More recently, these CD4⫹ T cells have been shown to be oligoclonal, consistent with an antigen-driven response (20). The granuloma-inducing component remains unknown. Since the reaction was first studied, investigators have hypothesized the granuloma-inducing compound in the Kveim-Siltzbach reagent was derived from an infectious agent. The kinetics of the reaction is similar to the Mitsuda reaction to lepromins in tuberculous leprosy, but no mycobacterial or other microbial remnants have been identified in validated Kveim suspensions (41). Studies have shown that the biologic activity is enriched in post-nuclear membrane fractions containing endolysosomes (40). The granuloma-inducing component is insoluble to neutral detergents and has relative resistance to heat, acidity, denaturing detergents, organic solvents, nucleases and proteases. Importantly, the granuloma-inducing activity is abrogated by potent denaturants (urea ⫹ ␤ME) suggesting a protein component is responsible for the reaction (42). These studies suggest that it may be possible to biochemically concentrate

S40


disease-relevant antigens in sarcoidosis tissues in at least a limited way. Using this information, we have initiated studies in an attempt to detect potential pathogenic antigens in sarcoidosis tissue. Our hypothesis is that sarcoidosis is caused by linked T and B cell immune responses to insoluble protein aggregates of microbial and/or endogenous origins. Our approach is based on using a limited proteomic approach together with immunoassays of sarcoidosis tissue extracts. Specifically, we hypothesized that antigenic proteins in sarcoidosis tissues can be enriched by biochemical means and detected using a combination of protein immunoblot techniques and mass spectroscopy. Frozen sarcoidosis tissues were biochemically processed to concentrate for tissue proteins that were insoluble in neutral detergents. Protein immunoblots of these extracts were analyzed using IgG from patients with sarcoidosis and control subjects. We have identified protein bands from sarcoidosis tissue that bind sarcoidosis but not control IgG. These bands have been excised and subjected to matrix-associated laser desorption/ ionization-time of flight (MALDI-TOF) mass spectroscopy. Our preliminary results suggest that some of these protein bands contain microbial peptides. One of the proteins identified is the mycobacterial catalase-peroxidase gene (43). The B and T cell immune responses to recombinant protein derived from this mycobacterial gene are currently being analyzed to determine whether there are disease-specific responses to this protein in sarcoidosis. Conceivably, disease-specific immune responses to persistent microbial antigens may be associated with either disease remission or chronic progressive disease; these findings could then be used to design specific immunotherapy to amplify or suppress these responses (22). The approach outlined above offers one potential approach to the identification of pathogenic antigens in sarcoidosis tissues. This approach might also be generalizable to other granulomatous disorders of uncertain etiology based on the premise that poorly soluble proteins form a central nidus of granuloma formation and are also targets of an immune response in these disorders. Whether these proteins derive from remnants of microbial organisms or endogenous proteins, and whether they induce pathogenic immune responses, could be experimentally determined. References 1. Kitaichi, M. 1986. Pathology of pulmonary sarcoidosis. Clin. Dermatol. 4:108– 115. 2. American Thoracic Society. Statement on sarcoidosis. 1999. Am. J. Respir. Crit. Care Med. 160:736–55. 3. Hillerdal, G., E. Nou, K. Osterman, and B. Schmekel. 1984. Sarcoidosis: epidemiology and prognosis. A 15-year European study. Am. Rev. Respir. Dis. 130:29–32. 4. Rybicki, B. A., M. Major, J. Popovich, Jr, M. J. Maliarik, and M. C. Iannuzzi. 1997. Racial differences in sarcoidosis incidence: a 5-year study in a health maintenance organization.. Am. J. Epidemiol. 145:234–241. 5. Siltzbach, L. E., D. G. James, E. Neville, J. Turiaf, J. P. Battesti, O. P. Sharma, Y. Hosoda, R. Mikami, and M. Odaka. 1974. Course and prognosis of sarcoidosis around the world. Am. J. Med. 57:847–852. 6. Baughman, R. P., A. S. Teirstein, M. A. Judson, M. D. Rossman, H. Yeager, Jr., E. A. Bresnitz, L. DePalo, G. Hunninghake, M. C. Iannuzzi, C. J. Johns, G. McLennan, D. R. Moller, L. S. Newman, D. L. Rabin, C. Rose, B. Rybicki, S. E. Weinberger, M. L. Terrin, G. L. Knatterud, and R. Cherniak. A Case Control Etiologic Study of Sarcoidosis (ACCESS) research group. 2001. Clinical characteristics of patients in a case control study of sarcoidosis. Am. J. Respir. Crit. Care Med. 164:1885–1889.

7. Gideon, N. M., and D. M. Mannino. 1996. Sarcoidosis mortality in the United States 1979–1991: an analysis of multiple-cause mortality data. Am. J. Med. 100:423–427. 8. Wang, J. H., and E. L. Reinherz. 2002. Structural basis of T cell recognition of peptides bound to MHC molecules. Mol. Immunol. 38:1039–1049. 9. Kunkel, S. L., N. W. Lukacs, R. M. Strieter, and S. W. Chensue. 1996. Th1 and Th2 responses regulate experimental lung granuloma development. Sarcoidosis Vasc. Diffuse Lung Dis. 13:120–128. 10. Orme, I. M., and A. M. Cooper. 1999. Cytokine/chemokine cascades in immunity to tuberculosis. Immunol. Today 20:307–312. 11. Moller, D. R. 1999. Cells and cytokines involved in the pathogenesis of sarcoidosis. Sarcoidosis Vasc. Diffuse Lung Dis. 16:24–31. 12. Moller, D. R., J. D. Forman, M. C. Liu, P. W. Noble, B. M. Greenlee, P. Vyas, D. A. Holden, J. M. Forrester, A. Lazarus, M. Wysocka, G. Trinchieri, and C. Karp. 1996. Enhanced expression of IL-12 associated with Th1 cytokine profiles in active pulmonary sarcoidosis. J. Immunol. 156:4952–4960. 13. Greene, C. M., G. Meachery, C. C. Taggart, C. P. Rooney, R. Coakley, S. J. O’Neill, and N. G. McElvaney. 2000. Role of IL-18 in CD4⫹ T lymphocyte activation in sarcoidosis. J. Immunol. 165:4718–4724. 14. Agostini, C., L. Trentin, M. Facco, R. Sancetta, A. Cerutti, C. Tassinari, L. Cimarosto, F. Adami, A. Cipriani, R. Zambello, et al. 1996. Role of IL-15, IL-2, and their receptors in the development of T cell alveolitis in pulmonary sarcoidosis. J. Immunol. 157:910–918. 15. Rogge, L., A. Papi, D. H. Presky, M. Biffi, L. J. Minetti, D. Miotto, C. Agostini, G. Semenzato, L. M. Fabbri, and F. Sinigaglia. 1999. Antibodies to the IL-12 receptor beta 2 chain mark human Th1 but not Th2 cells in vitro and in vivo. J. Immunol. 162:3926–3932. 16. Baughman, R. P., S. A. Strohofer, J. Buchsbaum, and E. E. Lower. 1990. Release of tumor necrosis factor by alveolar macrophages of patients with sarcoidosis. J. Lab. Clin. Med. 115:36–42. 17. Moller, D. R. 1998. Involvement of T cells and alterations in T cell receptors in sarcoidosis. Semin. Respir. Infect. 13:174–183. 18. Grunewald, J., C. H. Janson, A. Eklund, M. Ohrn, O. Olerup, U. Persson, and H. Wigzell. 1992. Restricted V alpha 2.3 gene usage by CD4⫹ T lymphocytes in bronchoalveolar lavage fluid from sarcoidosis patients correlates with HLA-DR3. Eur. J. Immunol. 22:129–135. 19. Forman, J. D., J. T. Klein, R. F. Silver, M. C. Liu, B. M. Greenlee, and D. R. Moller. 1994. Selective activation and accumulation of oligoclonal V betaspecific T cells in active pulmonary sarcoidosis. J. Clin. Invest. 94:1533–1542. 20. Klein, J. T., T. D. Horn, J. D. Forman, R. F. Silver, A. S. Teirstein, and D. R. Moller. 1995. Selection of oligoclonal V beta-specific T cells in the intradermal response to Kveim-Siltzbach reagent in individuals with sarcoidosis. J. Immunol. 154:1450–1460. 21. Selroos, O., M. Klockars, R. Kekomaki, K. Pentinen, P. Lindstrom, and O. Wager. 1980. Circulating immune complexes in sarcoidosis. J. Clin. Lab. Immunol. 3:129–132. 22. Moller, D. R., and E. S. Chen. 2002. Genetic basis of remitting sarcoidosis: triumph of the trimolecular complex? Am. J. Respir. Cell Mol. Biol. 27:391–395. 23. Rosen, Y. 1994. Sarcoidosis. In D. H. Dail and S. P. Hammer, editors. Pulmonary Pathology, 2nd ed. Springer-Verlag, New York. 13–64. 24. Serpier, H., P. Gillery, V. Salmon-Ehr, R. Garnotel, N. Georges, B. Kalis, and F. X. Maquart. 1997. Antagonistic effects of interferon-gamma and interleukin-4 on fibroblast cultures. J. Invest. Dermatol. 109:158–162. 25. Crystal, R. G., P. B. Bitterman, S. I. Rennard, A. J. Hance, and B. A. Keogh. 1984. Interstitial lung diseases of unknown cause: disorders characterized by chronic inflammation of the lower respiratory tract. N. Engl. J. Med. 310:235–244. 26. Sher, A., and R. L. Coffman. 1992. Regulation of immunity to parasites by T cells and T cell-derived cytokines. Annu. Rev. Immunol. 10:385–409. 27. Chen, E. S., B. M. Greenlee, M. Wills-Karp, and D. R. Moller. 2001. Attenuation of lung inflammation and fibrosis in interferon-␥–deficient mice following intratracheal bleomycin. Am. J. Respir. Cell Mol. Biol. 24:545–555. 28. Gurujeyalakshmi, G., and S. N. Giri. 1995. Molecular mechanisms of antifibrotic effect of interferon gamma in bleomycin-mouse model of lung fibrosis: downregulation of TGF-beta and procollagen I and III gene expression. Exp. Lung Res. 21:791–808. 29. Zuo, F., N. Kaminski, E. Eugui, J. Allard, Z. Yakhini, A. Ben-Dor, L. Lollini, D. Morris, Y. Kim, B. DeLustro, D. Sheppard, A. Pardo, M. Selman, and R. A. Heller. 2002. Gene expression analysis reveals matrilysin as a key regulator of pulmonary fibrosis in mice and humans. Proc. Natl. Acad. Sci. USA 399:6292–6297. 30. Chilosi, M., V. Poletti, A. Zamo, M. Lestani, L. Montagna, P. Piccoli, S. Pedron, M. Bertaso, A. Scarpa, B. Murer, A. Cancellieri, R. Maestro, G. Semenzato, and C. Doglioni. 2003. Aberrant Wnt/␤-catenin pathway activation in idiopathic pulmonary fibrosis. Am. J. Pathol. 162:1495–1502. 31. Chilosi, M., V. Poletti, B. Murer, M. Lestani, A. Cancellieri, L. Montagna, P. Piccoli, G. Cangi, G. Semenzato, and C. Doglioni. 2002. Abnormal reepithelialization and lung remodeling in idiopathic pulmonary fibrosis: the role of deltaN-p63. Lab. Invest. 82:1335–1345. 32. Liu, J. Y., P. J. Sime, T. Wu, G. S. Warshamana, D. Pociask, S. Y. Tsai, and A. R. Brody. 2001. Transforming growth factor-␤(1) overexpression in


33. 34. 35. 36. 37.

38.

tumor necrosis factor-␣ receptor knockout mice induces fibroproliferative lung disease. Am. J. Respir. Cell Mol. Biol. 25:3–7. Teder, P., R. W. Vandivier, D. Jiang, J. Liang, L. Cohn, E. Pure, P. M. Henson, and P. W. Noble. 2002. Resolution of lung inflammation by CD44. Science 296:155–158. Baughman, R. P., E. E. Lower, and R. M. du Bois. 2003. Sarcoidosis. Lancet. 361:1111–1118. Baughman, R. P., M. A. Judson, A. S. Teirstein, D. R. Moller, and E. E. Lower. 2002. Thalidomide for chronic sarcoidosis. Chest 122:227–232. Martinetti, M., M. Luisetti, and M. Cuccia. 2002. HLA and sarcoidosis: new pathogenetic insights. Sarcoidosis Vasc. Diffuse Lung Dis. 19:83–95. Sato, H., J. C. Grutters, P. Pantelidis, A. N. Mizzon, T. Ahmad, A. J. Van Houte, J. W. Lammers, J. M. Van Den Bosch, K. I. Welsh, and R. M. Du Bois. 2002. HLA-DQB1*0201: a marker for good prognosis in British and Dutch patients with sarcoidosis. Am. J. Respir. Cell Mol. Biol. 27:406–412. Zissel, G., J. Homolka, J. Schlaak, M. Schlaak, and J. Muller-Quernheim.

S41

39. 40. 41. 42. 43.

1996. Anti-inflammatory cytokine release by alveolar macrophages in pulmonary sarcoidosis. Am. J. Respir. Crit. Care Med. 154:713–719. Grunewald, J., M. Berlin, O. Olerup, and A. Eklund. 2000. Lung T-helper cells expressing T-cell receptor AV2S3 associate with clinical features of pulmonary sarcoidosis. Am. J. Respir. Crit. Care Med. 161:814–818. Munro, C. S., and D. N. Mitchell. 1987. The Kveim response: still useful, still a puzzle. Thorax 42:321–331. Richter, E., Y. P. Kataria, G. Zissel, J. Homolka, M. Schlaak, and J. MullerQuernheim. 1999. Analysis of the Kveim-Siltzbach test reagent for bacterial DNA. Am. J. Respir. Crit. Care Med. 159:1981–1984. Lyons, D. J., S. Donald, D. N. Mitchell, and G. L. Asherson. 1992. Chemical inactivation of the Kveim reagent. Respiration 59:22–26. Moller, D. R., B. Greenlee, L. Marzilli, Z. Song, A. Teirstein, F. Askin, and R. Cotter. 2001. Identification of potential etiologic antigens in sarcoidosis using protein immunoblot and MALDI-TOF mass spectroscopy. Am. J. Respir. Crit. Care Med. 163:A215. (Abstr.)

S42


Proteomic and Inducible Transgenic Approaches to Study Disease Processes Lower respiratory track disorders often result in alteration of the normal architecture of the lung. A possible reason for this is abnormal repair of the injured lung. One of the hallmarks of abnormal lung repair is pulmonary fibrosis. Pulmonary fibrosis results from interactions between different cell types and biomolecules. Idiopathic pulmonary fibrosis (IPF) can be classified as a collection of fibrotic lung disorders of unknown etiology, and involves sequential biological processes (1). In early IPF, there is alveolitis dominated by macrophages and fewer numbers of neutrophils, lymphocytes, and eosinophils, and there is also an increase in the number of type II cells in the epithelium. In the intermediate phase of IPF, alveolitis persists with the thickening of the alveolar walls with fibrosis. In the late phase, there is a marked change in the normal architecture with inflammation and widening of the alveolar walls with fibrosis. Very little is known about the mechanism of this disease process. As with other complex diseases, there is no easy way to dissect the mechanism of this disease process. Here we have discussed two approaches that can be used in conjunction to study complex disease processes. We consider oxidative lung injury to be one potential insult that can initiate this disease process. There are three essential components in the approach that we have discussed here: (i ) identification of differentially expressed proteins between normal lung and during development of lung disease by proteomic analysis; (ii) identification of the specificity of the differentially expressed protein in IPF in comparison with other inflammatory lung diseases; and (iii) identification of the biological consequence of overexpression or functional deletion of that protein using lung specific inducible transgenic mouse model.

Proteomic Analysis of a Disease State Proteomics refers to the characterization of the proteome. The term proteome was first discussed in print by Wasinger and coworkers as the total protein complement of a genome (2). Although the genome of an organism is the same in all somatic cells, the proteome is quite diverse in different cell types in different tissues. Also, the same cell may have a different proteome under different physiologic conditions, or the same protein may undergo functional changes due to biochemical modifications like phosphorylation and acetylation. In a disease process, normal cells behave abnormally

This section was written by Prabir Ray, Li Chen, Vladimir A. Tyurin, Valerian E. Kagan, and Frank A. Witzmann (Dorothy P. and Richard P. Simmons Center for Research and Education in Interstitial Lung Disease, Division of Pulmonary, Allergy, and Critical Care Medicine and Department of Immunology, Department of Environmental and Occupational Health, University of Pittsburgh School of Medicine and School of Public Health, Pittsburgh, Pennsylvania; and Department of Cellular and Integrative Physiology, Indiana University, Indianapolis, Indiana).

because of altered proteome or functional alterations in some proteins. Although characterization of this change is challenging, once this is accomplished it will have enormous impact on different areas, from diagnosis of diseases to drug development. The first step in proteome analysis is isolation of proteins from the source. The source could be cell-free fluids obtained from the body such as bronchoalveolar lavage (BAL) fluid (BALF) and serum, specific pathologically altered areas of a tissue and nearby unaffected areas of the tissue isolated by laser capture microscopy (LCM), or a specific cell type isolated by a specialized technique such as fluorescence-activated cell sorting (FACS). Depending on the source and method of separation, one can optimize the method of protein isolation. If one uses the same method for normal and diseased tissue with careful attention to enzymes that can either degrade or modify proteins such as proteases, phosphatases, and kinases, artifactual protein modifications stemming from isolation procedures can be minimized. The second step in this process is the separation of a complex mixture of proteins into individual proteins. Although this can be achieved by different methods, twodimensional polyacrylamide gel electrophoresis (2-DE) can resolve very complex mixtures of proteins in a gel (3). In this method, the protein mixture is first separated in an isoelectric focusing (IEF) gel. IEF gels are cast with ampholytes to create a pH gradient within the gel and without any denaturing agents. During electrophoresis, proteins migrate to their isoelectric point (pI), the pH at which their positive and negative charges are equal. Because of this, all proteins with the same pI will focus at the same position in the IEF gel. In the second dimension, electrophoresed proteins in the IEF gel are further resolved in a second gel (polyacrylamide) according to their molecular weight. By selecting the appropriate IEF gel and the second dimension gradient gel, one can achieve excellent separation of a complex proteome. One critical point in this regard is that proteins with the same molecular weight and same pI will migrate to the same position. Also, the same protein modified by post-translational modification can be separated from the unmodified protein. After electrophoretic separation, proteins can be stained by a fluorescent stain such as SYPRO Ruby protein gel stain (Molecular Probes, Eugene, OR) for visualization. Once different samples are separated under identical conditions, differential expression or modification of proteins between samples can be assessed by laser scanning of 2-DE spots followed by computer-assisted spot recognition and characterization. After this analysis, potentially interesting protein spots can be removed by a robot using automated spot excision system followed by in-gel protease digestion, elution, and spotting on matrix-assisted laser desorption ionization time of flight mass spectrometer (MALDI-TOF MS) targets for the analysis of peptide mass. The peptide mass data is then matched against different


data banks to get information about the protein from which the peptide is derived. Also, tools are available to obtain amino acid sequence of the peptides (4). The following is an example of proteomic analysis of a pathologic condition experimentally induced in mice.

Proteomic Analysis of Oxidative Lung Injury Oxidant-induced lung injury initiates a cascade of events involving different cell types that induce widespread epithelial and endothelial injury and cell death together with airway inflammation, edema, and hemorrhage. To combat the toxic effects of inhaled oxidants, the respiratory tract elaborates a complex mixture of molecules that maintains homeostasis. Despite the presence of this innate network of antioxidant defense mechanisms, the lung can be overwhelmed by environmental oxidative stresses culminating in fulminant inflammation and tissue destruction. To analyze the changes in protein expression profile during oxidative injury, we exposed mice either to 100% oxygen or to room air as described previously (5). We then compared the proteins present in the BALF of animals exposed to hyperoxia with those present in the BALF derived from control animals exposed to room air. Identical lavage protocols were used for each set of animals. Sample Preparation BALF from each animal was precipitated by the addition of cold trichloroacetic acid (TCA; 10% final concentration) and incubation in an ice bath for 20 min. The precipitate was collected by centrifugation and the pellet was washed in ice-cold acetone using a sonicator to suspend the pellet. The pellets were solubilized for 2-DE using equal volumes of a lysis buffer containing 9 M urea, 4% Igepal CA-630 ([octylphenoxy] polyethoxyethanol), 1% DTT (dithiothreitol), and 2% ampholytes (pH 8–10.5) such that the final protein concentration ranged from 6.8–16.6 ␮g/␮l. 2-DE Proteins were resolved by 2-DE using the Hoefer ISODALT System running 20 gels simultaneously. Equal volumes (100 ␮l) of the solubilized protein samples were placed on first-dimension IEF gels (24 cm ⫻ 1.5 mm) containing 3.3% acrylamide, 9 M urea, 2% Igepal CA-630, and 2% ampholyte (BDH pH 4–8) and isoelectrically focused for 25,000 V-h at room temperature. Each IEF gel was then placed, without equilibration, on a second-dimension slab gel (20 cm ⫻ 25 cm ⫻ 1.5 mm) containing a linear 11–19% polyacrylamide gradient. Second-dimension slab gels were run for ⵑ 18 h at 150 V and 4⬚C and later stained with a colloidal Coomassie brilliant blue stain (6, 7). Image Analysis After staining, the BALF gel protein patterns were scanned under visible light at 200 ␮m/pixel resolution using the Fluor-S MAX MultiImager System (Bio-Rad, Hercules, CA). Image data was analyzed using PDQuest software running under Windows 2000 on a PC workstation. Gel pattern background was subtracted and peaks for the protein spots were located and counted. The total spot count and the total optical density were directly related to the

S43

total protein concentration and individual protein quantities were expressed as PPM of the total integrated optical density. A BALF reference pattern was constructed (from one of the sample gel patterns) and protein spots in each sample gel pattern were automatically and interactively matched to that reference pattern. Protein spots that were uniformly expressed in all patterns were used as landmarks to facilitate rapid gel matching. Peptide Mass Fingerprinting Resolved BALF proteins were excised from the gels robotically with a Bio-Rad Spot Cutter (Bio-Rad, Richmond, CA) and placed in 96-well Costar V-bottomed plates. They were then digested in gel with the MassPrep Station (Micromass, Waters Ltd., Elstuce, Hertsford, UK). Using this automated system, the gel pieces were de-stained (50 mM ammonium bicarbonate/50% acetonitrile), reduced (10 mM dithiothreitol in 100 mM ammonium bicarbonate for 30 min), alkylated (55 mM iodoacetamide in 100 mM ammonium bicarbonate for 20 min), washed (100 mM ammonium bicarbonate), and dehydrated (acetonitrile; three applications). Trypsin (porcine modified, sequencing grade; Promega, Madison, WI) was then added to the gel pieces (150 ng in 25 ␮l 100 mM ammonium bicarbonate total volume for 5 h; 20 ␮l water added at the 5 h stage) and incubated at 37⬚C overnight. Extraction was performed by the addition of 1% formic acid/2% acetonitrile (30 ␮l). After 30 min, a 96-spot MALDI target was spotted by mixing matrix (10 mg/ml ␣-cyano-4-hydoxycinnamic acid in 50% acetonitrile/0.05% trifluoroacetic acid) and sample in-tip with an additional sample overlay (2 ␮l) thereafter. The tryptic peptides were then analyzed by MALDI-TOF-MS using a Micromass (Manchester, UK) MALDI reflectron instrument with automated monoisotopic Peptide Mass Fingerprinting. A threepoint calibration was achieved and an internal lockmass (trypsin-autodigested fragment at 2,211.1045 mz) was used. Spectra were analyzed using Masslynx software (Micromass) and various databases searched. Figure 1A illustrates the proteins that are differentially regulated by hyperoxia, and the details will be reported elsewhere. As an example, Figure 1B shows the decrease in the levels of the enzymes thioether S-methyltransferase and 1-cysteine peroxiredoxin in the BAL fluid of mice exposed to hyperoxia compared with those exposed to normoxia. Interestingly, thioether S-methyltransferase was previously shown to be highly expressed in murine lungs and to have an important role in the conversion and clearance of thioethers by methylation to more water-soluble methyl sulfonium ions suitable for urinary excretion (8). 1-cysteine peroxiredoxin, also abundantly expressed in the lungs, has been shown to be an important antioxidant for the protection of cells against oxidative stress (9, 10). Thus, decrease of 1-cysteine peroxiredoxin levels in the lungs upon hyperoxic stress may be an important contributing factor to increased lung epithelial cell death during oxidative stress.

Inducible Protein Expression System in Transgenic Mice to Study Protein Function Once differentially expressed proteins are implicated in a disease process, the relevance of differential expression of

S44


Figure 1. Proteomic analysis of BALF isolated from C57BL/6 mice exposed to 100% oxygen or room air. Mice were exposed to room air (normoxia), or exposed to 100% O2. BAL was performed and proteins recovered in the BALF was precipitated and subjected to 2DE. (A ) Shown are proteins that are differentially regulated due to hyperoxic exposure. Indicated protein spots, whose levels changed upon hyperoxic treatment, were analyzed by MALDI-TOF-MS. (B ) Lower levels of the proteins S-methyltrasferase (A ) and 1 cysteine peroxiredoxin (B ) in the BALF of animals exposed to hyperoxia compared with those present in the BALF derived from control animals. Twelve mice were used in each group.

specific proteins in the development of the disease phenotype or in the protection of the tissue from the disease process is an important issue. Inducible overexpression or repression of the protein in transgenic mice can provide some answers in this regard. The following is the description of an inducible tissue-specific gene expression system to study the effector function of a protein x (Figure 2).

Generation of Lung-Specific Inducible Transgenic Mice Using a Dual Repressor-Activator System In this method, we generate transgenic animals by simultaneously microinjecting three constructs into the pronuclei of C57BL/6xSJL F2 mouse embryos. One is a construct encoding the tet transrepressor tTR, a hybrid protein containing the class B DNA-binding domain and class E dimerization domain of TetR (11) and the KRAB (Kruppelassociated box) repressor domain of the mammalian Kox1 protein, the second is the reverse tet transactivator rtTA (12), and the third is a construct containing full-length cDNA of the protein of interest linked to tetO/P. The tTR is expressed under the control of the ␤-actin or ROSA26 promoter (13, 14), rtTA is expressed under the control of the Clara cell–specific CC10 promoter, which is active in lung epithelial cells, and the cDNA of the protein of interest

is linked to a minimal CMV promoter and tet O/P sequences. All constructs are confirmed by sequencing. Linearized minigenes are separated from vector DNA and used for microinjection (detailed information of constructs is available from the author). Transgenic mice are characterized by PCR amplification of DNA isolated from tail biopsies.

Effect of Keratinocyte Growth Factor Expression in Mice Exposed to 100% Oxygen The expression of endogeneous keratinocyte growth factor (KGF) is increased in oxidative lung injury (15). To address the function of increased expression of KGF, we have generated transgenic mice expressing KGF in an inducible, lungspecific fashion using the system described above. Using these mice, we are currently investigating several potential functions of KGF in the oxidative injury model. One question that we have asked in this context is “does KGF upregulate production of antioxidant molecules during oxidative exposure to protect the lung?” To address this question, transgenic mice or control nontransgenic mice were exposed to hyperoxia and the lungs of animals were lavaged. To characterize the redox status of the BALF, ESR detection of ascorbate radicals, the one-electron oxidation intermediate of ascorbate, generated upon addition of albumin/Cu complexes, was followed.


Figure 2. Generation of lung-specific inducible transgenic animals using a dual repressor–activator system. An inducible dual repressor–activator transgene expression system is developed by injecting the following three transgenes: one minigene for expression of the tetracycline (doxycycline; Dox)-inducible transrepressor (tTR) under the control of ROSA26 or ␤-actin promoter (pROSA26-tTR or p␤actin-tTR), a second minigene to express the tetracyclineinducible reverse transactivator (rtTA) under the control of lungspecific CC10 promoter (pCC10-rtTA), and a third construct consisting of a CMV minimal promoter and the binding sequence of tTR and rtTA (Tet o/p) linked to the coding sequence of the gene of interest (x) containing a start codon after a Kozak sequence and its own stop codon (ptet O/P x).

Electron Paramagnetic (Spin) Resonance Assay of Ascorbate Radicals in BAL For these experiments, 4 ␮l of albumin/Cu mixture (245 ␮M of N-ethylmaleimide–pretreated human serum albumin ⫹ 73.5 ␮M Cu in the presence of oleic acid [735 ␮M] in PBS, pH 7.4) was added to 50 ␮l of BAL and electron paramagnetic (spin) resonance (EPR) signals of ascorbate radicals were scanned during a 20-min time period. The measurements were performed in gas-permeable Teflon tubing (0.8 mm internal diameter, 0.013 mm thickness) obtained from Alpha Wire Corp. (Elizabeth, NJ) on a JEOL-RE1X spectrometer at 25⬚C. The Teflon tube (ⵑ 8 cm in length) was filled with 50 ␮l of the reaction mixture, folded into halves, and placed into an open EPR quartz tube (inner diameter of 3.0 mm) in such a way that the sample was entirely within the microwave radiation area. In a typical experiment, the spectra of ascorbate radicals were recorded under the following conditions: center field 3,352 G, power 10 mW, field modulation 0.79 G, sweep time 20 s, sweep width 2.5 G, receiver gain 4000, time constant 0.1 s. Spectra were collected using EPRware software (Scientific Software Services, Bloomington, IL). Figure 3A shows the typical continuous repetitive recordings of EPR signals of ascorbate radicals generated by albumin/Cu from endogenous ascorbate in BAL samples from control mice and mice exposed to 100% oxygen. In the presence of albumin/Cu, a distinctive ascorbate radical EPR signal was detectable with a characteristic doublet splitting aH ⫽ 1.79 G (Figure 3A, traces 2–4). As expected, the Cu/albumin complex exhibited a remarkable catalytic redox-cycling activity toward ascorbate, as evidenced by the formation of its one-electron oxidation product, ascorbate radical. The greatest magnitude of the EPR signal and the

S45

Figure 3. Ascorbate radical generation in BALF from KGF(⫹)/ Dox(⫹) (transgenic mice) and KGF(⫺)/Dox(⫺) (nontransgenic control mice) mice exposed to hyperoxia using EPR spectroscopy. (A ) Typical time course of EPR signals from ascorbate radicals produced by albumin/Cu in different samples of BAL from control mice and transgenic mice exposed to room air or hyperoxia. Trace 1: sample contained BAL from KGF(⫹)/Dox(⫹) mice without addition of Cu/albumin; trace 2: sample contained BAL from room air–exposed KGF(⫹)/Dox(⫹) mouse ⫹ Cu/albumin complex of (20 ␮M, 1:0.3 mol/mol); trace 3: sample contained BAL from hyperoxia-exposed KGF(⫹)/Dox(⫹) mouse ⫹ Cu/albumin complex of (20 ␮M, 1:0.3 mol/mol); trace 4: sample contained BAL from hyperoxia-exposed KGF(⫺)/Dox(⫺) mice ⫹ Cu/albumin complex of (20 ␮M, 1:0.3 mol/mol). (B ) Decay rate of ascorbate radical generated by Cu/albumin complex in different BAL samples from control mice and transgenic mice exposed to room air or hyperoxia. Column 1: BAL from room air-exposed KGF(⫹)/Dox(⫹) mice ⫹ Cu/albumin (n ⫽ 2). Column 2: BAL from hyperoxia-exposed KGF(⫺)/Dox(⫺) mice ⫹ Cu/albumin (n ⫽ 6). Column 3: BAL from hyperoxia-exposed KGF(⫹)/Dox(⫹) mice ⫹ Cu/albumin (n ⫽ 2). Data are presented as means ⫾ SD, *P ⬍ 0.03 versus KGF(⫹)/Dox(⫹) hyperoxia.

shortest life-span of the radical signal was observed in BAL samples from KGF(⫺)/Dox(⫺) mice exposed to hyperoxia (Figure 3A, trace 4). The effect of hyperoxia was significantly less pronounced in BAL from KGF(⫹)/Dox(⫹) mice exposed to hyperoxia. In this case, the magnitude of the signal was significantly smaller and the decay of the ascorbate radical signal was much slower (Figure 3A, trace 3). In BAL samples from both KGF(⫺)/Dox(⫺) and KGF(⫹)/ Dox(⫹) mice exposed to room air, Cu/albumin catalyzed oxidation of ascorbate and formation of its radicals proceeded at a slow rate resulting in a relatively weak signal that did not significantly change its magnitude over 4 min of recording (Figure 3A, trace 2). No detectable EPR signals were observed from BAL samples in the absence of albumin/Cu (Figure 3A, trace 1). A summary of measurements performed on different BAL samples from several mice is presented in Figure 3B. The rate of ascorbate radical decay after hyperoxia was significantly higher in the KGF(⫺)/ Dox(⫺) BAL samples as compared with BAL samples from KGF(⫹)/Dox(⫹) mice. An even lower rate of ascorbate radical decay was detected in BAL samples of animals exposed to room air. In conclusion, to understand the complexity of biological systems or the development of disease processes, characterization of the expressed proteins is an essential step. Estab-

S46


lishment of protein expression profiles in different classes of fibrotic disorders will not only facilitate better diagnosis, but will also help identify potential drug targets. Expression of potential disease-related genes in mice, on the other hand, will aid in the development of murine models of human diseases. Ultimately, these murine models will be valuable tools for studying mechanisms of disease processes. Acknowledgments: The writers of this section thank Drs. M. Gossen and H. Bujard for the plasmid pUHD172-neo containing the reverse tetracycline transactivator, Dr. W. Hillen for the plasmid pCMV-TetR(B/E)-KRAB encoding TetR, and Dr. J. Whitsett for the plasmid pCC10CAT-2300 containing the CC10 promoter. This section was supported by grants HL 69810 and HL 60207 (to P.R.) from the National Institutes of Health.

References 1. Green, F. H. 2002. Overview of pulmonary fibrosis. Chest 122:334S–339S. 2. Wasinger, V. C., S. J. Cordwell, A. Cerpa-Poljak, J. X. Yan, A. A. Gooley, M. R. Wilkins, M. W. Duncan, R. Harris, K. L. Williams, and I. HumpherySmith. 1995. Progress with gene-product mapping of the Mollicutes: Mycoplasma genitalium. Electrophoresis 16:1090–1094. 3. O’Farrell, P. H. 1975. High resolution two-dimensional electrophoresis of proteins. J. Biol. Chem. 250:4007–4021. 4. Pennington, S. R., and M. J. Dunn, editors. 2001. Proteomics: from protein sequence to function. BIOS, Springer-Verlag New York Inc., New York. 5. Lu, Y. B., L. Parkyn, L. Otterbein, Y. Kureishi, K. Walsh, A. Ray, and P. Ray. 2001. Activated Akt protects the lung from oxidant-induced injury and delays death of mice. J. Exp. Med. 193:545–549.

6. Neuhoff, V., N. Arold, D. Taube, and W. Ehrhardt. 1988. Improved staining of proteins in polyacrylamide gels including isoelectric focusing gels with clear background at nanogram sensitivity using Coomassie Brilliant Blue G-250 and R-250. Electrophoresis 9:255–262. 7. Witzmann, F. A., J. W. Clack, K. Geiss, S. Hussain, M. J. Juhl, C. M. Rice, and C. Wang. 2002. Proteomic evaluation of cell preparation methods in primary hepatocyte cell culture. Electrophoresis 23:2223–2232. 8. Mozier, N. M., and J. L. Hoffman. 1990. Biosynthesis and urinary excretion of methyl sulfonium derivatives of the sulfur mustard analog, 2-chloroethyl ethyl sulfide, and other thioethers. FASEB J. 4:3329–3333. 9. Manevich, Y., T. Sweitzer, J. H. Pak, S. I. Feinstein, V. Muzykantov, and A. B. Fisher. 2002. 1-Cys peroxiredoxin overexpression protects cells against phospholipid peroxidation-mediated membrane damage. Proc. Natl. Acad. Sci. USA 99:11599–11604. 10. Pak, J. H., Y. Manevich, H. S. Kim, S. I. Feinstein, and A. B. Fisher. 2002. An antisense oligonucleotide to 1-cys peroxiredoxin causes lipid peroxidation and apoptosis in lung epithelial cells. J. Biol. Chem. 277:49927–49934. 11. Forster, K., V. Helbl, T. Lederer, S. Urlinger, N. Wittenburg, and W. Hillen. 1999. Tetracycline-inducible expression systems with reduced basal activity in mammalian cells. Nucleic Acids Res. 27:708–710. 12. Gossen, M., S. Freundlieb, G. Bender, G. Muller, W. Hillen, and H. Bujard. 1995. Transcriptional activation by tetracyclines in mammalian cells. Science 268:1766–1769. 13. Ray, P., K. M. Higgins, J. C. Tan, T. Y. Chu, N. S. Yee, H. Nguyen, E. Lacy, and P. Besmer. 1991. Ectopic expression of a c-kitW42 minigene in transgenic mice: recapitulation of W phenotypes and evidence for c-kit function in melanoblast progenitors. Genes Dev. 5:2265–2273. 14. Kisseberth, W. C., N. T. Brettingen, J. K. Lohse, and E. P. Sandgren. 1999. Ubiquitous expression of marker transgenes in mice and rats. Dev. Biol. 214:128–138. 15. Ware, L. B., and M. A. Matthay. 2002. Keratinocyte and hepatocyte growth factors in the lung: roles in lung development, inflammation, and repair. Am. J. Physiol. Lung Cell. Mol. Physiol. 282:L924–L940.


S47

Pulmonary Fibrosis in Families Familial idiopathic pulmonary fibrosis (FIPF) is identified by confirming IPF in two or more members of the same family. FIPF was described in the English literature fifty years ago (1–3), but has received scant attention since. Families with IPF have been described from all around the world, in forty-three reports mostly from Europe and North America (1).

A Family with IPF with Sixteen Patients One of the earliest reports described twin sisters who both died of IPF at age 46, after living in separate geographic regions for the prior 25 years, suggesting that genetic factors were more important than environmental exposure (2). The following year, another report described a mother and adult daughter who both died from IPF (3). It was subsequently learned that these two studies reported different branches of the same family, and in 1965 Dr. Bonanni described a comprehensive investigation of this large family (4). Eight patients had developed IPF in this family by the time of his sentinel report, and there have been eight new cases since that time, making it the largest reported (5). Vertical transmission in four generations, along with father-to-son transmission, are present and indicate that FIPF is caused by a single autosomal dominant gene (Figure 1). Ages of onset of IPF in this family ranged from 38–52 yr.

Familial IPF/Cryptogenic Fibrosing Alveolitis in the United Kingdom The clinical and epidemiologic findings of 25 families identified in the United Kingdom were recently described (6). Adult pulmonary physicians in the United Kingdom were asked to identify all families under their care in which two or more individuals had been diagnosed with fibrosing alveolitis of unknown cause. Twenty-five families were identified, comprising 67 cases. The male:female ratio was 1.75:1. The mean age at diagnosis was 55.5 yr. Fifty percent of cases had been smokers and 18% had been diagnosed as asthmatic. Exposure to known fibrogenic agents was recorded by 36% of patients. Familial patients were younger at diagnosis, but otherwise indistinguishable from nonfamilial cases. The clinical, radiographic, histopathologic, and treatment outcomes are identical between sporadic and familial IPF (6). It is not known what percentage of all IPF is familial, but current reports estimate that it is ⵑ 2% (6). In contrast, our experience suggests that the actual incidence may be considerably higher, similar to that described in an early review that included nearly 100 patients with IPF, in which 25 percent reported a positive family history (7). There are no reports of confirmed chromosomal linkage or genome-wide searches for IPF.

This section was written by James E. Loyd (Vanderbilt University Medical School, Nashville, Tennessee).

Familial IPF Database at Vanderbilt University In our database of families with IPF we have collected clinical information from 76 families. One family has had 16 patients with IPF (Figure 1), another family has had 14 patients (Figure 2), and 14 other families have had 5 or more patients with IPF. There have been 222 patients with IPF recognized among 2,134 individuals at risk in these families. Nearly 20% of IPF deaths in these families occurred before age 50 yr. The ethnic origins are predominantly Caucasian and Hispanic. Vertical transmission, in up to four consecutive generations, is seen in the majority of our IPF pedigrees, and indicates an autosomal dominant mode. Father-to-son transmission is present in many families, and excludes X linked inheritance. These characteristics indicate that there is at least one autosomal dominant gene that causes IPF. It is possible that there may be more than one locus or more than one allele, or that IPF is more than one disease. In the Vanderbilt lung transplant program, the cause for end stage lung disease was IPF for 47 lung recipients. Nine of the 47 (19%) transplanted for IPF have a family history positive for interstitial lung disease.

Prior Reports of Linkage of IPF to Chromosome 14 Two remote studies suggested that IPF may be related to genes on chromosome 14, using associations between IPF and ␣1-antitrypsin alleles located there. An increase in frequency of Z and S alleles in patients with IPF was described by Geddes and coworkers (8) and again by Michalski (9). Geddes and colleagues found in their study of 49 patients with IPF that there was a significant increase in the frequency of MZ phenotype. In another heavily affected IPF family, a strong association of disease was identified with immunoglobulin Gm allotypes located on chromosome 14q32 (10). This family had six proven IPF cases in three generations, and all affected individuals carried the immunoglobulin haplotype Gm1.

Our Studies Exclude FIPF Linkage to Chromosome 14 In a recent collaborative study, we examined markers spaced across chromosome 14 to establish or to exclude the suggested linkage. We genotyped 70 individuals from 11 families with IPF for 14 markers spanning the length of chromosome 14 (unpublished data). The power of this dataset was marginal to confirm linkage, but it was sufficient to exclude linkage with confidence. Our results revealed that all two-point and multi-point LOD scores on chromosome 14 were negative or near zero. These results suggest that linkage of the total 11 families to a putative gene on chromosome 14, within 5 cM on either side of all, and within 10 cM on either side of eight of the 14 markers, can be excluded with a LOD of ⬍ ⫺2.

S48


Figure 1. FIPF 23.

Surfactant Protein C Mutations as a Cause of Interstitial Lung Disease A recent report described a mutation in the surfactant protein C gene (SFTPC) that was associated with nonspecific interstitial pneumonitis (NSIP) in an infant whose mother had desquamative interstitial pneumonitis (DIP) (11). Heterozygous G to A transition of the first base of intron 4 (IVS4⫹1 G to A) was present in both patients, and caused skipping of exon 4 with deletion of 37 amino acids. Symptoms were not present at the time of birth in either patient, but both developed interstitial lung disease (ILD) later as infants. The IVS4⫹1 G to A mutation in SFTPC was identified on only one allele of both patients, consistent with an autosomal dominant pattern (11). The mutation resulted in the production of an abnormal proprotein, and the levels of transcripts encoding normal SP-C precursor protein were similar to those of transcripts encoding the abnormal protein. Mature surfactant protein C is derived through the proteolytic processing of a 197–amino acid proprotein (or a

191–amino acid proprotein with alternative splicing). Surfactant protein C precursor protein is an integral membrane protein that is anchored in the membrane by the hydrophobic core of mature surfactant protein C. The IVS4⫹1 G to A mutation caused skipping of exon 4 and the deletion of 37 amino acids in the carboxy-terminal domain of surfactant protein C precursor protein (11). Deletions in this domain have been shown to disrupt the intracellular transport of surfactant protein C precursor protein. Interactions between normal and abnormal surfactant protein C precursor protein could impair the transit of normal surfactant protein C precursor protein through the processing pathway or enhance its degradation. The lack of mature surfactant protein C in lung tissue and bronchoalveolar lavage fluid from the patient supports the idea that the precursor protein was not being processed and secreted normally (11).

A Different Mutation in SFTPC Causes IPF in 14 Patients in One Family Because of the report of an SFTPC mutation causing NSIP and DIP in a newborn child and mother (11), we chose

Figure 2. FPF 34.


SFTPC as a candidate gene, and then tested it in the largest IPF family in our database (12). This kindred (Figure 2) spans five generations, contains 97 total members, including 11 adults with IPF, including 6 with biopsy-proven usual interstitial pneumonitis (UIP), and 3 affected children (III:5, V:1,V:2) with cellular nonspecific interstitial pneumonitis. We screened this multiplex FIPF kindred for mutations in SFTPC. A microsatellite marker (SFTP2) located 9 kilobases from SFTPC was used to perform linkage analysis on this family. LOD scores were calculated assuming an autosomal dominant mode of inheritance of a single gene with a disease allele frequency of 0.0001. Analysis was done assuming that unaffected individuals were not disease gene carriers, using phenotype information on only affected individuals. A LOD score of 4.33 at a recombination fraction of 0.00 was generated between FIPF and the marker, which is highly significant and confirms a definite relationship of this marker to the disease in this family (12). We screened patient DNA specimens by dideoxyfingerprinting (ddF) using a primer scanning approach, which yielded an abnormal ddF pattern from polymerase chain reaction (PCR) fragments containing exon 5 sequences derived from DNA template of three affected family members (12). Sequencing of these DNA fragments revealed a heterozygous exon 5 ⫹128 T to A transversion that substitutes glutamine for leucine at the highly conserved amino acid position 188 of the carboxy-terminal region of SP-C precursor (proSP-C) protein. Restriction analysis then confirmed the mutation was present in DNA from all available affected family members (12). The mutation was not present in 88 control chromosomes. Immunohistochemistry was performed by immunostaining for pro SP-C; in normal adult alveolar Type II cells, it showed focal brown staining of the cytoplasm adjacent to lamellar bodies (12). Lung from affected patients with IPF in this family when immunostained for pro SP-C showed a very abnormal distribution of staining, with diffuse brown cytoplasmic staining in cuboidal type II cells, and absence of identifiable lamellar bodies (12). Mouse lung epithelial cells were transfected with plasmids containing normal and mutant SFTPC (12). Pooled stable lines were grown, then supernatants and lysates of 105 viable nontransfected, wild-type, or mutant SFTPCtransfected cells incubated for 24 h were assayed for cellular toxicity. Mutant SFTPC-transfected cells displayed sluggish growth rates compared with nontransfected and wild-type SFTPC-transfected cells, taking several days longer to grow to confluence on culture plates (12). The percentage of nontransfected, wild-type SFTPC-transfected, and mutant SFTPC-transfected cells displaying cytotoxicity (percentage of cytotoxicity ⫽ LDH activity supernatant/LDH activity cell lysate) was 5.8 ⫾ 1.4%, 4.6 ⫾ 2.3%, and 11.9 ⫾ 1.9%, respectively (P ⬍ 0.05 for comparison between both nontransfected and mutant cells and between wild-type and mutant cells). The carboxy terminal domain plays a critical role in trafficking and processing of proSP-C (13), because deletional mutants of this region remain localized in the endoplasmic reticulum/Golgi body without proper proteolysis (14). Thus, we predict the carboxy-terminal SFTPC muta-

S49

tion we discovered may cause misfolding of SP-C and/or SP-C deficiency with subsequent type II cell injury and alveolar instability.

Mechanisms of Disease from SFTPC Mutations It appears that severe interstitial lung disease can result from either the absence of SP-C, or alternatively from production of an abnormal proSP-C protein (15). Selective absence of expression of pro SP-C and the active SP-C protein was described in a family with interstitial lung disease recently described (16). Also, an inbred strain of SP-C (⫺/⫺) mice developed severe ILD with features similar to those seen in patients with ILD (15). SP-C deficiency also causes lung disease in Belgian White and Blue cattle, a strain in which some newborn calves may develop respiratory distress associated with selective deficiency of SP-C (17). The deficiency of SP-C in surfactant could cause abnormal shear forces in the alveoli, thereby causing mechanical injury of the respiratory epithelium, which in turn may contribute to the pathogenesis of IPF. Missense or short deletion mutations, as seen in the studies by Nogee (11) and in our studies, result in the production of a stable mRNA that produces an abundance of a misfolded protein that may escape from protein quality control systems. Accumulation of the abnormal pro SP-C protein or protein complexes may cause type II epithelial cell injury. Further, the expression of a mutant SP-C protein directly caused a lethal lung disorder in transgenic mice (18), providing support for the concept that mutations in the SP-C gene-caused misfolding and misrouting of pro SP-C, may contribute to the pathogenesis of lung disease in mice and patients expressing mutant proSP-C peptides. Thus, both the presence and absence of proSP-C can be associated with lung disease.

Clinical Features of SFTPC Mutations Information describing the clinical expression of SFTPC mutations is growing progressively, but it is already clear that these mutations can cause interstitial lung disease in children and adults. Several pathologic forms of IPF, including NSIP, DIP, and UIP, have been reported related to mutations in SFTPC. The clinical course of some individual patients with ILD due to SFTPC mutations appears to be quite long, sometimes even for decades. Anecdotal evidence suggests that common viral respiratory infections may trigger the clinical presentation. Further specific information about the clinical manifestations of SFTPC mutations is awaited with great interest, and surely will be developed in the next few years.

Summary of Familial IPF Clinical findings, histopathology, and clinical course are indistinguishable between familial IPF and sporadic cases (6). Patients with familial IPF may be younger at diagnosis, but are otherwise indistinguishable from nonfamilial cases (6). Our experience in which we have collected 76 families with IPF at a single medical center suggests that IPF in families may be far more common than the 2% estimate (6) that is currently reported, perhaps even 10-fold higher.

S50


Nineteen percent of patients who received lung transplantation for IPF at our institution have a positive family history. It is possible that the incidence of familial IPF in our referral population is not a representative sample. The subsequent development of new cases in other members in families of patients formerly believed to have sporadic IPF suggests that some sporadic patients may have a genetic basis. The identification of the genetic basis of IPF in families may be the most effective method to identify the central pathogenetic features of IPF. Acknowledgments: This work was supported by an Intramural Discovery Grant from Vanderbilt University on familial idiopathic pulmonary fibrosis.

References 1. Marshall, R. P., R. J. McAnulty, and G. J. Laurent. 1997. The pathogenesis of pulmonary fibrosis: is there a fibrosis gene? Int. J. Biochem. Cell Biol. 29:107–120. 2. Peabody, J. W., J. W. Peabody, Jr., E. W. Hayes, and E. W. Hayes, Jr. 1950. IPF: its occurrence in identical twin sisters. Dis. Chest 18:330–344 3. MacMillan, J. M. 1951. Familial pulmonary fibrosis. Dis Chest 20:426–436 4. Bonanni, P. P., J. W. Frymoyer, and R. F. Jacox. 1965. A family study of idiopathic pulmonary fibrosis: a possible dysproteinemic and genetically determined disease. Am. J. Med. 39:411–421. 5. Marney, A., K. B. Lane, J. A. Phillips, III, D. J. Riley, and J. E. Loyd. 2001. Idiopathic pulmonary fibrosis can be an autosomal dominant trait in some families. Chest 120:S56. 6. Marshall, R. P., A. Puddicombe, W. O. Cookson, and G. J. Laurent. 2000. Adult familial cryptogenic fibrosing alveolitis in the UK. Thorax 55:143– 146. 7. Donohue, W. L. 1959. Familial fibrocystic pulmonary dysplasia and its relation to Hamman-Rich syndrome. Pediatrics 24:786–819.

8. Geddes, D. M., M. Webley, D. A. Brewerton, C. W. Turton, M. TurnerWarwick, A. H. Murphy, and A. M. Ward. 1977. Alpha 1-antitrypsin phenotypes in fibrosing alveolitis and rheumatoid arthritis. Lancet 2:1049– 1051. 9. Michalski, J. P. 1986. Alpha 1 antitrypsin phenotypes including M subtypes in pulmonary disease associated with rheumatoid arthritis and systemic sclerosis. Arthritis Rheum. 29:586–591. 10. Musk, A. W., P. J. Zilko, P. Manners, P. H. Kay, and M. I. Kamboh. 1986. Genetic studies in familial fibrosing alveolitis. Possible linkage with immunoglobulin allotypes (Gm). Chest 89:206–210. 11. Nogee, L. M., A. E. Dunbar, III, S. E. Wert, F. Askin, A. Hamvas, and J. A. Whitsett. 2001. A mutation in the surfactant protein C gene associated with familial interstitial lung disease. N. Engl. J. Med. 344:573–579. 12. Thomas, A. Q., K. Lane, J. Phillips, III, M. Prince, C. Markin, M. Speer, D. A. Schwartz, R. Gaddipati, A. Marney, J. Johnson, and J. E. Loyd. 2002. Heterozygosity for a surfactant protein C gene mutation associated with usual interstitial pneumonitis and cellular nonspecific interstitial pneumonitis in one kindred. Am. J. Respir. Crit. Care Med. 165:1322–1328. 13. Keller, A., W. Stenhilber, K. Schafer, and T. Voss. 1992. The C-terminal domain of the pulmonary surfactant protein C precursor contains signals for intracellular targeting. Am. J. Respir. Cell Mol. Biol. 6:601–608. 14. Beers, M., C. Lomax, and S. Russo. 1998. Synthetic processing of surfactant protein C by alveolar epithelial cells. J. Biol. Chem. 273:15287–15293. 15. Whitsett, J. A. 2002. Genetic basis of familial interstitial lung disease:misfolding or function of surfactant protein C? Am. J. Respir. Crit. Care Med. 165:1201–1202. 16. Amin, R. S., S. E. Wert, R. P. Baughman, J. F. J. Tomashefski, L. M. Nogee, A. S. Brody, W. M. Hull, and J. A. Whitsett. 2001. Surfactant protein deficiency in familial interstitial lung disease. J. Pediatr. 139:85–92. 17. Danlois, F., S. Zaltash, J. Johansson, B. Robertson, H. P. Haagsman, M. van Eijk, M. F. Beers, F. Rollin, J. M. Ruysschaert, and G. Vandenbussche. 2000. Very low surfactant protein C contents in newborn Belgian White and Blue calves with respiratory distress syndrome. Biochem. J. 351:779– 787. 18. Conkright, J. J., C. L. Na, and T. E. Weaver. 2002 Overexpression of surfactant protein-C mature peptide causes neonatal lethality in transgenic mice. Am. J. Respir. Cell Mol. Biol. 26:85–90.


S51

Gene Profiling and Kinase Screening in Asbestos-Exposed Epithelial Cells and Lungs Pulmonary fibrosis is a progressive and chronic inflammatory lung disease characterized by epithelial cell injury, mesenchymal cell (fibroblast, myofibroblast) proliferation, and extensive remodeling of the lung parenchyma (1, 2) . Lung remodeling may involve epithelial and inflammatory cell interactions with mesenchymal cells that lead to excessive accumulation of extracellular matrix (ECM), lung dysfunction, and fatality (1–3). Although the pathogenesis of pulmary fibrosis, which may exhibit a number of pathologies, is poorly understood, a variety of cytokines, chemokines, and regulators of apoptosis have been implicated in its development and progression (1–6). The failure of anti-inflammatory drugs to effectively treat this disease (7), as well as data that show inflammation per se is not intrinsic to the development of fibrosis (8, 9), suggest that other mechanisms such as epithelial cell injury and repair are important. Epithelial cell responses may be key to initiation of inflammation as well as regulating homeostasis of the ECM (10). It is becoming increasingly clear that maintenance of ECM is a dynamic process in which the synthesis of proteins such as fibrillar collagens, fibronectin, and proteoglycans is normally balanced by similar rates of proteolysis. Protein turnover in the ECM is mediated mainly by a class of proteases known as matrix metalloproteinases (MMPs) and their inhibitors (TIMPs) (11). The role of cell signaling pathways in eliciting cell injury, apoptosis, proliferation, and inflammation has been studied in a number of organs and cell types, but little is known about epithelial cell signaling and its relationship to the development of pulmonary fibrosis. In studies here, we used a murine nontransformed type II epithelial cell line, C10 (12), to characterize gene and protein expression by oligonucleotide microarray analysis (Affymetrix, Santa Clara, CA) and kinase profiling after exposure to the carcinogenic and fibrogenic mineral, crocidolite asbestos, for 8 and 24 h. In addition, we examined alterations in gene expression in whole lung homogenates of C57/BL6 mice at 3 d after inhalation of crocidolite asbestos at concentrations inducing proliferation of bronchiolar and alveolar epithelial cells (13). These acute periods of exposure were selected to identify genes and signaling proteins that may be involved in the initiation of epithelial cell injury and proliferation by asbestos.

Materials and Methods Cell Culture and Reagents The C10 cell line is a nontumorigenic murine alveolar type II epithelial cell line (12). The line was isolated from adult mice, and

This section was written by Maria E. Ramos-Nino, Nicolas Heintz, Luca Scapoli, Marcella Martinelli, Susan Land, Norma Nowak, Astrid Haegens, Brian Manning, Nicole Manning, Maximilian MacPherson, Maria Stern, and Brooke Mossman (Department of Pathology, University of Vermont College of Medicine, Burlington, Vermont; Applied Genomics Technology Center, Wayne State University, Detroit, Michigan; and Microarray and Genomics Facility, SUNY Buffalo School of Medicine and Biomedical Sciences and Roswell Park Cancer Institute, Buffalo, New York).

maintains a characteristic epithelial morphology including surface microvilli, desmosomes, and lamellar bodies. C10 cells were maintained and passaged in CMRL 1066 medium (Life Technologies, Inc., Grand Island, NY) supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine, and antibiotics. At confluence, cells were switched to 0.5% FBS-containing medium for 24 h before addition of crocidolite asbestos (Na2[Fe3⫹]2[Fe2⫹]3Si8O22[OH]2) (NIEHS reference sample) at 5 ␮g/cm2 dish, a concentration causing apoptosis at 24 h and increases in DNA synthesis that reflect compensatory proliferation at 72 h (14). Epidermal growth factor (EGF; Upstate Biotechnology, Lake Placid, NY) at 5 ng/ml was used as a positive control for cell proliferation (14). C10 cells were grown to confluence, complete medium was removed, and medium with 0.5% was added 24 h before exposure to agents. Control dishes received medium without agents

Kinase Screening For these experiments, cells were exposed to asbestos fibers (5 ␮g/cm2) at two time points, 8 and 24 h, or to EGF (5 ng/ml) for 30 min and 4 h (n ⫽ 2-3 samples per group per time point). These time points were selected based on previously published data showing maximum extracellular signal-regulated kinase (ERK1/2) activity by these agents (14). Protein kinase assays were performed using the Kinetworks (KPKS1.0) screen (Kinexus Bioinformatics Corporation, Vancouver, BC, Canada). This screen evaluates 75 known protein kinases for their expression and phosphorylation due to mobility shifts on SDS-PAGE gels. Briefly, cells were suspended in 0.5 ml of lysis buffer (20 mM MOPS, pH 7.0; 2 mM EGTA; 5 mM EDTA; 30 mM NaF; 40 mM ␤-glycerophosphate, pH 7.2; 10 mM sodium pyrophosphate; 2 mM sodium orthovanadate; 1 mM phenylmethylsulfonylfluoride; 3 mM benzamidine; 5 ␮M pepstatin A; 10 ␮M leupeptin and 0.5% Nonidet P-40, pH 7.0) per duplicate samples. Lysates were then sonicated 2⫻ for 15 s each, and the homogenates centrifuged for 30 min at 100,000 ⫻ g. Protein concentrations from the resulting supernatant fraction were measured using the Bradford assay (Bio Rad, Hercules, CA). Four hundred micrograms of protein per sample was suspended in SDS-PAGE sample buffer as specified by Laemmli. Immunoreactive proteins were quantified with a high resolution scanner that detects chemiluminescence. The data are presented as fold changes of protein expression with respect to the untreated controls. Only those signaling kinases exhibiting fold changes ⬎ 1.5 were considered altered in expression and were graphed.

Microarray Assays on C10 Cells Microarrays were performed on C10 cells with and without addition of asbestos as described above. The RNA target (biotinlabeled RNA fragments) was produced from 8 ␮g of total RNA collected from the pooling of five different experiments by first synthesizing double-stranded cDNA followed by an in vitro transcription reaction and a fragmentation reaction. A hybridization cocktail containing the fragment cRNA, probe array control (Affymetrix), bovine serum albumin, and herring sperm DNA was prepared and hybridized to the probe array at 45oC for 16 h. The hybridized probe array was then washed, and bound biotin-labeled cRNA detected with streptavidin phycoerythrin conjugate. Subsequent signal amplification was performed with a biotinylated anti-

S52


TABLE 1

Taqman primers and probes with FAM/TAMRA labels for Real time RT-PCR assays to confirm results of microarray in asbestos-exposed C10 cells Gene

CD44-F CD44-P CD44-R FOS-F FOS-P FOS-R FRA1-F FRA1-P FRA1-R HPRT-F HPRT-P HPRT-R

Primers and probes

CCAACACCTCCCACTATGAC CAGTCACAGACCTACCCAATTCCTTCGA TATACTCGCCCTTCTTGCTG GGACCTGTCCGGTTCCTTCTA CAGCAGACTGGGAGCCTCTGCACA GGCTCCAGCTCTGTGACCAT TGCCTTGCATCTCCCTTTCT CCCGTACTTGAACCGGAAGCACTGC TCAGAGAGGGTGTGGTCATGAG TTTGCCGCGAGCCG CGACCCGCAGTCCCAGCGTC TAACCTGGTTCATCATCGCTAATC

streptavidin antibody. The washing and staining procedures were automated using the Affymetrix fluidics station. Each probe array Mouse Genome U74A (Affymetrix) was scanned twice (HewlettPackard GeneArray Scanner, Agilent Technologies, Inc., Palo Alto, CA), the images overlaid, and the average intensities of each probe cell compiled. Results were analyzed using Affymetrix GeneChip software (Silicon Genetics, Redwood, CA).

Real Time RT-PCR Total RNA (1 ␮g) was reverse-transcribed with random primers using the Promega AMV Reverse Transcriptase kit (Promega, Madison, WI) according to recommendations of the manufacturer. To quantify gene expression, we amplified the cDNA by TaqMan Real Time RT-PCR using the 7700 Sequence Detector (Perkin Elmer Applied Biosystems, Foster, CA). Reactions contained 1⫻ TaqMan Universal PCR Master Mix, 900 nM of forward and reverse primers and 200 nM for the TaqMan-probes. Thermal cycling proceeded with 40 cycles of 95⬚C for 15 s and 60⬚C for 1 min. Original input RNA amounts were calculated with relative standard curves for the mRNAs of interest and the hprt control. Duplicate assays were performed with RNA samples isolated from at least two independent experiments. The values obtained from cDNAs and hprt controls provided relative gene expression levels for the gene locus investigated. The primers and probe sequences used are presented in Table 1.

Microarrays on Mouse Lungs C57/BL6 mice (12 wk old) were exposed in inhalation chambers to clean air (shams) or NIEHS crocidolite asbestos (2 mg/m3 air, 6 h/d for 3 d) as described previously (13). Inflammation and focal interstitial fibrosis subsequently occur in this murine model of asbestosis. After preparation of RNA from lung samples (50 ␮g/ sample) (13), RNA from two sham and two asbestos-exposed mice were examined for hybridization to Affymetrix mouse chips, and results analyzed using Affymetrix GeneChip software as described above.

Results Kinase Protein Screening Indicates that Multiple Pathways Are Involved in Asbestos- and EGF-Induced Effects on Pulmonary Epithelial Cell Proliferation The results of kinase screening assays suggest that multiple kinases are increased in expression in C10 cells after expo-

Figure 1. Results of kinase proteomic screening assays in alveolar type II epithelial cells (C10). Kinases induced by asbestos (A, B ) or EGF (C ) that show a fold change ⬎ 1.5 compared to untreated controls (n ⫽ 2–3/group). (A ) Black bars, asbestos 24 h; shaded bars, asbestos 8 h. (B ) Bars, asbestos 8 h. (C ) Black bars, EGF 4 h; shaded bars, EGF 30 min.

sures to asbestos or EGF. Many common and time-related changes in signaling proteins were revealed after exposures to these stimuli, several (Src, protein kinase C [PKC]␨, focal adhesion kinase [FAK], etc.) of which have been confirmed by Western blots and kinase activity assays. An 8-h exposure to asbestos fibers caused increases in Raf-1, an upstream activator of MEK1/2 and the ERK1/2 pathway, PKC␨, v-Mos Moloney murine sarcoma viral oncogene homolog 1, Janus kinase 1, hematopoietic progenitor kinase 1, G protein– coupled receptor kinase 2 (GRK2), germinal center kinase (GCK), FAK, and calmodulin-dependent kinase IV (Figure 1A). Some of these increases, e.g., Raf-1, GRK2, and GCK, persisted for 24 h. In contrast, increases in other proteins, e.g., Src and Fyn, did not appear until 24 h. Increases in proteins unique to addition of asbestos fibers and not EGF included phosphorylated PKC␨, ribosomal S6 kinase, and SYK protein tyrosine kinase (Figure 1B). Exposure to EGF caused increases in many of the same signaling proteins that were observed with asbestos (Figure


Figure 2. Increases and decreases in gene expression after microarray analysis (U74A Affymetrix chip) of asbestos-exposed C10 cells and lungs.

1C). The observation that many of the same protein expression patterns were seen with EGF at early time points (30 min and 4 h), and asbestos at later time periods (8 and 24 h) may reflect differences in solubility and dose effects by these stimuli. EGF is soluble and affects all cells immediately after its addition to cultures, whereas asbestos fibers are insoluble and require time to precipitate upon cells. Thus their effects are more protracted and localized to cells in areas of deposition of fibers. Microarray Data Show a Common Subset of Genes Altered in Asbestos-Exposed Pulmonary Epithelial Cells and Lungs after Inhalation of Asbestos After oligonucleotide microarray analysis, genes were identified that increased or decreased after in vitro or inhalation exposures to asbestos. Because of the complexity of these data, results presented in this paper are limited to genes upregulated by asbestos that are classically linked to cell signaling, epithelial cell injury and proliferation, and fibrogenesis. In these experiments, gene expression data (average difference as calculated by Affymetrix algorithms) were normalized against the control or sham groups, and the fold changes determined using GeneSpring software (Silicon Genetics, Redwood City, CA). Genes exhibiting ⬎ 1.5 fold changes or present/absent in comparison to respective controls using the Affymetrix absolute call algorithm were considered altered in expression. Figure 2 presents the comparative data from experiments in which asbestos was added for 24 h to C10 epithelial cells with lungs from inhalation experiments. Of the 12,488 genes present in the chip, 420 genes were upregulated, and 546 genes were downregulated by asbestos in vitro. In inhalation experiments analyzing whole lung tissues, 2,082 genes were upregulated and 562 downregulated after 3 d of exposure to asbestos, a time point immediately preceding peak proliferation of both distal bronchiolar and alveolar duct epithelial cells at 4 d (13). Genes Linked to Cell Signaling and Fibrogenesis Are Upregulated in Pulmonary Epithelial Cells and Lungs Exposed to Asbestos In Tables 2–5, we present the designations and ontologies of genes upregulated in C10 cells and/or in lungs after exposure to asbestos. These are categorized for presentation

S53

here as genes involved in cell signaling, transcription factors, mitogenesis- or growth-related genes, and those regulating ECM homeostasis and lung remodeling. A number of cell signaling genes were upregulated (Table 2), suggesting activation of multiple signaling pathways by asbestos and reinforcing the results of kinase screening assays. These included genes involved in G protein–coupled receptor and mitogen-activated protein kinase (MAPK) signaling, integrin-mediated signaling pathways, and cyclin-dependent kinases and their inhibitors. Other genes were linked to survival pathways (rsk, phosphatidylinositol 3-kinases) and cell surface receptor–cytokine pathways such as the urokinase plasminogen activator (uPA) receptor (uPAR), fibroblast growth factor, and transforming growth factor (TGF)-␤ pathways. Several genes encoding transcription factors linked to MAPK signaling pathways, most notably the activator protein 1 (AP-1) components, FBJ osteosarcoma oncogene (Fos), Fos-like antigen 1, and JunB, were also upregulated by asbestos (Table 3). In addition, elevated expression of genes encoding transcription factors associated with altered proliferation and cell cycle control, e.g., E2F transcription factor 3, were observed. Gene analysis also identified several growth factor– related genes encoding proteins that have been classically linked to the fibrogenic effects of asbestos or silica (6) and other models of fibrosis including connective tissue growth factor (15), insulin-like growth factor 1 (IGF-1) (16, 17), and TGF-␤1 (16, 18). (Table 4). A number of other factors associated in other organs and cell types with angiogenesis, cell cycle regulation, and proliferation, were also revealed. Table 5 shows induction by asbestos of several genes linked to cytoskeletal organization/biogenesis, ECM regulation, and lung remodeling. Many of these, e.g., metalloproteinases (19), integrins (20), and the plasminogen-related group of genes (21–24), have been linked to the processes of fibrogenesis and repair, whereas other factors such as protein tyrosine phosphatases, serine proteases, plectin, and hydrolases need further characterization in lung. Table 6 shows genes upregulated by asbestos in C10 cells that are linked to the prevention or development of apoptosis (bcl, caspase 14), inflammation (GRO1 oncogene, phospholipase A2), and antioxidant responses (CuZn-SOD). These changes are consistent with previously published observations showing that asbestos induces apoptosis through mitochondrial pathways (25) and oxidative stress (26). Moreover, asbestos-induced inflammation and fibrosis in a rodent inhalation model can be ameliorated by administration of antioxidants (27). Real-Time Q-PCR and Microarray Analysis Show Similar Trends of Expression for Selected Genes in Asbestos-Treated C10 Cells Table 7 presents the fold increases in expression of three genes (junB, fra-1, fos) associated with AP-1 activation, a known regulator of cell proliferation and responses to toxicants in the lung (28), and cd44, a gene recently linked to the resolution of inflammation after exposures to bleomycin (29), after comparative analysis using microarrays and RealTime Q-PCR in C10 cells. The Real Time Q-PCR results validate the trends found after analysis of microarray data.

S54


TABLE 2

Cell signaling genes upregulated by asbestos in murine pulmonary epithelial cells exposed to asbestos for 24 h or murine lungs after inhalation of asbestos for 3 d* GB Accession No.

Gene Name

Ontology

AV374010 M70642 U28656 U43320 X79003 X69902 AV093331 AI852849 X59769 AF022889 AI849601 AI848471 AI846668 U20238 M24086 AV337065 AF015260 M87321 AV259885

Bone morphogenetic protein 2 Connective tissue growth factor Translation initiation factor 4E binding protein 1 Frizzled homolog 7 (Drosophila) Integrin ␣ 5 (fibronectin receptor ␣) Integrin ␣ 6* Integrin ␣ 7 Integrin ␤ 1 binding protein 1 Interleukin 1 receptor, type II* Latent TGF ␤ binding protein (LTBP-1)* Potassium channel, subfamily K, member 2 Protein tyrosine phosphatase, receptor-type, F Ras homolog A2 RAS p21 protein activator 3* Retinal S-antigen Signal-induced proliferation associated gene 1 Smad7* Teratocarcinoma-derived growth factor Vav2 oncogene

Cytokine|TGF-␤ receptor signaling pathway FGF receptor signaling pathway Translation initiation factor G-protein coupled receptor signaling pathway Integrin-mediated signaling pathway Integrin-mediated signaling pathway Integrin-mediated signaling pathway Intracellular signaling cascade Cell surface receptor linked signal transduction Calcium ion binding G-protein coupled receptor signaling pathway Transmembrane receptor signaling pathway Rho protein signal transduction GTPase activator Sensory perception|calcium ion binding GTPase activator Regulation of transcription Growth factor|activation of MAPK Intracellular signaling cascade

AA204265 U51866 X75888 X74145 AW049716 U09507 U07634 U22324 M64689 M21673 U15159 AF039840 AV352346 U88984 AW121773 D12619 L39017 M28489 AF068748 AB000828 X62700 D30743

B lymphoid kinase Casein kinase II, ␣ 1 related sequence 4 Cyclin E1 Cyclin-dependent kinase 7 Cyclin-dependent kinase inhibitor 1A (P21) Cyclin-dependent kinase inhibitor 1A (P21)* Eph receptor A2 Fibroblast growth factor receptor 1* FMS-like tyrosine kinase 3* LH8-1 LIM-domain containing, protein kinase MAP kinase-activated protein kinase 5 Mitogen activated protein KKK 11 Mitogen-activated protein KKKK 4 Phosphatidylinositol 3-kinase, catalytic Proprotein convertase subtilisin/kexin type 5* Protein C receptor, endothelial Ribosomal protein S6 kinase polypeptide 1 Sphingosine kinase 1 TYRO3 protein tyrosine kinase 3 Urokinase plasminogen activator receptor Wee 1 homolog

KINASES

Discussion Although the pathogenesis of pulmonary fibrosis is complex and incompletely understood, evidence suggests at least two critical routes influence its development, an inflammationlinked pathway and an epithelial cell pathway involving cross-talk with inflammatory and mesenchymal cells (3). Both routes trigger a number of chemokines/growth factors that induce fibroblast migration/proliferation, phenotypic changes to myofibroblasts, and subsequent accumulation of ECM. In this study, we provide new information on early epithelial responses to the fibrogenic mineral, asbestos, using transcriptional profiling and kinase screening on murine epithelial cells in culture (C10). We also analyzed global gene expression in mouse lungs after acute inhalation of

Transferase|protein tyrosine kinase Transferase|protein serine/threonine kinase Nucleus|cell cycle Kinase|nucleus|transferase Kinase|nucleus|cell cycle arrest Membrane|transferase|tyrosine kinase Transferase|protein tyrosine kinase| Membrane|transferase|protein tyrosine kinase Membrane|transferase|protein tyrosine kinase Transferase|protein serine/threonine kinase Transferase|protein serine/threonine kinase Transferase|protein serine/threonine kinase Kinase|transferase Membrane|hydrolase|protein tyrosine kinase Cyclin-dependent protein kinase, regulator Transferase|protein serine/threonine kinase Kinase Transferase|protein tyrosine kinase Cell surface receptor linked signal transduction Mitosis|nucleus|transferase|protein kinase

asbestos fibers. These complementary approaches provide hypothetical models of cell signaling events that can be tested using transfection techniques in vitro and transgenic mouse models using constructs to disrupt these pathways and target them to lung epithelium. Figure 3 shows a diagram of asbestos-induced signaling events that is compiled from our past knowledge regarding the importance of the EGFR and ERK1/2 pathways in asbestos-associated cell injury and proliferation (14, 30–34) and new data from transcriptional and kinase profiling studies in C10 cells. The fact that asbestos fibers can activate the EGFR (30, 32, 35) and integrin-associated receptors (26), as well as calcium-mediated signaling pathways (36, 37) and PKCs (38–40), all of which activate the ERK1/2


S55

TABLE 3

Transcription factor genes upregulated by asbestos in murine pulmonary epithelial cells exposed to asbestos for 24 h or murine lungs after inhalation of asbestos for 3 d* GB Accession No.

M37890 D50418 AF041847 AF015948 V00727 AF017128 X58250 X99915 AV279579 S78454

Gene Name

Androgen receptor AREC3* Cardiac ankyrin repeat protein MCARP E2F transcription factor 3 FBJ osteosarcoma oncogene* Fos-like antigen 1 H2.0-like homeo box gene* High mobility group protein I, isoform C Homeo box A4 Metal response element binding transcription factor 2* Nuclear matrix attachment DNA-binding protein SATB1** Nuclear receptor subfamily 6, group A, member 1 Polyomavirus enhancer activator 3 TG interacting factor Transcription factor GIF* Transcription factor junB (junB) gene, 5 region Transcription factor like protein 4 TCFL4

U05252 U09563 X63190 X89749 AF064088 U20735 U43548

cascade, suggests that blocking these events downstream is critical to modulating epithelial cell proliferation. This hypothesis is presently being tested in our laboratory using CC10-dnMEK1 transgenic mice and transgene-negative littermates exposed to asbestos fibers. The fact that asbestos induces many cell-signaling pathways, transcription factors, and growth-related genes in epithelium and lung points to the complexity of these factors in the induction of fibrogenesis. Crosstalk between growth factor pathways may also be critical in determining fibro-

genic versus repair responses. For example, like EGF, TGF-␣ also binds to the EGFR, and mice overexpressing TGF-␣ targeted to lung epithelium using the CC10 promoter develop pulmonary fibrosis (41). If TGF-␣ induces proliferation, like EGF, in lung epithelial cells, this observation is incongruous with the view that epithelial cell regeneration is thought to be a vital repair mechanism in fibrosis (42). Tumor necrosis factor (TNF)-␣–induced fibrogenesis may be mediated by a secondary upregulation of TGF-␤1, excessive ECM deposition, and development/proliferation of pulmonary myofibroblasts (43). These observations are consistent with studies showing that inbred mice strains failing to develop fibroproliferative lesions after inhalation of asbestos have diminished expression of both TNF-␣ and TGF-␤1 in their lungs (44). Both TGF-␤1 and latent TGF-␤1 (L-TGF-␤1) were increased in C10 epitheial cells and whole lungs exposed to asbestos in our studies, indicating the epithelial cell as a critically early source of this fibrogenic cytokine. TGF-␤1 also induces expression of IGF-1 and CTGF, both of which were increased in C10 cells after exposure to asbestos (15). In addition to its role as a potent mitogenic polypeptide, IGF-1 is antiapoptotic to fibroblasts, thus inducing fibroblast proliferation and transcription of collagen and laminin genes (45). Constitutive and TGF-␤1–induced expression of IGF-1 is higher in fibroblasts from fibrotic lungs, and levels of IGF-1 are higher in patients with pulmonary fibrosis. The fact that increased fibrosis can be inhibited by antibodies to IGF-1 is encouraging (16). Our studies also reveal the potential importance of CTGF production, whose overexpression has been confirmed as important in fibrosis (15), by lung epithelial cells. In fibroblasts, CTGF expression is induced by TGF-␤. TGF-␤1 and CTGF are coordinately overexpressed during wound repair in a rat model of wound healing, a process that requires both fibroblast proliferation and ECM deposition (45)

TABLE 4

Growth factor–related genes upregulated by asbestos in murine pulmonary epithelial cells exposed to asbestos for 24 h or murine lungs after inhalation of asbestos for 3 d* GB Accession No.

AV374010 M70642 X75888 X74145 AW049716 U09507 M34896 D30782 U22324 J04596 X04480 M21673 M17298 K03235 AI846668 M87321 AJ009862 AV259885

Gene Name

Bone morphogenetic protein 2 Connective tissue growth factor Cyclin E1 Cyclin-dependent kinase 7 Cyclin-dependent kinase inhibitor 1A (P21) Cyclin-dependent kinase inhibitor 1A (P21)* Ecotropic viral integration site 2* Epiregulin Fibroblast growth factor receptor 1 GRO1 oncogene Insulin-like growth factor 1 LH8-1 Nerve growth factor, beta Proliferin 2 Ras homolog A2 Teratocarcinoma-derived growth factor Transforming growth factor, ␤ 1* Vav2 oncogene

Ontology

Cytokine|organogenesis|growth factor Angiogenesis|ossification|cell migration Nucleus|cell cycle Nucleus|transferase|cyclin-dependent kinase Nucleus|cell cycle arrest Integral membrane protein|cell growth Growth factor|cell proliferation Protein kinase|fibroblast growth factor receptor Cytokine|growth factor Growth factor|peptide hormone Regulation of cell cycle Hormone Cell growth and/or maintenance Growth factor|activation of MAPK|proliferation Necrosis|myogenesis|TGF ␤ receptor ligand Regulation of cell cycle

S56


TABLE 5

Remodeling and fibrin turnover–related genes upregulated by asbestos in murine pulmonary epithelial cells exposed to asbestos for 24 h or murine lungs after inhalation of asbestos for 3 d* GB Accession No.

AA726223 AA726223 M12481 J04181 X66084 M70642 X79003 X69902 AV093331 U10091/94 AV236263 X66473 X66402 AW121179 AI505453 AV02820 M33960 AW123286 AV318045 D31842 AI848471 X16490 AW259940 Y13185 AJ009862 M13443 X62700

Gene Name

Ontology

A disintegrin and metalloproteinase domain A disintegrin and metalloproteinase domain 19 Actin, ␤, cytoplasmic* A-X actin CD44 antigen Connective tissue growth factor Integrin ␣ 5 (fibronectin receptor alpha) Integrin ␣ 6* Integrin ␣ 7 Killer cell lectin-like receptor, subfamily A* Laminin, ␣ 5 Matrix metalloproteinase 13 Matrix metalloproteinase 3* Microfibrillar associated protein 5 Myosin heavy chain IX Plasminogen Plasminogen activator inhibitor (PAI-1) Plectin 1 Poliovirus receptor-related 3 Protein tyrosine phosphatase, non-receptor type 14 Protein tyrosine phosphatase, receptor-type, F Serine (or cysteine) proteinase inhibitor, clade B Serine protease inhibitor 12 Stromelysin-2, matrix metalloproteinase 10 Transforming growth factor, ␤ 1 Tubulin, ␣ 7 Urokinase plasminogen activator receptor

Hydrolase|metallopeptidase Hydrolase|metallopeptidase Cytoskeleton organization and biogenesis Cytoskeleton organization and biogenesis Cell adhesion receptor|hyaluronic acid binding Cell adhesion Integrin|cell adhesion receptor Integrin|ce|cell adhesion receptor Integrin|ce|cell adhesion receptor Lectin|cell adhesion|sugar binding Cell adhesion|extracellular matrix Hydrolase|metallopeptidase|extracellular matrix Hydrolase|metallopeptidase|extracellular matrix Microfibril|extracellular matrix Cytoskeleton organization and biogenesis Plasmin|serine-type endopeptidase Plasminogen activator|serine protease inhibitor Cytoskeleton|actin binding Cell-cell adherens junction Cytoskeleton|protein tyrosine phosphatase Hydrolase|cell adhesion Plasminogen activator|serine protease inhibitor Serpin|serine protease inhibitor Hydrolase|extracellular|metallopeptidase Necrosis|defense response|regulation of proliferation GTP binding|microtubule-based process Cell surface receptor linked signal transduction

Abnormal matrix deposition and lung remodeling are fundamental features of fibrosis, and the many genes increased in expression by asbestos (Table 5) illustrate the complexity of these processes. Increased expression of many of these gene products such as fibronectin and integrins governing activation of TGF-␤1, laminin, and ligation of fibrin and fibrinogens have been related to fibrosis (20). Other proteins, such as CD44, play an important role in resolving lung inflammation and removal of ECM breakdown products (29). A rapidly evolving field has elucidated mechanisms by which fibrin turnover is altered in lung injury, fibrosis, and

neoplasia. Tissue factor expression is increased in the lung, initiating coagulation and movement of coagulation substrates into the injured alveolar space, and potentiating thrombin generation and fibrin formation. Locally depressed fibrinolysis attributable to inhibition of plasminogen activator (PAI-1) often occurs concomitantly with increased procoagulant activity and promotes local fibrin deposition (46). Mice with deletion of the PAI-1 gene develop less fibrosis, and those constitutively overexpressing a PAI-1 transgene develop more fibrosis after exposure to bleomycin (47). We have shown previously that asbestos induces complex

TABLE 6

Genes upregulated by asbestos in murine pulmonary epithelial cells exposed to asbestos for 24 h or murine lungs after inhalation of asbestos for 3 d* linked to the development of apoptosis, inflammation and oxidative stress GB Accession No.

AV102186 U88990 AF092997 J04596 M57958 AJ009862 AV174603 M35725 M88242

Gene Name

Ontology

Bcl-associated death promoter Baculoviral IAP repeat-containing 4 Caspase 14 GRO1 oncogene Phospholipase A2, activating protein Transforming growth factor, ␤ 1* Copper chaperone for superoxide dismutase Cu-Zn superoxide dismutase Prostaglandin-endoperoxide synthase 2

Apoptosis regulator Apoptosis inhibitor Induction of apoptosis Cytokine|inflammatory response Inflammatory response|phospholipase A2 activator Defense response|inflammatory Chaperone|heavy metal binding|superoxide Antioxidant Peroxidase|oxidoreductase|peroxidase


S57

TABLE 7

Comparison of microarray and Taqman results for four different genes GB Accession No.

Gene Name

U20735

junB

AF017128

fra-1

V00727

FBJ osteosarcoma oncogene (fos) cd44

X66084

Method

C10

Asb

Taqman Microarray Taqman Microarray Taqman Microarray Taqman Microarray

1 1 1 1 1 1 1 1

2 2 6 8 5 3 2 5

* Fold changes in microarray data are calculated with normalized values against untreated C10s. Fold changes in Taqman data are calculated from normalized ratios (gene expression/hprt expression).

processes, and substantial effort will be required to describe the functional consequences of changes in gene expression in specific cell types, and how these influence the events that culminate in fibrosis. For example, induction of the antiproliferative cyclin-dependent kinase inhibitor p21 in response to asbestos is not likely to occur in the same cells that express cyclin E1, which is linked directly to cell proliferation (Table 4). In conclusion, transcriptional and protein profiling, especially to elucidate gene products that are post-transcriptionally regulated, provide sensitive tools for revealing new candidates for modulation of epithelial cell participation in fibrosis. These approaches and data confirmation using Real Time –Q-PCR, Western analyses, and kinase activity assays, provide information on pathways to be targeted for prevention of epithelial cell injury and fibrosis. Acknowledgments: This section was supported by grants ES/HL09213 (BTM) and PO1 HL67004 (BTM) from the National Institutes of Health.

changes in the fibrinolytic cascade, including induction of urokinase plasminogen activator (uPA) and its receptor (uPAR) (48). Mice deficient in uPA or tPA also demonstrate increased pulmonary fibrosis after bleomycin-induced lung injury (46). These studies suggest complex interrelationships between these pathways and mitogenesis of fibroblasts versus epithelial cells. Gene expression profiles in mice exposed to asbestos were far more complicated than those observed with type II cells in vitro. We expect that this outcome is a result of the complex series of events that occur by 3 d of exposure in mice; by this time epithelial cell injury, immune responses, and even compensatory proliferation are evident at focal sites. No doubt many cell types participate in these

References 1. Selman, M., T. King, and A. Pardo. 2001. Idiopathic pulmonary fibrosis: prevailing and evolving hypotheses about its pathogenesis and implications for therapy. Ann. Intern. Med. 134:136–151. 2. Crystal, R., P. Bitterman, B. Mossman, M. Schwarz, D. Sheppard, L. Almasy, H. Chapman, S. Friedman, T. King, L. Leinwand, L. Liotta, G. Martin, D. Schwartz, G. Schultz, C. Wagner, and R. Musson. 2002. Future research directions in idiopathic pulmonary fibrosis: summary of a National Heart, Lung, and Blood Institute working group. Am. J. Respir. Crit. Care Med. 166:236–246. 3. Pardo, A., and M. Selman. 2002. Molecular mechanisms of pulmonary fibrosis. Front. Biosci. 7:d1743–d1761. 4. Smith, R., R. Strieter, S. Phan, and S. Kunkel. 1996. C-C chemokines: novel mediators of the profibrotic inflammatory response to bleomycin challenge. Am. J. Respir. Cell Mol. Biol. 15:693–702. 5. Hagimoto, N., K. Kuwano, Y. Nomoto, R. Kunitake, and N. Hara. 1997.

Figure 3. Model showing kinases induced by asbestos as revealed by kinase screening (Kinexus). Novel upregulated kinases and their crosstalk with the ERK1/2 pathway are indicated by the dark gray boxes.

S58

6. 7. 8. 9. 10. 11. 12. 13.

14.

15.

16.

17.

18. 19.

20.

21.

22.

23.

24.

25.

26.

27.


Apoptosis and expression of Fas/Fas ligand mRNA in bleomycin-induced pulmonary fibrosis in mice. Am. J. Respir. Cell Mol. Biol. 16:91–101. Mossman, B., and A. Churg. 1998. Mechanisms in the pathogenesis of asbestosis and silicosis. Am. J. Respir. Crit. Care Med. 157:1666–1680. Cottin, V. 2002. Treatment of pulmonary fibrosis. Presse Med. 31:1613–1623. Selman, M., and A. Pardo. 2002. Idiopathic pulmonary fibrosis: an epithelial/ fibroblastic cross-talk disorder. Respir. Res. 3:3 Das, K., and C. White. 1997. Activation of NF-kB by antineoplastic agents. J. Biol. Chem. 272:14914–14920. Li, Q., P. W. Park, C. L. Wilson, and W. C. Parks. 2002. Matrilysin shedding of syndecan-1 regulates chemokine mobilization and transepithelial efflux of neutrophils in acute lung injury. Cell 111:635–646. Sternlicht, M. D., and Z. Werb. 2001. How matrix metalloproteinases regulate cell behavior. Annu. Rev. Cell Dev. Biol. 17:463–516. Malkinson, A., L. Dwyer-Nield, P. Rice, and D. Dinsdale. 1997. Mouse lung epithelial cell lines—tools for the study of differentiation and the neoplastic phenotype. Toxicology 123:53–100. Manning, C., A. Cummins, M. Jung, I. Berlanger, C. Timblin, C. Palmer, D. Taatjes, D. Hemenway, P. Vacek, and B. Mossman. 2002. A mutant epidermal growth factor receptor targeted to lung epithelium inhibits asbestos-induced proliferation and proto-oncogene expression. Cancer Res. 62:4169–4175. Buder-Hoffmann, S., C. Palmer, P. Vacek, D. Taatjes, and B. Mossman. 2001. Different accumulation of activated extracellular signal-regulated kinases (ERK 1/2) and role in cell-cycle alterations by epidermal growth factor, hydrogen peroxide, or asbestos in pulmonary epithelial cells. Am. J. Respir. Cell Mol. Biol. 24:405–413. Allen, J. T., R. A. Knight, C. A. Bloor, and M. A. Spiteri. 1999. Enhanced insulin-like growth factor binding protein-related protein 2 (connective tissue growth factor) expression in patients with idiopathic pulmonary fibrosis and pulmonary sarcoidosis. Am. J. Respir. Cell Mol. Biol. 21:693– 700. Allen, J. T., C. A. Bloor, R. A. Knight, and M. A. Spiteri. 1998. Expression of insulin-like growth factor binding proteins in bronchoalveolar lavage fluid of patients with pulmonary sarcoidosis. Am. J. Respir. Cell Mol. Biol. 19:250–258. Allen, J. T., C. A. Bloor, R. K. Kedia, R. A. Knight, and M. A. Spiteri. 2000. Expression of growth hormone-releasing factor, growth hormone, insulinlike growth factor-1 and its binding proteins in human lung. Neuropeptides 34:98–107. Vassalli, J. D., A. P. Sappino, and D. Belin. 1991. The plasminogen activator/ plasmin system. J. Clin. Invest. 88:1067–1072. Bini, A., D. Wu, J. Schnuer, and B. J. Kudryk. 1999. Characterization of stromelysin 1 (MMP-3), matrilysin (MMP-7), and membrane type 1 matrix metalloproteinase (MT1-MMP) derived fibrin(ogen) fragments D-dimer and D-like monomer: NH2-terminal sequences of late-stage digest fragments. Biochemistry 38:13928–13936. Kaminski, N., J. D. Allard, J. F. Pittet, F. Zuo, M. J. Griffiths, D. Morris, X. Huang, D. Sheppard, and R. A. Heller. 2000. Global analysis of gene expression in pulmonary fibrosis reveals distinct programs regulating lung inflammation and fibrosis. Proc. Natl. Acad. Sci. USA 97:1778–1783. Gross, T. J., S. M. Cobb, D. C. Gruenert, and M. W. Peterson. 1993. Asbestos exposure increases human bronchial epithelial cell fibrinolytic activity. Am. J. Physiol. 264:L276–L283. Perkins, R., V. Broaddus, S. Shetty, S. Hamilton, and S. Idell. 1999. Asbestos upregulates expression of the urokinase-type plasminogen activator receptor on mesothelial cells. Am. J. Respir. Cell Mol. Biol. 21:637–646. Barchowsky, A., R. R. Roussel, R. J. Krieser, B. T. Mossman, and M. D. Treadwell. 1998. Expression and activity of urokinase and its receptor in endothelial and pulmonary epithelial cells exposed to asbestos. Toxicol. Appl. Pharmacol. 152:388–396. Lardot, C. G., F. A. Huaux, F. R. Broeckaert, P. J. Declerck, M. Delos, B. Fubini, and D. F. Lison. 1998. Role of urokinase in the fibrogenic response of the lung to mineral particles. Am. J. Respir. Crit. Care Med. 157:617– 628. Kamp, D., V. Panduri, S. Weitzman, and N. Chandel. 2002. Asbestos-induced alveolar epithelial cell apoptosis: role of mitochondrial dysfunction caused by iron-derived free radicals. Mol. Cell. Biochem. 234–235:153–160. Broaddus, V., L. Yang, L. Scavo, J. Ernst, and A. Boylan. 1996. Asbestos induces apoptosis of human and rabbit pleural mesothelial cells via reactive oxygen species. J. Clin. Invest. 98:2050–2059. Mossman, B. T. 1990. In vitro studies on the biologic effects of fibers: correlation with in vivo bioassays. Environ. Health Perspect. 88:319–322.

28. Reddy, S., and B. Mossman. 2002. Role and regulation of activator protein-1 (AP-1) in toxicant-induced responses of the lung. Am. J. Physiol. (Lung Cell Mol. Physiol.) 283:L1161–L1178. 29. Teder, P., R. Vandivier, D. Jiang, J. Liang, L. Cohn, E. Pure, P. Henson, and P. Noble. 2002. Resolution of lung inflammation by CD44. Science 296:155–158. 30. Zanella, C., J. Posada, T. Tritton, and B. Mossman. 1996. Asbestos causes stimulation of the ERK-1 mitogen-activated protein kinase cascade after phosphorylation of the epidermal growth factor receptor. Cancer Res. 56:5334–5338. 31. Jimenez, L., C. Zanella, H. Fung, Y. Janssen, P. Vacek, C. Charland, J. Goldberg, and B. Mossman. 1997. Role of extracellular signal-regulated protein kinases in apoptosis by asbestos and H2O2. Am. J. Physiol. (Lung Cell Mol. Physiol.) 273:L1029–L1035. 32. Pache, J., Y. Janssen, E. Walsh, T. Quinlan, C. Zanella, R. Low, D. Taatjes, and B. Mossman. 1998. Increased epidermal growth factor-receptor (EGF-R) protein in a human mesothelial cell line in response to long asbestos fibers. Am. J. Pathol. 152:333–340. 33. Zanella, C., C. Timblin, A. Cummins, M. Jung, J. Goldberg, R. Raabe, T. Tritton, and B. T. Mossman. 1999. Asbestos-induced phosphorylation of epidermal growth factor receptor is linked to c-fos expression and apoptosis. Am. J. Physiol. (Lung Cell Mol. Physiol.) 277:L684–L693. 34. Robledo, R., S. Buder-Hoffmann, A. Cummins, E. Walsh, D. Taatjes, and B. Mossman. 2000. Increased phosphorylated ERK immunoreactivity associated with proliferative and morphologic lung alterations following chrysotile asbestos inhalation in mice. Am. J. Pathol. 156:1307–1316. 35. Zanella, C., C. Timblin, A. Cummins, M. Jung, J. Goldberg, R. Raabe, T. Tritton, and B. Mossman. 1999. Asbestos-induced phosphorylation of epidermal growth factor receptor is linked to c-fos expression and apoptosis. Am. J. Physiol. (Lung Cell Mol. Physiol.) 277:L684–L693. 36. Tuomala, M., M. R. Hirvonen, and K. M. Savolainen. 1993. Changes in free intracellular calcium and production of reactive oxygen metabolites in human leukocytes by soluble and particulate stimuli. Toxicology 80:71–82. 37. Ruotsalainen, M., J. Naarala, and K. M. Savolainen. 1995. Mineral fiberinduced leukocyte activation: the role of intra- and extracellular calcium. Toxicol. Lett. 78:195–205. 38. Fung, H., T. R. Quinlan, Y. M. Janssen, C. R. Timblin, J. P. Marsh, N. H. Heintz, D. J. Taatjes, P. Vacek, S. Jaken, and B. T. Mossman. 1997. Inhibition of protein kinase C prevents asbestos-induced c-fos and c-jun proto-oncogene expression in mesothelial cells. Cancer Res. 57:3101–3105. 39. Perderiset, M., J. P. Marsh, and B. T. Mossman. 1991. Activation of protein kinase C by crocidolite asbestos in hamster tracheal epithelial cells. Carcinogenesis 12:1499–1502. 40. Lounsbury, K. M., M. Stern, D. Taatjes, S. Jaken, and B. T. Mossman. 2002. Increased localization and substrate activation of protein kinase C delta in lung epithelial cells following exposure to asbestos. Am. J. Pathol. 160:1991–2000. 41. Hardy, J., and A. Aust. 1995. The effect of iron binding on the ability of crocidolite asbestos to catalyze DNA single-strand breaks. Carcinogenesis 16:319–325. 42. Adamson, I., and D. Bowden. 1987. Response of mouse lung to crocidolite asbestos. 2. Pulmonary fibrosis after long fibres. J. Pathol. 152:109–117. 43. Sime, P. J., R. A. Marr, D. Gauldie, Z. Xing, B. R. Hewlett, F. L. Graham, and J. Gauldie. 1998. Transfer of tumor necrosis factor-alpha to rat lung induces severe pulmonary inflammation and patchy interstitial fibrogenesis with induction of transforming growth factor-beta1 and myofibroblasts. Am. J. Pathol. 153:825–832. 44. Brass, D., G. Hoyle, H. Poovey, J. Liu, and A. Brody. 1999. Reduced tumor necrosis factor-alpha and transforming growth factor-beta1 expression in the lungs of inbred mice that fail to develop fibroproliferative lesions consequent to asbestos exposure. Am. J. Pathol. 154:853–862. 45. Allen, J. T., and M. A. Spiteri. 2002. Growth factors in idiopathic pulmonary fibrosis: relative roles. Respir. Res. 3:13–21. 46. Idell, S., A. P. Mazar, P. Bitterman, S. Mohla, and A. L. Harabin. 2001. Fibrin turnover in lung inflammation and neoplasia. Am. J. Respir. Crit. Care Med. 163:578–584. 47. Eitzman, D. T., R. D. McCoy, X. Zheng, W. P. Fay, T. Shen, D. Ginsburg, and R. H. Simon. 1996. Bleomycin-induced pulmonary fibrosis in transgenic mice that either lack or overexpress the murine plasminogen activator inhibitor-1 gene. J. Clin. Invest. 97:232–237. 48. Barchowsky, A., R. Roussel, R. Krieser, B. Mossman, and M. Treadwell. 1998. Expression and activity of urokinase and its receptor in endothelial and pulmonary epithelial cells exposed to asbestos. Toxicol. Appl. Pharmacol. 152:388–396.


S59

The Importance of Sarcoidosis Genotype to Lung Phenotype A genetic predisposition to sarcoidosis is becoming more evident. A recent family study in the United Kingdom has identified a risk ratio (␭s) value for siblings of familial sarcoidosis of 36–73, indicating significant familial clustering of the disease, and the biggest case-control study on sarcoidosis from the United States (A Case Control Etiologic Study of Sarcoidosis) showed an odds ratio of 5.8 in siblings, 5.7 in avuncular relationships, 5.2 in grandparents, and 3.8 in parents (1, 2). Genetic studies of sarcoidosis are becoming more prevalent. Two broad categories of studies have been reported: those involving the major histocompatibility complex (MHC), and those targeting non-MHC regions. MHC genes so far studied include the human leukocyte antigens (HLA) Class I ⫹ II genes, transporter associated with antigenprocessing (TAP) genes, and tumor necrosis factor (TNF) (3–5). These studies, and a genome–wide search for predisposing genes in German sarcoidosis families (6), have provided inescapable evidence for a susceptibility locus for sarcoidosis somewhere in the MHC region of chromosome 6. Moreover, a number of non-MHC–related gene studies has provided evidence for other genes contributing to sarcoidosis susceptibility, including chemokine receptor (CCR) 2, CCR5, interleukin (IL)-1␣, and most recently complement receptor (CR) 1 (7–10). However, many studies focusing on other candidate genes have shown negative results or conflicting data. One of the most extensively investigated genes in this respect is angiotensin-converting enzyme (ACE). Most studies find no differences in the presence or absence of a 287–base pair insertion (I) or deletion (D) sequence in comparisons of patients with sarcoidosis and control subjects. In a study of African Americans, however, an increased frequency of the D-allele was found. Global data, however, would suggest that this gene in isolation confers little susceptibility to sarcoidosis or its severity (11).

HLA-DR and -DQ in Sarcoidosis As the initiation of sarcoidosis is thought to begin with the presentation of an as yet unknown antigen by dendritic cells or macrophages, the HLA Class II genes are of particular interest for the pathogenesis of sarcoidosis. HLA molecules bind antigenic peptides within a groove formed by two ␣-helices and a floor of antiparallel ␤-strands. These peptides are derived from unknown antigenic proteins that have been phagocytosed or internalized by endocytosis. The resulting antigen-bearing phagosomes or endosomes are fused with lysosomes, and the proteins are degraded into peptides that are loaded onto HLA Class II molecules with the assistance of HLA-DM molecules (12). The resulting MHC–peptide complexes are transported to the cell surface on antigen-presenting cells and subsequently recognized by

This section was written by Jan C. Grutters, Hiroe Sato, Kenneth I. Welsh, and Roland M. du Bois (Clinical Genomics Group, Imperial College of Science, Technology and Medicine, National Heart and Lung Institute & Royal Brompton Hospital, London, United Kingdom).

␣/␤⫹ T cell receptor (TCR)-expressing lymphocytes (13). Provided that costimulatory molecules deliver a second signal for T cell activation, the triggering of the ␣/␤ TCR complex subsequently leads to the upregulation of genes involved in a T helper (Th) 1 type cellular immune response, resulting in granuloma formation. Although some studies have reported associations between sarcoidosis and HLA Class I, Class II associations have been reported most frequently. The majority of these associations are found with HLA-DR and -DQ. Importantly, these reported associations tend to be with either disease susceptibility/chronicity or with a milder disease phenotype. Susceptibility/chronicity-related DR associations have been found in Japanese patients with sarcoidosis (HLADR5 [DRB1*11], -DR6 [DRB1*14], and -DR8 [DRB1*08]), in German patients (HLA-DR5), and in patients from Sweden (HLA-DR14 and DR15) (14–17). DQ susceptibility associations have been found in Japan (DQB1*0601), Sweden (DQB1*0201/0202), and Germany (DQB1*0603 and *0604) (17–19). DR associations with milder disease mainly involve DR3, and are reported for patients with a Swedish background (HLA-DR3 [17]), and also Polish patients (HLA-DRB1*03 and DRB3*0101) (17, 20).

DR Profiling One of the earlier studies to highlight the dichotomy between alleles that confer likely chronicity or resolution was reported by Berlin and colleagues (17). They showed strong DR associations with two disease phenotypes: a susceptibility/chronicity phenotype and a milder disease phenotype. They investigated 122 Scandinavian patients with sarcoidosis and 250 healthy volunteers from the same ethnic background. All were typed genomically for HLA-DR, -DQA1, and -DQB1 alleles. The results showed that 33% of patients with nonchronic sarcoidosis, i.e., those who recovered within 2 yr, were HLA-DR3 (17)-positive by comparison with 17% of control subjects, whereas patients with chronic sarcoidosis had significantly increased frequencies of DR14 (18% compared with 6% in control subjects) and DR15 (60% compared with 30% in control subjects) (17). Recently, Foley and coworkers determined HLA-DRB1 alleles in three cohorts of white patients with sarcoidosis from the United Kingdom (n ⫽ 189), Poland (n ⫽ 87), and Czech Republic (n ⫽ 69), and confirmed the associations found between HLA-DRB1*14(DR14) and -DRB1*15 (DR15) and sarcoidosis susceptibility in all populations (3). In addition, HLA-DRB1*3(DR3) carrier frequency was found to be increased in Czech patients with sarcoidosis, and -DRB1*12(DR12) in British patients. Furthermore, they showed that another HLA-DRB1 allele, DRB1*01 (DR1), was consistently protective for sarcoidosis in all three populations, and also consistent with results from previously published Scandinavian, Italian, and Japanese case–control studies. Furthermore, the carrier frequency of HLA-DRB1*04(DR4) was found to be significantly re-

S60


duced in British patients, suggesting an additional protective allele for sarcoidosis, which is also consistent with results previously published for Scandinavian, Italian, and Japanese sarcoidosis. From these studies, covering six populations, therefore, a DR profile emerges; i.e., DR1 and DR4 can be classified as “protective alleles,” and DR3, DR12, DR14, and DR15 as “susceptible” alleles. The finding that certain HLA-DR alleles act as protective markers for sarcoidosis in a number of populations from different background suggests importantly that this protective effect is independent of ethnic or geographic background. When HLA-DRB1 allele protein sequences were compared to identify shared residues forming pockets within the peptide-binding groove of the HLA-DR complex, remarkably, all alleles identified as being protective for sarcoidosis, encoding DR1 and DR4 antigens, were found to share small hydrophobic residues at position 11. By contrast, the susceptibility alleles did not share these hydrophobic residues, but instead had a hydrophilic residue at this position. The residue at position 11 is within a pocket of the HLA-DR complex antigen-binding groove (designated P6), where it is the only variable amino acid and may determine the peptide binding preference of this pocket (3). The findings imply that specific peptide binding is determined by amino acid sequences in the binding groove, and that variability in this binding may be important in initiating sarcoidosis. The basis for this protective effect of hydrophobic residues at HLA-DRB1 position 11 in sarcoidosis is, however, unknown at this time, but the alterations in the number of H2O molecules in P6 might be of relevance, as these might influence the strength of the MHC binding of the potentially sarcoid-triggering peptide(s). Other important data have emerged from the multicenter ACCESS study, which has recently reported the findings on HLA typing at recent international meetings. High-resolution HLA typing was performed for HLA-DPB1, -DQB1, -DRB1, and -DRB3, and low-resolution typing for HLADRB4 and -DRB5 to explore possible HLA associations with sarcoidosis. This study comprised the biggest sarcoidosis cohort typed for HLA to date, including 474 patients and matched control subjects. The results showed that HLADRB1*1101 was significantly associated with sarcoidosis in both African Americans and in whites, again confirming a genetic predisposition to sarcoidosis, and again identifying the HLA-DRB1 locus as a major locus for disease susceptibility in this disease. Importantly, this study confirmed HLADRB1*1501(DR15) and *1201(DR12) as being susceptibility alleles, and HLA-DRB1*04(DR4) as a protective allele. A summary of the susceptibility and protective alleles is shown in Table 1.

TABLE 1

Susceptibility and protective MHC locus alleles Susceptibility alleles HLA DR 3, 11, 12, 14, 15 DQB1*0602/3 TNF -857T Protective alleles HLA DRB1*0101, DQB1*0501 HLA DR 4 HLA DQB1*0201, DR 3 (17), TFN -307A haplotype mild disease less severe lung disease

relatives) was analyzed using multipoint nonparametric linkage (NPL) statistics, which is a form of linkage calculation that depends on identification of a series of polymorphic sites along a chromosome. They found the most prominent peak (six adjacent markers, including D6S1666) at the MHC Class III region, which confirmed their results of a previous familial study using only seven markers that flank and cover the same area on chromosome 6 (6, 21). Interestingly, six additional minor peaks were identified at chromosome 1, 3, 7 (2), 9, and X. The most prominent peak at the MHC has more recently been shown to be closer to the class II region, in keeping with numerous reports of associations between gene variants in this region and sarcoidosis. Interestingly, the peak at chromosome 3 is in a region (although at 8 cM distance) containing the chemokine receptor genes CCR2 and CCR5, of which polymorphisms have been associated with sarcoidosis in two populations (Czech and Japanese) (7, 8). One of two minor peaks at chromosome 7 (D7S3070) attracts attention because it is close to the T cell receptor (TCR) B gene cluster. Further, the gene encoding transforming growth factor-␤ receptor 1 (TGFBR1) is located in the area of the peak at chromosome 9. Although an interesting candidate gene in sarcoidosis, however, no significant association studies of TGFBR1 have been reported so far. Finally, the gene encoding interleukin-2 receptor (IL-2R) ␥ chain (IL2RG) is located close to the chromosome X peak. Despite the limitations of this study, especially the lowdensity screen, likely causing insufficient resolution to identify all markers of interest, it provides very useful information for those involved in sarcoidosis genetic research and should encourage further fine mapping of the areas identified.

Sarcoidosis: Concepts of Severity Genome-Wide Screen for Candidate Genes Schu¨rmann and colleagues have performed a genome-wide search for predisposing genes in sarcoidosis. They used microsatellite linkage analysis to identify chromosomal regions that contribute to the risk of sarcoidosis. The investigators chose 225 microsatellite markers, covering the whole of the genome, but with an average spacing as high as 19.6 cM (ⵑ 20 million bases). A total of 63 German families with affected siblings (138 patients, 95 first-degree

In clinical practice, it is clearly recognized that there are large differences in presentation of sarcoidosis and prognosis, and that some clinical characteristics strongly relate to disease severity. In this regard, erythema nodosum (EN) and chest radiographic stage I are known to be associated with a milder disease phenotype, which is often spontaneously remitting and has a favorable prognosis. In combination with joint symptoms, EN and stage I chest radiography are grouped into a syndrome, Lo¨fgren’s syndrome, that gen-


erally has an excellent prognosis (22). Other extrapulmonary disease manifestations such as uveitis, cardiac disease, central nervous system involvement, and stage II/III disease represent a more severe phenotype with a more likely chronic course (23). Interestingly, mild and severe disease phenotypes often do not evolve into each other, but appear to retain the same phenotype from first presentation. This concept of at least two clinically different severity phenotypes in sarcoidosis was recently given more genetic basis in a high-resolution HLA-DQB1 typing study by our group (24). We studied the relationship between 19 HLADQB1 alleles and sarcoidosis severity and progression in 133 white patients with sarcoidosis and 354 control subjects from the United Kingdom, and 102 patients and 214 control subjects from The Netherlands. Disease severity was evaluated by chest radiography, pulmonary function tests, and extrapulmonary disease, including uveitis and central nervous system disease, at presentation, and progression, measured by chest radiographic follow-up at 2 and 4 yr. We found that HLA-DQB1*0201 was strongly associated with milder disease manifestations (EN, Lo¨fgren’s syndrome, and stage I chest radiography at presentation, 2 and 4 yr), and protective against severe sarcoidosis (uveitis, chest radiograph stage II or greater, and diffusing capacity ⬍ 80% predicted). Furthermore, the DQB1*0201 allele was also strongly associated with a reduced risk of disease progression (improved or stable stage I chest radiograph, and no progression or persistent stage II/III disease) regardless of corticosteroid treatment. Remarkably, another HLADQB1 allele, *0602, showed susceptibility associations with more severe disease. Importantly, the above findings are consistent with previous HLA-DRB1 association studies. The HLA-DQB1*0201 allele is in tight linkage disequilibrium with HLA-DRB1*03 that has been associated with good prognosis in several sarcoidosis cohorts. In addition, the findings that the HLADQB1*0602 allele is associated with more severe disease are consistent with the Scandinavian studies described above as this allele is closely linked to the HLA-DRB1*15 allele. Therefore, taken together, there is now good evidence that there are at least two HLA haplotypes that are very influential on different sarcoidosis phenotypes: (i ) HLA-DRB1*0301/DQB1*0201 determines mild-type disease with remitting course, and (ii) HLA-DRB1*15DQB1*0602 determines more severe, nonremitting-type disease. However, there might be other relevant genotype– susceptibility/phenotype associations, either MHC-based or involving other, yet to be identified, loci.

Sarcoidosis, a Polygenic Disease Although some clear HLA genotype–susceptibility/phenotype associations have been described, many patients have different HLA haplotypes. Therefore, we are presently extending our studies to a large MHC typing study, including the major HLA loci. At this time ⬎ 500 sarcoidosis patients are included in the study. Interim analysis shows some potentially important results. When all positive allelic HLA associations are reclassified as either “susceptible” or “protective” alleles, almost half of all patients carry either a protective or susceptible or both allele(s) (our unpublished

S61

Figure 1. This figure shows the percentage of patients with sarcoidosis (S) and control individuals (C) who carry (either homozygous or heterozygous) a susceptibility allele (s), a protective allele (p), or neither a susceptibility or protective allele (n). From this it can be seen that roughly 40% of the susceptibility to sarcoidosis is unexplained by current studies (% of sarcoidosis with nn alleles).

data) (Figure 1). Interestingly, the observed effects of some of these alleles appear to be age-dependent (our unpublished data). Although these HLA protective/susceptibility– sarcoidosis associations are highly significant, it also has to be recognized that roughly half the patients do not have evidence for an HLA contribution to the pathogenesis of their disease. This observation confirms the conceptualized polygenic nature of sarcoidosis, and highlights the importance of studying other candidate genes, either MHC-associated (e.g., TNF) or located in other chromosomal areas (e.g., the areas identified by Schu¨rmann and colleagues). In this respect, we have recently studied a series of different TNF promoter polymorphisms, at position –1031, –863, –857, –307, and –237 in 96 British and 100 Dutch patients with sarcoidosis, and 354 British and 222 Dutch control subjects (5). The results showed a significant increase in the rarer TNF –857T allele in both sarcoidosis populations. In total, 25.5% of the patients with sarcoidosis carried the TNF –857T allele, compared with 14.1% of the control subjects (P ⫽ 0.0003, pc ⫽ 0.002; population attributable risk percentage 13.3%). Interestingly, subgroup analysis showed a significant increase of the rarer TNF –307A allele in patients presenting with Lo¨fgren’s syndrome, and a decrease of the TNF –857T allele in this subgroup. Haplotype construction of the investigated polymorphisms revealed six haplotypes, of which haplotype-2 contained the –307A allele and haplotype-4 the –857T allele. This study of genetic variants in the TNF promoter, therefore, provides further support that mild-type sarcoidosis is genetically distinguishable, i.e., associating with haplotype-2 and not -4 as occurs in more persistent disease.

Conclusion Evidence is accumulating that there are strong genotype– phenotype relationships in sarcoidosis. Of these, specific alleles are associated with disease susceptibility/chronicity (HLA-DRB1*03, *11, *12, *14, *15, and DQB1*0602 and

S62


TNF –857T), and others are clearly protective or associated with mild disease (HLA-DRB1*01, 03, 04, DQB1*0201, and TNF –307A). The DQB1*0201 allele is in linkage disequilibrium with DRB1*0301 and TNF –307A, and it is this haplotype that is almost invariably associated with mildtype disease, i.e., sarcoidosis presenting as Lo¨fgren’s syndrome or stage I disease only. The true protective locus on this extended MHC haplotype, however, still needs identification. This will need much larger cohorts of patients with sarcoidosis than those studied to date, or DRB1*0301-deficient cohorts, most likely to be found in populations from a different ethnic background. Fine mapping across the MHC region is also required, including genes such as the HLA-B-associated transcript (BAT) 1. Furthermore, we need fine mapping of important candidate chromosomal areas outside the MHC, and confirmation of previously described associations in genes including the chemokine receptors CCR 2 and 5. In conclusion, is sarcoidosis a single disease or not? There appear to be at least two clearly different disease phenotypes, one mild-type/remitting and one chronic/progressive, which split now can be given genetic backing, implying a different pathogenesis that might relate to differences in trigger factors and/or their processing by the mononuclear phagocyte system. References 1. McGrath, D. S., Z. Daniil, P. Foley, J. L. du Bois, P. A. Lympany, P. Cullinan, and R. M. du Bois. 2000. Epidemiology of familial sarcoidosis in the UK. Thorax 55:751–754. 2. Rybicki, B. A., M. C. Iannuzzi, M. M. Frederick, B. W. Thompson, M. D. Rossman, E. A. Bresnitz, M. L. Terrin, D. R. Moller, J. Barnard, R. P. Baughman, L. DePalo, G. Hunninghake, C. Johns, M. A. Judson, G. L. Knatterud, G. McLennan, L. S. Newman, D. L. Rabin, C. Rose, A. S. Teirstein, S. E. Weinberger, H. Yeager, and R. Cherniack. 2001. Familial aggregation of sarcoidosis: a case-control etiologic study of sarcoidosis (ACCESS). Am. J. Respir. Crit. Care Med. 164:2085–2091. 3. Foley, P. J., D. S. McGrath, E. Puscinska, M. Petrek, V. Kolek, J. Drabek, P. A. Lympany, P. Pantelidis, K. I. Welsh, J. Zielinski, and R. M. du Bois. 2001. Human leukocyte antigen-DRB1 position 11 residues are a common protective marker for sarcoidosis. Am. J. Respir. Cell Mol. Biol. 25:272–277. 4. Foley, P. J., P. A. Lympany, E. Puscinska, J. Zielinski, K. I. Welsh, and R. M. du Bois. 1999. Analysis of MHC encoded antigen-processing genes TAP1 and TAP2 polymorphisms in sarcoidosis. Am. J. Respir. Crit. Care Med. 160:1009–1014. 5. Grutters, J. C., H. Sato, P. Pantelidis, A. L. Lagan, D. S. McGrath, J. W. Lammers, J. M. van den Bosch, A. U. Wells, R. M. du Bois, and K. I. Welsh. 2002. Increased frequency of the uncommon tumor necrosis factor -857T allele in British and Dutch patients with sarcoidosis. Am. J. Respir. Crit. Care Med. 165:1119–1124. 6. Schurmann, M., P. Reichel, B. Muller-Myhsok, M. Schlaak, J. Muller-Quern-

7.

8.

9.

10.

11.

12. 13. 14. 15. 16. 17. 18.

19. 20. 21.

22. 23.

24.

heim, and E. Schwinger. 2001. Results from a genome-wide search for predisposing genes in sarcoidosis. Am. J. Respir. Crit. Care Med. 164:840–846. Petrek, M., J. Drabek, V. Kolek, J. Zlamal, K. I. Welsh, M. Bunce, E. Weigl, and B. R. Du. 2000. CC chemokine receptor gene polymorphisms in Czech patients with pulmonary sarcoidosis. Am. J. Respir. Crit. Care Med. 162:1000–1003. Hizawa, N., E. Yamaguchi, K. Furuya, E. Jinushi, A. Ito, and Y. Kawakami. 1999. The role of the C–C chemokine receptor 2 gene polymorphism V64I (CCR2–64I) in sarcoidosis in a Japanese population. Am. J. Respir. Crit. Care Med. 159:2021–2023. Hutyrova, B., P. Pantelidis, J. Drabek, M. Zurkova, V. Kolek, K. Lenhart, K. I. Welsh, R. M. du Bois, and M. Petrek. 2002. Interleukin-1 gene cluster polymorphisms in sarcoidosis and idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 165:148–151. Zorzetto, M., C. Bombieri, I. Ferrarotti, S. Medaglia, C. Agostini, C. Tinelli, G. Malerba, N. Carrabino, A. Beretta, L. Casali, E. Pozzi, P. F. Pignatti, G. Semenzato, M. C. Cuccia, and M. Luisetti. 2002. Complement receptor 1 gene polymorphisms in sarcoidosis. Am. J. Respir. Cell Mol. Biol. 27:17–23. Maliarik, M. J., B. A. Rybicki, E. Malvitz, R. G. Sheffer, M. Major, J. Popovich, Jr., and M. C. Iannuzzi. 1998. Angiotensin-converting enzyme gene polymorphism and risk of sarcoidosis. Am. J. Respir. Crit. Care Med. 158:1566–1570. Klein, J., and A. Sato. 2000. The HLA system: first of two parts. N. Engl. J. Med. 343:702–709. Wang, J. H., and E. L. Reinherz. 2002. Structural basis of T cell recognition of peptides bound to MHC molecules. Mol. Immunol. 38:1039–1049. Ishihara, M., T. Ishida, H. Inoko, H. Ando, T. Naruse, Y. Nose, and S. Ohno. 1996. HLA serological and class II genotyping in sarcoidosis patients in Japan. Jpn. J. Ophthalmol. 40:86–94. Ishihara, M., H. Inoko, K. Suzuki, H. Ono, Y. Hiraga, H. Ando, T. Naruse, T. Ishida, and S. Ohno. 1996. HLA class II genotyping of sarcoidosis patients in Hokkaido by PCR-RFLP. Jpn. J. Ophthalmol. 40:540–543. Nowack, D., and K. M. Goebel. 1987. Genetic aspects of sarcoidosis. Class II histocompatibility antigens and a family study. Arch. Intern. Med. 147: 481–483. Berlin, M., A. Fogdell-Hahn, O. Olerup, A. Eklund, and J. Grunewald. 1997. HLA-DR predicts the prognosis in Scandinavian patients with pulmonary sarcoidosis. Am. J. Respir. Crit. Care Med. 156:1601–1605. Naruse, T. K., Y. Matsuzawa, M. Ota, Y. Katsuyama, A. Matsumori, M. Hara, S. Nagai, S. Morimoto, S. Sasayama, and H. Inoko. 2000. HLADQB1*0601 is primarily associated with the susceptibility to cardiac sarcoidosis. Tissue Antigens 56:52–57. Schurmann, M., G. Bein, D. Kirsten, M. Schlaak, J. Muller-Quernheim, and E. Schwinger. 1998. HLA-DQB1 and HLA-DPB1 genotypes in familial sarcoidosis. Respir. Med. 92:649–652. Bogunia-Kubik, K., J. Tomeczko, K. Suchnicki, and A. Lange. 2001. HLADRB1*03, DRB1*11 or DRB1*12 and their respective DRB3 specificities in clinical variants of sarcoidosis. Tissue Antigens 57:87–90. Schurmann, M., P. A. Lympany, P. Reichel, B. Muller-Myhsok, K. Wurm, M. Schlaak, J. Muller-Quernheim, R. M. du Bois, and E. Schwinger. 2000. Familial sarcoidosis is linked to the major histocompatibility complex region. Am. J. Respir. Crit. Care Med. 162:861–864. Lo¨fgren, S. 1946. Erythema nodosum: studies on etiology and pathogenesis in 185 adult cases. Acta Med. Scand. 124:1–197. American Thoracic Society. 1999. Statement on sarcoidosis. Joint Statement of the American Thoracic Society (ATS), the European Respiratory Society (ERS) and the World Association of Sarcoidosis and Other Granulomatous Disorders (WASOG) adopted by the ATS Board of Directors and by the ERS Executive Committee, February 1999. Am. J. Respir. Crit. Care Med. 160:736–755. Sato, H., J. C. Grutters, P. Pantelidis, A. N. Mizzon, T. Ahmad, A. J. Van Houte, J. W. Lammers, J. M. van den Bosch, K. I. Welsh, and R. M. du Bois. 2002. HLA-DQB1*0201: A Marker for Good Prognosis in British and Dutch Patients with Sarcoidosis. Am. J. Respir. Cell Mol. Biol. 27:406–412.


S63

Cytokine Phenotypes Serve as a Paradigm for Experimental Immune-Mediated Lung Diseases and Remodeling The pathologic presentation of a number of chronic lung disease is often associated with an inflammatory response, with subsequent fibroproliferation and deposition of extracellular matrix. Many chronic lung disorders share common characteristics, including an unknown etiology, ill-defined mechanisms of disease progression, inability to effectively resolve, and end-stage fibrosis. Unfortunately, these progressive chronic lung diseases are usually refractory to treatment and are associated with substantial morbidity and mortality. The inability to identify efficacious therapeutic options to treat the actively progressing forms of these lung disorders likely reflects the scientific community’s limited mechanistic understanding of these disorders. However, investigative inroads have been made that suggest that cytokine networks are operative in dictating the progression of these diseases. For example, it is known that various cytokines can promote and maintain the chronicity of inflammation by sustaining the recruitment of leukocyte subpopulations and inducing fibroblast activation, proliferation, and collagen deposition during the maintenance of chronic lung disease. Clearly, the etiology of chronic lung disease, which possesses a fibrotic outcome, is diverse and includes such insults as radiation injury, cytotoxic drugs, particulates, and idiopathic events. However, we present a working model based on immune dependent cytokine phenotypes that appear to be important in dictating the progression of lung inflammation and end-stage outcome. The involvement of various cytokines in the initiation and maintenance of chronic immune-mediated lung disease, which eventually may mature to end-stage fibrosis, may be directed by a sequence of host cytokine responses that have gone awry. Under a normal host defense paradigm, it is likely that the initial cell-mediated reaction involves the expression of ␥ interferon and mediators that would fall under the rubric of a type 1 response. The immune process involving a high interferon (IFN)-␥ response is extremely efficient in activating the phagocytosis and killing activity of neutrophils, monocytes, and macrophages, as well as inducing MHC class II expression on antigen-presenting cells (APC). Although the elevation in IFN-␥ is indeed important in activating mononuclear cells, it also serves a key role in the regulation of fibroblast activation. The ability of IFN-␥ to suppress fibroblast proliferation and collagen deposition has long been recognized as a biological activity of this type 1 cytokine. However, if the initiating antigen or pathogen is not cleared by this cell-mediated immune response, the host enters a transition phase, which is characterized by the appearance of either a hybrid cytokine phenotype or a

This section was written by Steven L. Kunkel, Stephen W. Chensue, Nicholas Lukacs, and Cory Hogaboam (Department of Pathology, University of Michigan Medical School, Ann Arbor, Michigan).

totally different cytokine phenotype. The subsequent host response is represented by the expression of cytokines, which would fall under the rubric of a type 2 immune process with accompanying levels of the prototypic cytokines interleukin (IL)-4, IL-5, and IL-13. The significance of this new mix of mediators to the host defense lies in the fact that a different type of immune process is now available to aid in attacking and clearing the antigen or pathogen. The switch to a more sophisticated immune response allows the host to mount a continued response with renewed vigor of the host, as antibody switching occurs and an additional leukocyte, the eosinophil, is cast into the inflammatory mix. It is also recognized that this phenotype consists of cytokines that ultimately activate resident fibroblasts and cause these cells to proliferate and deposit collagen. Thus, if the antigen continues to persist and escape the grasp of the different cytokine-directed responses, the final cytokine phenotype targets and activates the resident fibroblasts to proliferate, deposit collagen (“lay down bricks and mortar”), and wall the inciting agent away from the host. With the above paradigm in mind, the end-stage pathology observed in chronic fibroproliferative lung disease may be due to dysregulation of this final walling-off process. The persistence of the causative agent, coupled with the continued long-term expression of type 2 cytokines, drives fibroblasts to a highly active state and serves as the underpinning for end-stage disease. Thus, experimental models of chronic lung inflammation, which are characterized by either a type-1 or a type-2 response, would be useful in delineating the mechanisms that maintain and resolve chronic lung inflammation. These experimental systems will prove to be especially important to investigate, as the degree of inflammation and fibroblast activation during the pathogenesis of chronic pulmonary inflammation may be dependent upon a polarized expression of type-1 and type-2 cytokines during the evolution of the disease.

The Type 1/Type 2 Paradigm of Tissue Remodeling One of the most common worldwide diseases, which is dominated by type-2 cytokines and eventual end-stage fibrosis of target tissue, is schistosomiasis. This helminth parasitic infection induces a chronic cell-mediated inflammatory process characterized by high levels of IL-4, IL-5, IL-10, and IL-13, with corresponding low levels of IFN-␥ (1). In addition, the fibrotic response of the host during this disease greatly contributes to the morbidity associated with the parasitic infection. The vigorous fibrotic response to the schistosome egg granuloma is the consequence of a parasiteinduced, host-derived cytokine profile that is effective in fibrosing or “walling off” the deposited parasite egg. This disease process has been modeled in experimental systems to investigate the mechanisms by which cytokines can influence the cellularity, chronicity, and fibrosis of lung disease.

S64


Interestingly, the treatment of murine schistosomiasis with exogenous IFN-␥ significantly decreases collagen deposition associated with granuloma formation (2). Furthermore, IL-12–based vaccination was shown to suppress the fibrotic response normally induced by schistosome infection (3). These studies lend support to the potential disparate role of type-1 and type-2 cytokines during the evolution of chronic disease with associated fibrotic processes. The opposing effects of type-1 and type-2 cytokines in fibrosis are further supported by a number of recent investigations demonstrating that IL-4 and IL-13 are important mediators of fibroblast activation (4, 5). Additional data support the concept that the chronicity of certain cell-mediated responses in vivo ultimately results in pathology due to a characteristic type-2 cytokine profile (6). Murine models of chronic graft-versus-host disease, as a result of experimental bone marrow transplant, have been characterized by hypergammaglobulinemia, high levels of IgE, immune complex deposition in tissues, and elevated concentrations of the type-2 cytokine, IL-4 (7). When mice with bone marrow transplant-graft-versus-host disease were treated with neutralizing IL-4 antibodies, IgE levels dropped, immune complex–induced lesions resolved, and splenomegaly was prevented. Interestingly, cyclosporine A, an agent known to suppress type-1 cytokine responses, caused an exacerbation of bone marrow transplant graft-versus-host disease in these models (8). Clinical studies assessing longitudinal alterations in cytokine levels and corresponding fibroproliferative changes in lung pathology are difficult to perform in human bone marrow transplants with subsequent graft-versus-host disease. However, it is known that fibrosis and associated cell proliferation associated with bronchiolitis obliterans may be a consequence of the transplant. One of the more compelling pieces of information, which may link the expression of type-2 cytokines to the evolution of chronic fibrosis, is the association of fibroblast activation and the presence of eosinophils (9). A number of studies have demonstrated that asthma and parasitic infections are associated with both Th2 cytokine expression (IL-4 and IL-5) and a profound eosinophilia, as IL-5 is both an eosinophilopoeitic and chemotactic factor for eosinophils. Although the mechanistic role of eosinophils and type-2 cytokines has been demonstrated in asthma and parasitic infections, the role of these cells and type-2 cytokines in other disease states is not as clear. However, in vitro experiments have shown that eosinophils are capable of a timedependent release of factors that stimulate human lung fibroblasts to undergo replication and synthesize extracellular matrix. The interactions between fibroblasts and eosinophils appear to be rather complex, as fibroblast-conditioned media has also been shown to prolong the survival of eosinophils. Nonetheless, studies have identified an increase in eosinophils in association with fibrotic changes in pulmonary fibrosis. Thus, a potential fibrotic network, leading to end-stage pathology, may be established between the triumvirate of type-2 type cytokines, eosinophils, and fibroblasts. Using unique models of experimental lung granuloma formation defined by a characteristic cytokine phenotype, which may share characteristics of specific immune,

Figure 1. The evolution of chronic immune-mediated lung disease in a naive host depends on the persistence of antigen or pathogen, which is not cleared by the innate or type 1 (high IFN-␥) acquired response. The shift in the acquired response to a cytokine phenotype characterized by high levels of IL-4 and IL-13 results in a more sophisticated reaction with the contribution of additional antibodies (IgE) and leukocytes (esoinophils and Th2 cells). The continued persistence of the inciting agent and the long-term maintenance of a type 2 response may ultimately activate fibroblasts, resulting in matrix deposition to “wall-off” the agent from the host.

antigen-driven responses, we have assessed many of the above processes that are outlined in Figure 1.

Type 2 Cytokines Induce Profibrotic Cytokine Cascades Information regarding the role of IL-13 and TGF-␤ as key mediators in the fibrotic process stems from recent studies using either a transgenic expression system for the overexpression of IL-13 or an adenovector-mediated gene transfer system for the overexpression of TGF-␤1 (10–12). The overexpression of an IL-13 transgene under the control of the Clara cell 10-kD protein promoter in the lungs of mice demonstrated a unique model system to assess the in vivo biology of this cytokine. The overexpression of IL-13 resulted in an eosinophilic inflammation, mucus hypersecretion, globlet cell hyperplasia, and subepithelial airway fibrosis. Because IL-4 and IL-13 are related cytokines, are both located on chromosome 5, and may have resulted from gene duplication during evolution, it is important to define specific differences between these two type 2 cytokines. Although both can share a common receptor, they differ in their ability to induce eosinophil chemotaxis and survival, regulate T lymphocyte proliferation, alter prostaglandin and IFN-␥ production, and cause epithelial cells to secrete electrolytes. One of the more striking differences between IL-4 and IL-13 is the significant profibrotic activity of IL-13. This cytokine appears to be able to increase the fibrotic process directly by stimulating fibroblasts to increase collagen expression and via a cytokine network that involves the expression of TGF-␤1 (10). Data to support this latter aspect of an IL-13–directed cascade stems from the fact that IL-13 transgenic animals possess dramatically elevated levels of TGF-␤1 associated with collagen deposition. Inter-


estingly, a specific inhibitor of TGF-␤1, a TGF-␤1–soluble receptor, negated the in vivo fibrosis caused by the IL-13– overexpressing mice (10). Thus, the effects of IL-13 in this process may be indirect. Further evidence to support the cytokine cascade effect of IL-13 has been provided by investigations demonstrating the ability of IL-13 to induce the expression of the chemokine MCP-1/CCL2, which may activate fibroblasts to express collagen. In one study, the overexpression of an IL-13 transgene in a CCR2 (the receptor for MCP-1) knockout mouse demonstrated reduced pulmonary fibrosis (13). Furthermore, the direct challenge of primary cultures of wild-type fibroblasts was found to increase collagen expression via a pathway that included the downstream expression of TGF-␤. Thus, there appears to be an IL-13–MCP-1/CCL2–TGF-␤ circuit operative in the activation of fibroblasts and deposition of collagen.

Targeting Type 2 Cytokines as an Antifibrotic Therapy The central role of IL-13 to the fibrotic process makes this cytokine an ideal target to develop new therapeutic approaches in regulating the progressive pathologic response of end-stage disease. Recent studies have provided exciting evidence that reducing the biologic activity of IL-13 can indeed reduce organ-based fibrosis. One of the first published studies to clearly show a therapeutic effect of targeting the biology of IL-13 used a parasite model induced by Schistosoma mansoni (14). This model causes the expression of a dominant CD4⫹ Th2 response with a subsequent polarized cytokine phenotype. Investigations into the role of IL-4 (a prototypic type 2 cytokine) in this model, using either IL-4 depletion or IL4⫺/⫺ mice, did not unveil a critical role for this type 2 cytokine in the developing pathology, including fibrosis, associated with schistosomiasis. Interestingly, the developing granulomatous inflammation and accompanying fibrosis, which is a hallmark of the host response in this model, was significantly reduced in Stat6⫺/⫺ mice (15). Because IL-4 and IL-13 are the major activators of Stat6, the significance of IL-13 in the fibrosis associated with this model was explored. This was accomplished by using the soluble IL-13 receptor ␣ 2 complexed with the Fc portion of an antibody (sIL-13R␣2–Fc) (14). This therapeutic construct was shown to reduce collagen expression in vivo using histologic, biochemical, and molecular analyses. The antifibrotic effects of sIL-13R␣2–Fc was not due to skewing the cytokine profile, as blocking the biologic activity of IL-13 did not alter the production of IFN-␥, IL-4, IL-5, IL-10, or IL-13. However, fibroblast activation appeared to be profoundly altered by IL-13, as in vitro studies demonstrate that fibroblasts express IL-13 receptors, and when occupied by IL-13 induced the expression of type 1 collagen. An additional exciting therapeutic approach for the treatment of fibrosis is the use of an IL-13 fusion cytotoxin, which is IL-13 tagged with a derivative of Pseudomonas exotoxin (16). Once bound to the cell expressing an appropriate receptor, the IL-13 fusion cytotoxin destroyed that targeted cell. The strategy to use this construct is an outgrowth of investigations that have used the fusion protein to selectively target and eradicate solid tumor cells which

S65

express IL-13 receptors. Importantly, experimental animals did not demonstrate any negative effects from the prolonged systemic in vivo administration of the IL-13 fusion cytotoxin. In a recent in vivo study, IL-13–responsive cells were targeted via an intranasal administration of the IL-13 fusion cytotoxin in Aspergillus funigatus–sensitized mice challenged by the airways with fungal spores (16). The experimental animals received 50, 100, or 200 ng of the construct per animal on Days 14–28 after challenge. The experimental group exhibited a significant decrease in collagen deposition at Day 28 after challenge, with a concomitant decrease in lymphocytes in the bronchoalveolar lavage of the animals. In additional studies, the IL-13 fusion cytotoxin was found to block the development of primary S. mansoni egg-induced lung inflammation and decrease-associated collagen levels (17). These studies further support a role for targeting IL-13 as an efficacious means to block the progression of pulmonary fibrosis.

MCP-1/CCL2 as a Profibrotic Chemokine Even though the chemokine MCP-1/CCL2 was originally described as a specific chemotactic agent for the elicitation of mononuclear cells, it has now gained significant attention as a mediator involved in the maintenance of fibroblast activation and collagen deposition associated with pulmonary fibrosis (18). Although a variety of cells have the capability to synthesize MCP-1/CCL2, it is the pulmonary fibroblasts isolated from patients with idiopathic pulmonary fibrosis that appear to abundantly produce this chemokine (19). Furthermore, experimental models of fibrosis of the lungs and kidney are characterized by an increase in levels of MCP-1/CCL2, and interventional therapies targeting MCP-1/CCL2 have begun to identify a role for this CC chemokine in chronic interstitial lung disease (20, 21). For example, immunoneutralization of MCP-1/CCL2 in an experimental model of bleomycin-induced lung fibrosis reduced the elicitation of mononuclear cells by over 30%, whereas depletion of MCP-1/CCL2 reduced the fibrotic response associated with crescentic nephritis (20). In an additional investigation, MCP-1/CCL2 was defined as playing a significant role leading to collagen deposition (18). In this study, primary cultures of lung fibroblasts treated with escalating doses of MCP-1/CCL2 demonstrated a concentration dependent increase in the amount of radioactive hydroxyproline incorporated into fibroblast-derived collagen. This experiment was paired with an additional set of studies showing that MCP-1/CCL2 induced a concentration dependent increase in TGF-␤ by the challenged fibroblasts. The indirect regulation of collagen synthesis by MCP-1/CCL2 via TGF-␤ appeared to be a likely mechanism, as MCP-1/CCL2 stimulated fibroblasts in the presence of TGF-␤ antisense oligionucleotide did not express type 1 collagen. However MCP-1/CCL2–treated fibroblasts in the presence of TGF-␤ sense oligionucleotide did not cause a reduction in type 1 collagen (18). These studies are important because they demonstrated that chemokines are important to the fibrotic process and that the type 2 cytokines are likely to be operative in this scenario, as IL-13 is a major cytokine known to induce the expression of MCP-1/ CCL2.

S66


Summary One must keep in mind that much of the above data and conclusion are based on models using antigens that trigger a profound immune response; however, these paradigms do provide novel avenues to explore likely mechanisms of chronic lung disease. There is little doubt that the development of novel therapeutic strategies for pulmonary fibrosis should target key type 2 cytokines, such as IL-13 and the lung fibroblast, as key components of this progressive process. Sufficient data now underscores the pathologic role of IL-13 in promoting fibroblast activation. Once activated, these structural cells can play an effector role, as a cell that is intimately involved in the recruitment and activation of leukocytes into the interstitial space of the lung. The fibroblast can no longer be viewed as a passive, bystander cell during the evolution of chronic lung disease, but a true player in this developing response. Thus, the balance between normal tissue repair and excess collagen deposition, appears to be dictated by the nature of the cytokine phenotype and the interaction between immune cells and lung fibroblast during the evolution of progressive chronic lung disease. Acknowledgments: This work was supported in part by National Institutes of Health Grants #35276, 31963, and 56402.

References 1. Chensue, S. W., K. Warmington, J. H. Ruth, N. Lukacs, and S. L. Kunkel. 1997. Mycobacterial and schistosomal antigen-elicted granuloma formation in IFN-gamma and IL-4 knockout mice: analysis of local and regional cytokine and chemokine networks. J. Immunol. 159:3565–3573. 2. Czaja, M. J., F. R. Weiner, S. Takahashi, M. A. Giambrone, P. H. Van der Meide, H. Schellenkens, L. Biempica, and M. A. Zern. 1989. Gamma interferon treatment inhibits collagen deposition in murine schistosomiasis. Hepatol. 10:795–800. 3. Wynn, T. A., A. W. Cheever, D. Jankovic, R. W. Poindexter, P. Caspar, F. A. Lewis, and A. Sher. 1995. An IL-12-based vaccination method for preventing fibrosis induced by schistosome infection. Nature 376:594–596. 4. Oriente, A. O., N. S. Fedarko, S. E. Pacocha, S. K. Huang, L. M. Lichtenstein, and D. E. Essayan. 2000. Interleukin-13 modulates collagen homeostasis in human skin and keloid fibroblasts. J. Pharm. Exp. Ther. 292:988–994. 5. Gillery, P., C. Fertin, J. F. Nicolas, F. Chastang, B. Kalis, J. Banchereau, and F. X. Maquart. 1992. Interleukin-4 stimulates collagen gene expression in human fibroblast monolayer cultures: potential role in fibrosis. FEBS Lett. 302:231–234.

6. Goldman, M., D. Druet, and E. Gleichmann. 1991. Th2 cells in systemic autoimmunity: insights from allogeneic disease and chemically-induced autoimmunity. Immunol. Today 12:223–228. 7. Ushiyama, C., T. Hirano, H. Miyajima, K. Okumura, Z. Ovary, and H. Hashimoto. 1995. Anti-IL-4 antibody prevents graft-versus-host disease in mice after bone marrow transplantation. J. Immunol. 154:2687–2696. 8. Glazier, A., J. Tutschka, E. R. Farmer, and G. W. Santos. 1983. Graft-vshost disease in cyclosporin rats after syngeneic and autologous bone marrow reconstitution. J. Exp. Med. 158:1–13. 9. Weller, P. A. 1989. Eosinophils and fibroblasts: the medium in the mesenchyme. Am. J. Respir. Cell Mol. Biol. 1:267–268. 10. Lee, C. G., R. J. Homer, Z. Zhu, S. Lanone, X. Wnag, V. Koteliansky, M. Shipley, P. Nobel, Q. Chen, R. M. Senior, and J. A. Elias. 2002. Interleukin-13 induces tissue fibrosis by selectively stimulating and activating transforming growth factor beta1. J. Exp. Med. 194:809–821. 11. Zhu, Z., R. J. Homer, Z. Wang, Q. Chen, G. P. Geba, J. Wang, Y. Zhang, and J. A. Elias. 1999. Pulmonary expression of interleukin-13 causes inflammation, mucus hypersecretion, subepithelial fibrosis, abnormalities, and eotaxin production. J. Clin. Invest. 103:779–788. 12. Sime P, Z. Xing, F. L. Graham, K. G. Csaky, and J. Gauldie. 1997. Adenovectormediated gene transfer of active transforming growth factor beta1 induces prolonged sever fibrosis in rat lung. J. Clin. Invest. 100:768–776. 13. Zhu, Z., B. Ma, T. Zheng, R. J. Homer, C. G. Lee, I. F. Charo, P. Noble, and J.A. Elias. 2002. IL-13 induced chemokine responses in the lung: role of CCR2 in the pathogenesis of IL-13-induced inflammation and remodeling. J. Immunol. 68:2953–2962. 14. Chiaramonte, M. G., D. D. Donaldson, A. W. Cheever, and T. A. Wynn. 1999. An IL-13 inhibitor blocks the development of hepatic fibrosis during a T-helper type 2- dominated inflammatory response. J. Clin. Invest. 104: 777–785. 15. Kaplan, M. H., J. R. Whitfield, D. L. Boros, and M. J. Grusby. 1998. Th2 cells are required for the Schistosoma mansoni egg-induced granulomatous response. J. Immunol. 160:1850–1856. 16. Blease, K., C. Jakubzick, J. M. Schuh, B. H. Joshi, R. K. Puri, and C. M. Hogaboam. 2001. IL-13 fusion cytotoxin ameliorates chronic fungalinduced allergic airway disease in mice. J. Immunol. 167:6583–6592. 17. Jakubzick, C., S. L. Kunkel, B. H. Joshi, R. J. Puri, and C. M. Hogaboam. 2002. Interleukin-13 fusion cytotoxin arrests Schistosoma mansoni egginduced pulmonary granuloma formation in mice. Am. J. Pathol. 161: 1283–1297. 18. Gharaee-kermani, M., E. M. Denholm, and S. H. Phan. 1996. Costimulation fo fibroblast collagen and transforming growth factor beta 1 gene expression by monocyte chemoattractant protein-1 via specific receptors. J. Biol. Chem. 271:17779–17784. 19. Iyonaga, K., M. Takeya, N. Saita, O. Sakamoto, T. Yoshimura, M. Ando, and K. Takahashi. 1994. Monocyte chemoattractant protein-1 in idiopathic pulmonary fibrosis and other interstitial lung diseases. Hum. Pathol. 25:455–460. 20. Lloyd, C. M., A. W. Minto, M. E. Dorf, A. Proudfoot, T. N. Wells, D. J. Salant, and J. C. Guitierrez-Ramos. 1997. RANTES and monocyte chemoattractant protein-1 play an important role in the inflammatory phase of crescentic nephritis, but only MCP-1 is involved in crescent formation and interstitial fibrosis. J. Exp. Med. 185:1371–1378. 21. Hogaboam, C. M., R. E. Smith, and S. L. Kunkel. 1998. Dynamic interactions between lung fibroblasts and leukocytes: Implications for fibrotic lung disease. Proceedings of the Association of American Physicians 110:313– 320.


S67

CXC Chemokines in Vascular Remodeling Related to Pulmonary Fibrosis CXC chemokines are characteristically heparin-binding proteins. On a structural level, they have four highly conserved cysteine amino acid residues, with the first two cysteines separated by one nonconserved amino acid residue, hence the name CXC (1–3). Although the CXC motif distinguishes this family from other chemokine families, a second structural domain within this family dictates their angiogenic potential. The NH2-terminus of the majority of the CXC chemokines contains three amino acid residues (GluLeu-Arg: the “ELR” motif) that precede the first cysteine amino acid residue of the primary structure of these cytokines (4). The family members that contain the “ELR” motif (ELR⫹) are potent promoters of angiogenesis (4). In contrast, interferon-inducible members of the family that lack the ELR motif (ELR⫺) are potent inhibitors of angiogenesis (4). On a structural/functional level, the CXC chemokine family is an unique family of cytokines due to their ability to behave in a disparate manner in the promotion and inhibition of angiogenesis relevant to aberrant vascular remodeling in fibroproliferative disorders.

Angiogenic (ELR⫹) CXC Chemokines Members of the CXC chemokine family that promote angiogenesis include the following: interleukin-8 (IL-8/CXCL8), epithelial neutrophil-activating protein-78 (ENA-78/CXCL5), growth-related genes (GRO-␣, -␤, and -␥; CXCL1, CXCL2, and CXCL3, respectively), granulocyte chemotactic protein-2 (GCP-2/CXCL6), and NH2-terminal truncated forms of platelet basic protein (PBP), which include connective tissue activating protein-III (CTAP-III), ␤-thromboglobulin (␤-TG), and neutrophil-activating protein-2 (NAP-2/ CXCL7) (4). ELR⫹ CXC chemokines mediate both in vitro endothelial cell chemotactic and proliferative activity, and in vivo angiogenesis (4). In addition, ELR⫹ CXC chemokines can induce the expression of the metalloproteinases (MMPs) (5). Therefore, ELR⫹ chemokines not only have a direct effect on endothelial cell chemotaxis and proliferation, but also have an indirect effect in mediating their migration through ECM via the local production of MMPs.

CXCR2 Is the Putative Receptor for Angiogenic (ELR⫹) CXC Chemokine-Mediated Angiogenesis The fact that all ELR⫹ CXC chemokines mediate angiogenesis highlights the importance of identifying a common receptor. The CXC chemokine receptor, CXCR2, has the ability to bind all ELR⫹ CXC chemokine ligands, and has been found to mediate the angiogenic activity of these cyto-

This section was written by Robert M. Strieter, John A. Belperio, and Michael P. Keane (Department of Medicine, Division of Pulmonary and Critical Care Medicine, Department of Pathology and Laboratory Medicine, David Geffen School of Medicine at UCLA, Los Angeles, California).

kines (6, 7). CXCR2 is expressed by human microvascular endothelial cells (6). In addition, CXCR2 promotes ELR⫹ CXC chemokine-induced angiogenesis in vitro using endothelial migration and proliferation assays, and in vivo using the cornea micropocket assay of angiogenesis in CXCR2⫹/⫹, but not CXCR2⫺/⫺ animals (6). These in vitro and in vivo studies establish that CXCR2 is the receptor that mediates ELR⫹ CXC chemokine-dependent angiogenic activity.

Interferon-Inducible (ELR⫺) CXC Chemokines Are Inhibitors of Angiogenesis and Use the CXC Chemokine Receptor, CXCR3 The angiostatic members of the CXC chemokine family include PF4/CXCL4, monokine induced by interferon (IFN)-␥ (MIG/CXCL9), IFN-␥–inducible protein (IP-10/CXCL10), and IFN-inducible T cell ␣ chemoattractant (I-TAC/CXCL11) (4). MIG/CXCL9, IP-10/CXCL10, and I-TAC/CXCL11 are all highly inducible by interferons. These findings suggest that all IFN-inducible ELR⫺ CXC chemokines are potent inhibitors of angiogenesis. Moreover, this interrelationship of interferon and IFN-inducible CXC chemokines and their biological function are directly relevant to the function of Th1/Type 1 cytokines. All three IFN-inducible ELR⫺ CXC chemokines specifically bind to the CXC chemokine receptor, CXCR3, that is found on Th1 cells (8). In addition, CXCR3 is expressed on endothelial cells in a cell cycledependent manner, and this expression mediates the angiostatic activity of IP-10/CXC10, MIG/CXCL9, and I-TAC/ CXCL11 (9). We have further confirmed these finding in vivo using specific neutralizing antibodies to CXCR3. These findings provide definitive evidence of CXCR3-mediated angiostatic activity by angiostatic IFN-inducible ELR⫺ CXC chemokines. Furthermore, the expression of IFN-inducible CXC chemokines links Th1/type 1 cytokine-mediated innate and adaptive immunity with angiostasis, and may support the concept of “immunoangiostasis.”

The Role of Angiogenic (ELR⫹) and Angiostatic IFN-Inducible (ELR⫺) CXC Chemokines in Aberrant Vascular Remodeling Associated with Pulmonary Fibrosis The existence of aberrant vascular remodeling in idiopathic pulmonary fibrosis (IPF) was originally identified by TurnerWarwick, who examined the lungs of patients with IPF, and demonstrated neovascularization in areas of fibrosis and in associated with anastomoses between the systemic and pulmonary microvasculature (10). The impact of aberrant vascular remodeling in IPF has the following impact: (i ) vascular remodeling in areas of fibrosis may support fibroplasia; and/or (ii) vascular remodeling leading to anastomoses between the systemic and pulmonary microvasculature may contribute to increased right-to-left shunt and hypoxemia

S68


in IPF patients during exertional activity or in conjunction with secondary pulmonary hypertension. The finding of aberrant vascular remodeling has also been found in the pathogenesis of pulmonary fibrosis in animal models (i.e., bleomycin-induced pulmonary fibrosis) (11). These studies demonstrate that the presence of aberrant vascular remodeling is important in the pathogenesis of pulmonary fibrosis, and support the importance of further understanding the specific factors that are involved in this process. Lung tissues from patients with IPF demonstrate an imbalance in the presence of angiogenic and angiostatic CXC chemokines (12). This imbalance favors augmented net angiogenic activity (12). IPF patient lung tissues have elevated levels of IL-8/CXCL8, and in vivo angiogenic activity that can be significantly attributed to IL-8/CXCL8 (12). The pulmonary fibroblast is the predominant interstitial cellular source of IL-8/CXCL8 in the IPF lung (12). In addition, ENA-78/CXCL5 is an additional important regulator of angiogenic activity in IPF (13). The predominant cellular sources of ENA-78/CXCL5 are hyperplastic type II cells and macrophages, not fibroblasts. Studies have not shown that either ENA-78/CXCL5 or IL-8/CXCL8 is more important, but merely that they both play an important role in angiogenic activity in IPF, and they are predominantly produced by distinct populations of cells (13). Although other angiogenic factors may be involved in this process, our laboratory has found no difference in the levels of vascular endothelial growth factor (VEGF) in IPF, as compared with normal lung tissue (unpublished observations, R. M. Streiter). This supports the contention that ELR⫹ CXC chemokines are important in mediating the angiogenic activity and aberrant vascular remodeling in IPF. In contrast to the increased angiogenic activity attributable to IL-8/CXCL8, there appears to be a deficiency of the production of the angiostatic factor, IP-10/CXCL10, in IPF lung tissue (12). Interestingly, IFN-␥, a major inducer of IP-10/CXCL10 from a number of cells, is a known inhibitor of wound repair, in part due to its angiostatic properties, and has been shown to attenuate fibrosis in bleomycininduced pulmonary fibrosis (14). This supports the notion that the distal mediator of the effect of IFN-␥ is IP-10/ CXCL10, and an imbalance in the expression of this angiostatic CXC chemokine is found in IPF. These results suggest that attenuation of the angiogenic (IL-8/CXCL8) or augmentation of the angiostatic (IP-10/CXCL10) CXC chemokines may represent a viable therapeutic option for the treatment of IPF. Although the above studies demonstrate that an imbalance in angiogenic and angiostatic CXC chemokines exist in IPF, preclinical models have also supported their function in promoting or inhibiting fibrosis in bleomycin-induced pulmonary fibrosis. Macrophage inflammatory protein-2 (MIP-2/CXCL2; an angiogenic ELR⫹ CXC chemokine homologous to human GRO-␤/␥/CXCL2/3) and the angiostatic CXC chemokine, IP-10/CXCL10, directly and inversely, respectively, correlate with the extent of fibrosis during bleomycin-induced pulmonary fibrosis in mice (15, 16). Moreover, if either endogenous MIP-2/CXCL2 is depleted by passive immunization with neutralizing antibodies, or exogenous IP-10/CXCL10 is administered to the animals during bleo-

mycin exposure, both treatment strategies attenuate pulmonary fibrosis entirely attributable to a reduction in vascular remodeling in the lung (15, 16). These findings support the notion that aberrant vascular remodeling is a critical biological event that supports fibroplasia and deposition of ECM in the lung during pulmonary fibrosis, and that angiogenic and angiostatic factors, such as CXC chemokines, play an important role in the pathogenesis of this process.

Conclusion Angiogenesis that leads to aberrant vascular remodeling is regulated by an opposing balance of angiogenic and angiostatic factors. CXC chemokines are an unique cytokine family that contain members that exhibit specific structural/functional differences and receptor use for their behavior in mediating angiogenic or angiostatic biological activity. The CXC chemokines are important in the regulation of angiogenesis associated with aberrant vascular remodeling during the pathogenesis of chronic inflammatory/fibroproliferation (i.e., IPF). These findings support the notion that therapy directed at either inhibition of angiogenic or augmentation of angiostatic CXC chemokines may be a novel approach in the treatment of chronic fibroproliferative disorders, such as IPF. Acknowledgments: This section was supported, in part, by: NIH grants HL66027, CA87879, P01 HL67665, and P50 CA90388 (R.M.S.); HL04493 and the American Lung Association (J.A.B); and HL03906, P01 HL67665, and the Dalsemer Award from the American Lung Association (M.P.K.).

References 1. Luster, A. D. 1998. Chemokines: chemotactic cytokines that mediate inflammation. N. Engl. J. Med. 338:436–445. 2. Rollins, B. J. 1997. Chemokines. Blood 90:909–928. 3. Zlotnik, A., and O. Yoshie. 2000. Chemokines: a new classification system and their role in immunity. Immunity 12:121–127. 4. Belperio, J. A., M. P. Keane, D. A. Arenberg, C. L. Addison, J. E. Ehlert, M. D. Burdick, and R. M. Strieter. 2000. CXC chemokines in angiogenesis. J. Leukoc. Biol. 68:1–8. 5. Bar-Eli, M. 1999. Role of interleukin-8 in tumor growth and metastasis of human melanoma. Pathobiology 67:12–18. 6. Addison, C. L., T. O. Daniel, M. D. Burdick, H. Liu, J. E. Ehlert, Y. Y. Xue, L. Buechi, A. Walz, A. Richmond, and R. M. Strieter. 2000. The CXC chemokine receptor 2, CXCR2, is the putative receptor for ELR(⫹) CXC chemokine-induced angiogenic activity. J. Immunol. 165:5269–5277. 7. Devalaraja, R. M., L. B. Nanney, Q. Qian, J. Du, Y. Yu, M. N. Devalaraja, and A. Richmond. 2000. Delayed wound healing in CXCR2 knockout mice. J. Invest. Dermatol. 115:234–244. 8. Cole, K. E., C. A. Strick, T. J. Paradis, K. T. Ogborne, M. Loetscher, R. P. Gladue, W. Lin, J. G. Boyd, B. Moser, D. E. Wood, B. G. Sahagan, and K. Neote. 1998. Interferon-inducible T cell alpha chemoattractant (I-TAC): a novel non-ELR CXC chemokine with potent activity on activated T cells through selective high affinity binding to CXCR3. J. Exp. Med. 187:2009– 2021. 9. Romagnani, P., F. Annunziato, L. Lasagni, E. Lazzeri, C. Beltrame, M. Francalanci, M. Uguccioni, G. Galli, L. Cosmi, L. Maurenzig, M. Baggiolini, E. Maggi, S. Romagnani, and M. Serio. 2001. Cell cycle-dependent expression of CXC chemokine receptor 3 by endothelial cells mediates angiostatic activity. J. Clin. Invest. 107:53–63. 10. Turner-Warwick, M. 1963. Precapillary systemic-pulmonary anastomoses. Thorax 18:225–237. 11. Peao, M. N. D., A. P. Aguas, C. M. DeSa, and N. R. Grande. 1994. Neoformation of blood vessels in association with rat lung fibrosis induced by bleomycin. Anat. Rec. 238:57–67. 12. Keane, M. P., D. A. Arenberg, J. P. Lynch III, R. I. Whyte, M. D. Iannettoni, M. D. Burdick, C. A. Wilke, S. B. Morris, M. C. Glass, B. DiGiovine, S. L. Kunkel, and R. M. Strieter. 1997. The CXC chemokines, IL-8 and IP-10, regulate angiogenic activity in idiopathic pulmonary fibrosis. J. Immunol. 159:1437–1443.


13. Keane, M. P., J. A. Belperio, M. D. Burdick, J. P. Lynch, M. C. Fishbein, and R. M. Strieter. 2001. ENA-78 is an important angiogenic factor in idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 164:2239– 2242. 14. Hyde, D. M., T. S. Henderson, S. N. Giri, N. K. Tyler, and M. Y. Stovall. 1988. Effect of murine gamma interferon on the cellular responses to bleomycin in mice. Exp. Lung Res. 14:687–695. 15. Keane, M. P., J. A. Belperio, D. A. Arenberg, M. D. Burdick, Z. J. Xu,

S69

Y. Y. Xue, and R. M. Strieter. 1999. IFN-gamma–inducible protein-10 attenuates bleomycin-induced pulmonary fibrosis via inhibition of angiogenesis. J. Immunol. 163:5686–5692. 16. Keane, M. P., J. A. Belperio, T. A. Moore, B. B. Moore, D. A. Arenberg, R. E. Smith, M. D. Burdick, S. L. Kunkel, and R. M. Strieter. 1999. Neutralization of the CXC chemokine, macrophage inflammatory protein-2, attenuates bleomycin-induced pulmonary fibrosis. J. Immunol. 162: 5511–5518.

S70


Possible Roles for Apoptosis and Apoptotic Cell Recognition in Inflammation and Fibrosis In thinking about the life history of the inflammatory response and its relationship to tissue protection and repair, whether this latter involves return to normal structure and function or to fibrosis, we would argue the need to “consider the apoptotic cell.” In a simple model, injury, meaning cell damage and disruption of normal structure, leads to inflammation as the so-called first line of defense. In the majority of circumstances, inflammation resolves naturally and the tissue returns to normal, i.e., any damaged cells are replaced and the overall tissue architecture is restored. In recent years, an increasing focus has been placed on these elements of resolution, and even more recently on the mechanisms and consequences of removal of both the initially damaged cells and the incoming leukocytes that constitute the key element of the inflammatory process itself. The emigrating granulocyte has a built-in death program that can be modified to delay or speed up the process, but leads inevitably to apoptosis. Most tissue cell damage exhibits elements of apoptosis as well, and even though much has been made in the recent literature about the differences in tissue response to apoptotic versus necrotic cells (a difference first brought to attention by Stern and coworkers [1]), these differences are by no means as black and white as is often suggested, and the actual removal mechanisms for damaged cells have much in common, whatever the process by which they die. What may be critical to the outcome to the tissue of the cell death is the environment in which the dying cell finds itself, and the available receptors involved in its recognition. Intriguingly, recognition of apoptotic and dying cells, as well as of the cell debris after cytolysis, shows many features in common with recognition processes in the innate immune system. Because removal of unwanted and damaged cells may be considered a necessity to all multicellular organisms, it is not unreasonable to suggest an evolutionary connection between the two systems. These recognition receptors include a variety of scavenger receptors, integrins, lectins, etc., and appear at the moment to fall into two classes. Some are extracellular ligands with binding sites for both the apoptotic or damaged cell as well as for molecules on the surface of the phagocyte—i.e., bridge molecules. Other appear to be surface “receptors” on the phagocyte itself. Some of these recognition structures are illustrated in Figure 1. Of some interest are the collectin family of molecules, including the surfactant proteins (SP)-A and SP-D, as well as mannose-binding lectin (MBL) and C1q. These multimeric extracellular proteins exhibit globular head groups able to function as typical pattern recognition molecules for detection of pathogen-associated molecular patterns (PAMPs).

This section was written by Peter M. Henson (Program in Cell Biology, Department of Pediatrics, National Jewish Medical and Research Center, Denver; and Division of Pulmonary and Critical Care Medicine, University of Colorado Health Science Center, Denver, Colorado).

They can variously bind to selective carbohydrates, lipids, and proteins, and through effects of their conserved collagenous tails, initiate uptake into cells. A similar recognition and uptake of apoptotic cells (and of cell debris) has been suggested for all four of these molecules (2–5). Acting as bridge molecules, their collagenous tails have been suggested to interact with cell surface calreticulin (2, 5–8). This is a multifunctional protein, residing in the endoplasmic reticulum but now also identified on most cells surfaces (at least in vitro). Because it has no transmembrane domains, it functions as a signaling “receptor” in conjunction with a partner, suggested to be the important internalization molecule CD91 (also known as the LDL receptor–related protein [LRP] or the ␣2-macroglobulin receptor). CD91 is known to bind and internalize a host of materials (9, 10), and, by virtue of its orthologous intracellular signaling domain, may be conserved evolutionarily, at least as far as the nematodes (11). In contrast to the collectins or scavenger receptors, the group of innate immune system pattern recognition molecules, currently receiving the most attention (the Toll-like receptors, TLRs), do not seem to be heavily involved in recognition of apoptotic cells, although they may play a role in removal of cell debris. Surprisingly, the surface changes on the apoptotic cell that lead to its recognition are significantly understudied. The most clear-cut change is the persistent expression of phosphatidylserine (PS), a class of phospholipids normally found on the inner leaflet of the plasma membrane (12–19). PS expression appears to be a common feature of most cells undergoing apoptosis (13). A number of putative “receptors” for apoptotic cells have been suggested to bind to this PS, including a variety of scavenger receptors as well as some of the bridging molecules (e.g., Gas-6 [20], Protein S [21], and MFG-E8 [22]). A specific PS receptor has also been identified, is found on most cell surfaces, and appears to be an important component of the recognition and removal, as well as its sequelae (14, 23, 24). The ingestion of apoptotic cells is suggested to be mediated by a unique and highly conserved process that we are now calling “efferocytosis,” from the Latin “to carry to the grave” or “to bury.” The mechanisms appear more closely related to macropinocytosis than to the “classic” phagocytosis defined for uptake mediated through the immunoglobulin Fc receptor. It may also require two, often separable, steps—tethering of the cell or particle followed by the actual signaling for uptake (Figure 2). Importantly, most cell types in the body appear capable of this recognition and removal, from endothelial and epithelial cells through smooth muscle cells and fibroblasts to the so-called professional phagocytes, macrophages, and immature dendritic cells. Macrophages are more efficient and may exhibit a greater variety of receptors for apoptotic cells as well as variable usage of specific signaling molecules from site to site in the body and within the lung (see for example Ref 25). Nevertheless, the fundamental processes appear very widely distributed and highly conserved.


S71

Figure 1. Some of the receptors and bridge molecules that have been linked to recognition, removal, and tissue response to apoptotic cells.

These observations and comments therefore set the stage for asking what might be the role or roles played by apoptotic cells in the resolution of inflammation and/or the development of pulmonary fibrosis.

The Anti-Inflammatory Consequences of Apoptotic Cell Recognition Apoptotic cells are cleared in vivo with minimal local reaction. This has been suggested to result from an active production of anti-inflammatory mediators, particularly transforming growth factor (TGF)-␤ and anti-inflammatory prostanoids (23, 26–28). Production of these mediators, and suppression of proinflammatory molecules, has been demonstrated both in vitro and in vivo; indeed, the direct instillation of apoptotic cells into inflamed lungs was shown to hasten the resolution process in a TGF-␤–dependent manner (27). Experiments in vitro and within the lung also support the suggestion that it is the PS upon the apoptotic cell, and its recognition by the PS receptor, that is one of the main elements involved in this anti-inflammatory effect. Increasingly, it is becoming apparent that PS may also mediate an anti-immunogenic action as well (likely mediated via suppression of the inflammatory components of the “adjuvant” effect) (29, 30)—leading to modulation of the adaptive immune response and perhaps contributing to inadequate inflammatory and immunologic responses to neoplasia. One implication that can be taken from these observations is that abnormalities of this recognition and removal might be associated with defective resolution of inflammation. Support for this contention was supplied from studies of cystic fibrosis, where persistent inflammation was found associated with increased numbers of uncleared apoptotic neutrophils (31). A positive inflammatory feedback loop was suggested whereby inadequately cleared neutrophils underwent cytolysis, with release of cellular contents, including proteases such as elastase. This has been shown to cleave the surface PS receptor (31, 32), and would be expected to lead, in turn, to defects in recognition and removal of apoptotic cells and cell debris. It is not difficult to imagine

a similar effect in various forms of chronic obstructive pulmonary disease (COPD) in which increased apoptotic cells can be detected (33). We suggest a balance between anti- and proinflammatory consequences of apoptotic cells or cell debris recognition, depending on the availability and/or function of the PS receptor (Figure 3). Foreign organisms often do not express PS on their surface (in part because of delimiting cell walls). Cytolysed cells (a term we prefer to “necrotic” cells in this context) may indeed express PS, both because of surface membrane expression but also because the internal PS is now exposed. However, in the presence of intracellular proteases (to remove the responding PS receptor) and/or of intracellular annexins and other PS-binding proteins (to block the exposed PS and prevent its interaction with the receptor), cytolysed cells may be expected to be much less anti-inflammatory (32). Indeed, in the absence of PS receptor function we predict that engagement of calreticulinCD91 and/or Toll-like receptors will now generate unrestricted proinflammatory responses. On the other hand, when a cell becomes apoptotic in a tissue, from whatever cause, we suggest a quiet, nonreactive, and very efficient removal without any generation of inflammatory signals (see below). An immediate paradox arises. With all these anti-inflammatory effects, how does the acute inflammation get going in the first place? The life span of emigrating neutrophils might be long enough for a lag period of a few hours before their apoptosis would stimulate the anti-inflammatory response. However, we also raise the possibility that early release/secretion of elastase and other proteases would lead to a transient removal of existing PS receptor on cells of the tissue (e.g., lung). This would allow development of the full inflammatory response before the inhibitory processes kick in. Accumulation of antiproteases, for example in the inflammatory exudate, could then provide an opportunity for the PS receptor to recover and the apoptotic cells then to start triggering the resolution (see Figure 4). There is as yet little direct evidence for this explanation, but it is

Figure 2. A model for two-step signaling (a tether and tickle effect) for apoptotic uptake into professional or nonprofessional phagocytes by efferocytosis, a unique process related to macropinocytosis (23). The model suggests the involvement of both tethering ligands (diamond shape) as well as of signaling receptors that actually mediate the transmembrane instructions for membrane ruffling and efferocytosis.

Figure 3. A proposed switching mechanism whereby recognition of phosphatidylserine (PS) by a PS receptor leads both to suppression of inflammation and immunity and generation of possible replenishment signals for restoration of normal tissue structure and function. Interaction of the phagocyte with foreign organisms or cell debris that does not express PS on the membrane can lead, via a wide variety of innate or adaptive immune receptors, to the generation of proinflammatory mediators. However, if the PSR is engaged, the effects of many of these receptors are overcome, and production of proinflammatory mediators is suppressed (indicated here as a PSR-on switch). The susceptibility of the PSR to serine protease cleavage suggests that in the presence of a protease–antiprotease imbalance, the PSR switch is inactive and that inflammation may not be turned off. Please note that, although uptake of apoptotic cells and the generation of anti-inflammatory responses are associated and driven in part by the same receptors, they are not interdependent, i.e., suppression of inflammation can occur without actual ingestions of the apoptotic cell.

Figure 4. Modeling the acute inflammatory response. One hypothetical sequence of events associated with responses to apoptotic cells and their removal. Initial emigration of neutrophils would result in release of proteases with digestion of PSR in the lung (red line). As vascular permeability increases, influx of antiproteases would reverse this effect, leading to upregulation of PSR on cells or new cells that express it (black line) and the production of anti-inflammatory molecules such as TGF-␤ (brown line). Lung collectins also serve an anti-inflammatory role and are known to be decreased during acute inflammation (blue line). Their return during resolution would assist in the restoration of an anti-inflammatory environment.


eminently testable. Deliberately, in outlining this concept we do not define the cells within the tissue that may be expressing, losing, and then re-expressing the PS receptor. We do not, at this point, know enough about its regulation to speculate. Incoming monocytes maturing into macrophages may themselves supply sufficient new receptor and its consequences. In this regard, it is noteworthy that apoptotic cells and TGF-␤ seem selectively not to suppress the production of MCP-1, a monocyte chemotactic chemokine (34, 35).

Potential Profibrotic Consequences of Resolution of Inflammation The presence, and role, of active TGF-␤ (as well as other products including prostanoids) in the resolution immediately raises the possibility of contribution of this known profibrotic agent to subsequent fibrosis. In fact, the critical question that might be asked at the outset is: why does fibrosis not occur more frequently and as a “normal” response to resolution of inflammation? It seems reasonable to suppose that a diminishing supply of apoptotic cells would also result in a decreasing supply of TGF-␤. However, we do not know at what levels or location, TGF-␤ reaches a critical concentration with regard to fibrotic responses. In addition, altered amounts of putative inhibitors of TGF-␤, production, activation, and effect may also play a critical, but as yet unappreciated, role. Defects in “normal” downregulation of TGF-␤ supply or action would seem a reasonable contributor to fibrosis. In this regard, repetitive or continuous supply of apoptotic cells, whether from inflammation or other sources, would have to be considered a possibility. On the other hand, questions raised at this symposium (M. Selman) as well as elsewhere have challenged the longstanding concept that inflammation and fibrosis are related, at least with regard to some forms of idiopathic pulmonary fibrosis (IPF). Fibrotic responses in wound healing, in the skin or elsewhere, are usually associated with earlier inflammatory responses and may well fit the parameters discussed above for relationships to resolution of severe inflammatory responses. For the most part, this type of “fibrosis” seen as a component or extension of granulation tissue production in the skin, is reversible over time. In fact, its removal (resolution) may often be associated with, and possibly caused by, restoration of the normal epithelium. In the lung, cryptogenic organizing pneumonia (COP), also known as bronchiolitis obliterans organizing pneumonia (BOOP), may be closer to this type of response. To understand the pathogenesis of the progressive fibrosis seen in UIP, we may need to consider different processes and, indeed, perhaps completely rethink the role of inflammation. However, before addressing this question directly, a discussion of cell turnover in normal tissues may help set the stage.

Apoptosis and Ongoing Cell Turnover Overproduction of cells during development seems to be the norm (see Ref. 36), requiring selective removal of excess, unwanted cells or those that have completed their function. What is becoming increasingly apparent is that this cell turnover does not cease in the adult animal. One of the

S73

reasons that this has not been more obvious is that the death of individual cells is accompanied so rapidly by uptake and removal. In the absence of local tissue reaction, snapshot examination of tissues will not, and does not, reveal much evidence of cell death and replacement. Four examples will serve to strengthen this point. It has been estimated that in the adult human being, the total circulating pool of neutrophils turns over 2.5 times per day (37). This represents removal of ⵑ 1011 cells, but is a process that is almost completely invisible. The neutrophils are cleared primarily in the liver and to a lesser extent in the spleen. They are presumed to undergo apoptosis with subsequent recognition by the mechanisms outlined above. Other examples come from the effects of defective recognition or removal receptors. One of the putative “receptors” involved in apoptotic cell recognition is the membrane tyrosine kinase, Mer. Although its exact role in the process is not yet clear, it is a receptor for the PS-binding protein, Gas-6 (38, 39). Importantly, transgenic mice with a kinasedead form of this protein (or a deficiency) show defects in apoptotic cell clearance, both within isolated cells and in the animal as a whole (38, 39). Induction of apoptosis in thymocytes by administration of dexamethasone leads to death and removal of most of the thymocytes in normal mice—but with no more than 4.4% of these apoptotic cells being detectable in the tissue at any one time. On the other hand, in the Merkd animals, many apoptotic cells (⬎ 32%) were easily visible within the thymus. Using the same approach, search for apoptotic cells in the normal adult lung reveals very few at any given time. However, in animals deficient in CD14, another molecule with a suspected role in apoptotic cell removal (40), up to eight times as many apoptotic cells could be detected (Chris Gregory, Edinburgh University, personal communication). Although there are additional possibilities for this latter finding, the implication is still that there may be significantly more cell turnover in many (most?) tissues than is usually appreciated, and that this may only become readily apparent when studied directly and/or when normal clearance is defective or blocked. The last example comes from cystic fibrosis and bronchiectasis as outlined above (31). In the presence of proteases, decreased apoptotic cell clearance leads to easily detected apoptotic neutrophils in the lungs, a situation to be contrasted with neutrophil-dominated pulmonary inflammatory reactions such as ARDS or bacterial pneumonia, where almost no apoptotic granulocytes can be found at any one time despite significant ongoing clearance. A number of additional points follow from these concepts. First, the potential triggers for tissue cell death are multiple. However, exposure of the respiratory epithelium to the external environment, and anything small enough to be inhaled, might make it particularly susceptible, even in the face of significant protections. In this context, the human being may be even more susceptible as a uniquely mouthbreathing mammal. The high oxygen tension that cells of the lung are exposed to would only add to their potential for injury. An epithelial (or even endothelial) cell undergoing injury or apoptosis that exposes PS on its surface can be recognized by neighboring epithelial cells, to both stimulate them and initiate removal of the damaged cell. The presence

S74


Figure 5. An representative experiment demonstrating uptake of apoptotic cells into epithelial cells (in this case primary alveolar type II cells) and partial blockade by an antibody against the PS receptor. (Courtesy of Valerie Fadok and Robert Mason.)

of macrophages could enhance this process, but may not be necessary. Thus, other situations involving apoptotic cell clearance, as in involution of the murine mammary gland (41) or removal of the interdigitary webs (42) during development, do not require macrophages. An additional contribution to the removal may be an effect of the neighboring epithelial cells to actively extrude the damaged cell from the epithelium (43). Second, as noted above, cell types found in the alveolar wall can recognize and ingest apoptotic cells and cell debris (e.g., Refs. 44, 45). For example, a simple experiment showing uptake of apoptotic cells into cultured Type II alveolar epithelial cells is depicted in Figure 5. Third, removal locally is for the most part quiet and non-inflammatory. The implication is either that efferocytosis of apoptotic cells by tissue cells does not induce inflammatory mediators or that, like macrophages, they produce anti-inflammatory mediators. Most tissue cell types appear capable of synthesizing and secreting TGF-␤, cells of the alveolar wall being no exception. Indeed, studies with epithelial cells and fibroblasts in culture have shown the production of TGF-␤ after stimulation with apoptotic cells or activating antibody against the PS receptor (23 and H. Collard and P. Henson, unpublished observations). It is intriguing to speculate that the spontaneous pulmonary inflammation seen in mice genetically deficient in TGF-␤1 (46) may result in part from removal of this natural suppression. A fourth and most important point is that, in normal circumstances in the adult, the damaged cell(s) is rapidly replaced to maintain tissue homeostasis. The signals for this replacement, source of cells, etc. are generally poorly understood in any tissue, including the lung. Here we propose that recognition of apoptotic cells itself induces the production of replenishment stimuli from the responding cell—whether this be a macrophage, or more likely, neighboring, intact, tissue cells. Evidence for this concept is just beginning to appear. In our own studies, epithelial cell lines have been shown to produce vascular endothelial growth factor in response to apoptotic cells or PS receptor ligation (Golpon and coworkers, unpublished observations). Whether this type of response contributes to the abnormal neovascularization seen in UIP (see section by Streiter and coworkers

in this Supplement) remains to be determined. Morimoto and colleagues report production of hepatocyte growth factor from macrophages in response to apoptotic cells (47). We suspect that this is just the tip of an iceberg, and that production of selected growth factors (replenishment signals) may be a general response of cells to apoptotic cell interaction, perhaps with some specificity for the types of growth factors generated among different responding cell types. The finding of type II epithelial cell hyperplasia in human interstitial lung diseases (see, for example, Figure 6) may represent such a response. Whether the PS receptor (as suggested in Figure 3) will turn out to be the key stimulus for this response, as it may be for TGF-␤ production, remains to be determined. A paradox arises here. TGF-␤ and other members of this family of molecules often act as antiproliferative agents. A competition with the “replenishment” signals might therefore be expected. Under homeostatic conditions, a balance might be expected, perhaps based on timing, whereby the TGF-␤ effects (suppression of inflammation, etc.) are switched off before the major replenishment is accomplished. An important alternative or additional control may be geographical, with different effects at different sites within the lesions. Pursuit of these questions would appear to represent an area worth some investigative effort.

Models for Progressive versus Resolving Fibrotic Responses Putting these concepts together, we tentatively present the following concepts. Resolution of inflammatory reactions involves removal of apoptotic and damaged cells, engagement of the PS receptor, and generation of TGF-␤. In the normal, acute process, there may be little fibrotic response and minimal production of granulation tissue. In a skin wound, the response to damage and inflammation usually involves fibrin formation and a resolution process that includes development of granulation tissue, i.e., a vascularized fibrotic response. However, as the epithelium reforms, the granulation tissue resolves and the skin usually returns to normal structure and function. Such a resolvable inflammatory and fibrotic reaction may be seen in mouse models of “pulmonary fibrosis,” in particular those generated in the standard bleomycin systems. It may also represent the type of “fibrotic” response seen in COP, as well as in some of the other forms of human interstitial lung disease. By contrast, epithelial damage in the absence of an inflammatory response, i.e., with reduced brakes or inhibitory mechanisms, could allow for a progressive fibrotic process. Stimulation of neighboring cells by apoptotic cell surfaces leading to unregulated TGF-␤ production could lead to an active, and perhaps progressive, fibrosis. It should be noted here that we have not addressed the issue of TGF-␤ regulation at the level of its extracellular activation, even while recognizing that this is likely to be of critical importance. There are many ways in which this molecule may be activated, especially in the lung and in the presence of inflammatory cells, and much work will be needed before we can really understand the interplay between them. In the absence of inflammation, the PS receptor might remain unregulated, leading to more TGF-␤, the TGF-␤ itself could persist, and there might also be positive feedback loops


S75

Figure 6. Electron micrograph depicting type II epithelial cell hyperplasia in a patient suffering from ILD associated with scleroderma. (Courtesy of Jan Henson.)

involving increased apoptosis and more stimulation. We strongly implicate the epithelium in these processes at two levels: as an initial target for injury/turnover, and as a normally regulating agent to stop ongoing fibrosis or even induce its resolution. Re-epithelialization is here proposed to be a critical regulatory step, even if we do not know in vivo at which point the new epithelial cells may be acting (fibroblast proliferation, differentiation to myofibroblasts, matrix production, fibroblasts/myofibroblast apoptosis, etc.). Alveolar epithelial hyperplasia (Figure 6) may represent a possible attempt to resolve the fibrosis. If so, one might question abnormalities at the level of this epithelial cell function as an additional explanation for individual susceptibility to progressive fibrosis. Supporting evidence for a protective effect of inflammation and granulocyte accumulation on progressive fibrosis comes in part from studies such as that by Thrall and colleagues, in which, even in the bleomycin model, depletion of neutrophils led to a more extensive fibrotic change than in their presence (48). In humans, smoking may possibly be associated with a less negative outcome in pulmonary fibrosis (49)—an effect that might fit this explanation. Definitive tests of these hypotheses are sorely needed. What determines why some individuals get trapped into this type of progressive, perhaps noninflammatory, response is of course completely unclear. As usual when this question arises, one can fall back on not unreasonable possibilities arising from the genetic background. What may be possible in the future, as some of the concepts outlined above are supported or not by further experimentation in humans, animals, and in vitro, is to examine some of them in patients themselves to try and dissect out candidate areas for applying questions of genetic or environmental effects. Consider then the apoptotic cell, not for itself, but for our response to it. We suggest that apoptosis is an ongoing process in all tissues, but particularly the lung because of its exposure to the external environment and high oxygen

tension. Normally, apoptotic cells are recognized, removed, and replaced with little tissue response. However, the paradox is that the chief agent for this lack of inflammatory response appears to be TGF-␤, itself the prime candidate under appropriate conditions to induce tissue fibrosis. In the presence of inflammation, appropriate regulatory elements are suggested to lead to resolving lesions, either without any fibrosis or even of some, vascularized, types of fibrotic response. If, for reasons unknown at this time, the tissue damage (particularly, perhaps, of epithelial cells) is mild or scattered enough to avoid the development of inflammation and perhaps persistent as well, a different type of fibrosis may ensue, one that is progressive and unregulated, is in parts avascular, and perhaps unique to the lung. If enough alveolar epithelium is destroyed without replenishment, loss of surfactant could lead to alveolar collapse, with its own consequences for inappropriate repair. Finally, we suspect that before a more complete understanding of pulmonary fibrogenesis can be obtained, a more detailed appreciation of the effects of geography will be needed. As in other walks of life, it may be important to remember the slogan: location, location, location. Acknowledgments: This work was supported by USPHS grants HL 67671 and GM 48211.

References 1. Stern, M., J. Savill, and C. Haslett. 1996. Human monocyte-derived macrophage phagocytosis of senescent eosinophils undergoing apoptosis: mediation by alpha v beta 3/CD36/thrombospondin recognition mechanism and lack of phlogistic response. Am. J. Pathol. 149:911–921. 2. Ogden, C. A., A. deCathelineau, P. R. Hoffmann, D. Bratton, B. Ghebrehiwet, V. A. Fadok, and P. M. Henson. 2001. C1q and mannose binding lectin engagement of cell surface calreticulin and CD91 initiates macropinocytosis and uptake of apoptotic cells. J. Exp. Med. 194:781–795. 3. Taylor, P. R., A. Carugati, V. A. Fadok, H. T. Cook, M. Andrews, M. C. Carroll, J. S. Savill, P. M. Henson, M. Botto, and M. J. Walport. 2000. A hierarchical role for classical pathway complement proteins in the clearance of apoptotic cells in vivo. J. Exp. Med. 192:359–366. 4. Schagat, T. L., J. A. Wofford, and J. R. Wright. 2001. Surfactant protein A enhances alveolar macrophage phagocytosis of apoptotic neutrophils. J. Immunol. 166:2727–2733.

S76


5. Vandivier, R. W., C. A. Ogden, V. A. Fadok, P. R. Hoffmann, K. K. Brown, M. Botto, M. J. Walport, J. H. Fisher, P. M. Henson, and K. E. Greene. 2002. Role of surfactant proteins A, D, and C1q in the clearance of apoptotic cells in vivo and in vitro: calreticulin and CD91 as a common collectin receptor complex. J. Immunol. 169:3978–3986. 6. Sim, R. B., S. K. Moestrup, G. R. Stuart, N. J. Lynch, J. Lu, W. J. Schwaeble, and R. Malhotra. 1998. Interaction of C1q and the collectins with the potential receptors calreticulin (cC1qR/collectin receptor) and megalin. Immunobiology 199:208–224. 7. Stuart, G. R., N. J. Lynch, A. J. Day, W. J. Schwaeble, and R. B. Sim. 1997. The C1q and collectin binding site within C1q receptor (cell surface calreticulin). Immunopharmacology 38:73–80. 8. Reid, K. B., M. Colomb, F. Petry, and M. Loos. 2002. Complement component C1 and the collectins–first-line defense molecules in innate and acquired immunity. Trends Immunol. 23:115–117. 9. Basu, S., R. J. Binder, T. Ramalingam, and P. K. Srivastava. 2001. CD91 is a common receptor for heat shock proteins gp96, hsp90, hsp70, and calreticulin. Immunity 14:303–313. 10. Herz, J., and D. K. Strickland. 2001. LRP: a multifunctional scavenger and signaling receptor. J. Clin. Invest. 108:779–784. 11. Su, H. P., K. Nakada-Tsukui, A. C. Tosello-Trampont, Y. Li, G. Bu, P. M. Henson, and K. S. Ravichandran. 2002. Interaction of CED-6/GULP, an adapter protein involved in engulfment of apoptotic cells, with CED-1 and CD91/LRP. J. Biol. Chem. 277:11772–11779. 12. Fadok, V. A., D. R. Voelker, P. A. Campbell, J. J. Cohen, D. L. Bratton, and P. M. Henson. 1992. Exposure of phosphatidylserine on the surface of apoptotic lymphocytes triggers specific recognition and removal by macrophages. J. Immunol. 148:2207–2216. 13. Martin, S. J., C. P. Reutelingsperger, A. J. McGahon, J. A. Rader, R. C. van Schie, D. M. LaFace, and D. R. Green. 1995. Early redistribution of plasma membrane phosphatidylserine is a general feature of apoptosis regardless of the initiating stimulus: inhibition by overexpression of Bcl-2 and Abl. J. Exp. Med. 182:1545–1556. 14. Fadok, V. A., A. de Cathelineau, D. L. Daleke, P. M. Henson, and D. L. Bratton. 2001. Loss of phospholipid asymmetry and surface exposure of phosphatidylserine is required for phagocytosis of apoptotic cells by macrophages and fibroblasts. J. Biol. Chem. 276:1071–1077. 15. Frasch, S. C., P. M. Henson, J. M. Kailey, D. A. Richter, M. S. Janes, V. A. Fadok, and D. L. Bratton. 2000. Regulation of phospholipid scramblase activity during apoptosis and cell activation by protein kinase Cdelta. J. Biol. Chem. 275:23065–23073. 16. Fadok, V. A., D. L. Bratton, S. C. Frasch, M. L. Warner, and P. M. Henson. 1998. The role of phosphatidylserine in recognition of apoptotic cells by phagocytes. Cell Death Differ. 5:551–562. 17. Bratton, D. L., V. A. Fadok, D. A. Richter, J. M. Kailey, L. A. Guthrie, and P. M. Henson. 1997. Appearance of phosphatidylserine on apoptotic cells requires calcium-mediated nonspecific flip-flop and is enhanced by loss of the aminophospholipid translocase. J. Biol. Chem. 272:26159– 26165. 18. Williamson, P., S. van den Eijnde, and R. A. Schlegel. 2001. Phosphatidylserine exposure and phagocytosis of apoptotic cells. Methods Cell Biol. 66: 339–364. 19. Krahling, S., M. K. Callahan, P. Williamson, and R. A. Schlegel. 1999. Exposure of phosphatidylserine is a general feature in the phagocytosis of apoptotic lymphocytes by macrophages. Cell Death Differ. 6:183–189. 20. Ishimoto, Y., K. Ohashi, K. Mizuno, and T. Nakano. 2000. Promotion of the uptake of PS liposomes and apoptotic cells by a product of growth arrestspecific gene, gas6. J. Biochem. (Tokyo) 127:411–417. 21. Anderson, H. A., C. A. Maylock, J. A. Williams, C. P. Paweletz, H. Shu, and E. Shacter. 2003. Serum-derived protein S binds to phosphatidylserine and stimulates the phagocytosis of apoptotic cells. Nat. Immunol. 4:87–91. 22. Hanayama, R., M. Tanaka, K. Miwa, A. Shinohara, A. Iwamatsu, and S. Nagata. 2002. Identification of a factor that links apoptotic cells to phagocytes. Nature 417:182–187. 23. Hoffmann, P. R., A. M. deCathelineau, C. A. Ogden, Y. Leverrier, D. L. Bratton, D. L. Daleke, A. J. Ridley, V. A. Fadok, and P. M. Henson. 2001. Phosphatidylserine (PS) induces PS receptor-mediated macropinocytosis and promotes clearance of apoptotic cells. J. Cell Biol. 155:649–659. 24. Fadok, V. A., D. L. Bratton, D. M. Rose, A. Pearson, R. A. Ezekewitz, and P. M. Henson. 2000. A receptor for phosphatidylserine-specific clearance of apoptotic cells. Nature 405:85–90. 25. Todt, J. C., B. Hu, A. Punturieri, J. Sonstein, T. Polak, and J. L. Curtis. 2002. Activation of protein kinase C beta II by the stereo-specific phosphatidylserine receptor is required for phagocytosis of apoptotic thymocytes by resident murine tissue macrophages. J. Biol. Chem. 277:35906– 35914. 26. Fadok, V. A., D. L. Bratton, A. Konowal, P. W. Freed, J. Y. Westcott, and P. M. Henson. 1998. Macrophages that have ingested apoptotic cells

27. 28.

29.

30.

31.

32. 33.

34.

35.

36. 37. 38.

39. 40. 41. 42.

43. 44. 45. 46. 47.

48. 49.

in vitro inhibit proinflammatory cytokine production through autocrine/ paracrine mechanisms involving TGF-beta, PGE2, and PAF. J. Clin. Invest. 101:890–898. Huynh, M. L., V. A. Fadok, and P. M. Henson. 2002. Phosphatidylserinedependent ingestion of apoptotic cells promotes TGF-beta1 secretion and the resolution of inflammation. J. Clin. Invest. 109:41–50. Freire-de-Lima, C. G., D. O. Nascimento, M. B. Soares, P. T. Bozza, H. C. Castro-Faria-Neto, F. G. de Mello, G. A. DosReis, and M. F. Lopes. 2000. Uptake of apoptotic cells drives the growth of a pathogenic trypanosome in macrophages. Nature 403:199–203. Gaipl, U. S., T. D. Beyer, I. Baumann, R. E. Voll, C. M. Stach, P. Heyder, J. R. Kalden, A. Manfredi, and M. Herrmann. 2003. Exposure of anionic phospholipids serves as anti-inflammatory and immunosuppressive signal–implications for antiphospholipid syndrome and systemic lupus erythematosus. Immunobiology 207:73–81. Stach, C. M., X. Turnay, R. E. Voll, P. M. Kern, W. Kolowos, T. D. Beyer, J. R. Kalden, and M. Herrmann. 2000. Treatment with annexin V increases immunogenicity of apoptotic human T-cells in Balb/c mice. Cell Death Differ. 7:911–915. Vandivier, R. W., V. A. Fadok, C. A. Ogden, P. R. Hoffmann, J. D. Brain, F. J. Accurso, J. H. Fisher, K. E. Greene, and P. M. Henson. 2002. Impaired clearance of apoptotic cells from cystic fibrosis airways. Chest 121:89S–90S. Fadok, V. A., D. L. Bratton, L. Guthrie, and P. M. Henson. 2001. Differential effects of apoptotic versus lysed cells on macrophage production of cytokines: role of proteases. J. Immunol. 166:6847–6854. Kasahara, Y., R. M. Tuder, C. D. Cool, D. A. Lynch, S. C. Flores, and N. F. Voelkel. 2001. Endothelial cell death and decreased expression of vascular endothelial growth factor and vascular endothelial growth factor receptor 2 in emphysema. Am. J. Respir. Crit. Care Med. 163:737–744. McDonald, P. P., V. A. Fadok, D. Bratton, and P. M. Henson. 1999. Transcriptional and translational regulation of inflammatory mediator production by endogenous TGF-beta in macrophages that have ingested apoptotic cells. J. Immunol. 163:6164–6172. Xiao, Y. Q., K. Malcolm, G. S. Worthen, S. Gardai, W. P. Schiemann, V. A. Fadok, D. L. Bratton, and P. M. Henson. 2002. Cross-talk between ERK and p38 MAPK mediates selective suppression of pro-inflammatory cytokines by transforming growth factor-beta. J. Biol. Chem. 277:14884–14893. Cohen, J. 2001. Knife-edge of design. Nature 411:529. Wintrobe, M. 1981. Clinical Hematology. Lea & Feibiger, Philadelphia, PA. Cohen, P. L., R. Caricchio, V. Abraham, T. D. Camenisch, J. C. Jennette, R. A. Roubey, H. S. Earp, G. Matsushima, and E. A. Reap. 2002. Delayed apoptotic cell clearance and lupus-like autoimmunity in mice lacking the c-mer membrane tyrosine kinase. J. Exp. Med. 196:135–140. Scott, R. S., E. J. McMahon, S. M. Pop, E. A. Reap, R. Caricchio, P. L. Cohen, H. S. Earp, and G. K. Matsushima. 2001. Phagocytosis and clearance of apoptotic cells is mediated by MER. Nature 411:207–211. Gregory, C. D., A. Devitt, and O. Moffatt. 1998. Roles of ICAM-3 and CD14 in the recognition and phagocytosis of apoptotic cells by macrophages. Biochem. Soc. Trans. 26:644–649. Monks, J., F. J. Geske, L. Lehman, and V. A. Fadok. 2002. Do inflammatory cells participate in mammary gland involution? J. Mammary Gland Biol. Neoplasia 7:163–176. Wood, W., M. Turmaine, R. Weber, V. Camp, R. A. Maki, S. R. McKercher, and P. Martin. 2000. Mesenchymal cells engulf and clear apoptotic footplate cells in macrophageless PU.1 null mouse embryos. Development 127:5245–5252. Rosenblatt, J., M. C. Raff, and L. P. Cramer. 2001. An epithelial cell destined for apoptosis signals its neighbors to extrude it by an actin- and myosindependent mechanism. Curr. Biol. 11:1847–1857. Kresch, M. J., C. Christian, F. Wu, and N. Hussain. 1998. Ontogeny of apoptosis during lung development. Pediatr. Res. 43:426–431. Schittny, J. C., V. Djonov, A. Fine, and P. H. Burri. 1998. Programmed cell death contributes to postnatal lung development. Am. J. Respir. Cell Mol. Biol. 18:786–793. Kulkarni, A. B., and S. Karlsson. 1997. Inflammation and TGF beta 1: lessons from the TGF beta 1 null mouse. Res. Immunol. 148:453–456. Morimoto, K., H. Amano, F. Sonoda, M. Baba, M. Senba, H. Yoshimine, H. Yamamoto, T. Ii, K. Oishi, and T. Nagatake. 2001. Alveolar macrophages that phagocytose apoptotic neutrophils produce hepatocyte growth factor during bacterial pneumonia in mice. Am. J. Respir. Cell Mol. Biol. 24:608–615. Thrall, R. S., S. H. Phan, J. R. McCormick, and P. A. Ward. 1981. The development of bleomycin-induced pulmonary fibrosis in neutrophildepleted and complement-depleted rats. Am. J. Pathol. 105:76–81. King, T. E., Jr., J. A. Tooze, M. I. Schwarz, K. R. Brown, and R. M. Cherniack. 2001. Predicting survival in idiopathic pulmonary fibrosis: scoring system and survival model. Am. J. Respir. Crit. Care Med. 164:1171–1181.


S77

Regulation of Receptor for Advanced Glycation End Products during Bleomycin-Induced Lung Injury Idiopathic pulmonary fibrosis (IPF) is a debilitating disease for which there is currently no suitable therapy. Prevalence rates are estimated to be up to 30 per 100,000 (1), and the median survival time after biopsy-confirmed IPF is ⵑ 3 yr (2). The pathogenesis of IPF is known to involve destruction of epithelium and the underlying basement membrane, type II cell hyperplasia, fibroblast foci, and excessive extracellular matrix deposition (3). Such reorganization of the pulmonary parenchyma results in severe restrictive disease and eventual respiratory insufficiency. On the molecular level, many details of IPF pathogenesis remain unknown. The bleomycin model is commonly used to study mechanisms involved in the pathogenesis of pulmonary fibrosis. In this model, pulmonary fibrosis development is comprised of two stages: (i ) the inflammatory stage dominates the first week after bleomycin administration and involves infiltration of neutrophils, macrophages, and lymphocytes; and (ii) the fibrotic phase runs the course of the second week, during which fibroblast foci form and excess extracellular matrix is deposited (3). The receptor for advanced glycation end products (RAGE) is a molecule expressed by many of the cells that participate in the development of pulmonary fibrosis, including macrophages, neutrophils, fibroblasts, endothelial cells, and pulmonary type II epithelial cells (4–7). RAGE is a multiligand member of the immunoglobulin superfamily of cell surface molecules (8). It has been implicated as a propagation factor in a variety of pathologies such as diabetic nephropathy (9), diabetic atherosclerosis (10), inflammation (11), and cell migration (12, 13), in which sustained colocalization of RAGE with its ligands is observed. Binding of RAGE with a ligand leads to the activation of nuclear factor (NF)-␬B, and because the RAGE promoter has two active NF-␬B–binding sites (14), a positive feedback loop results, accounting for the observed sustained colocalization of RAGE and its ligands. RAGE ligands include advanced glycation end products (AGEs), S100/calgranulins, HMGB-1/amphoterin, and amyloid fibrils (reviewed in Ref. 15). Soluble RAGE, sRAGE, is the soluble isoform of RAGE. In humans, it is known to result from alternative splicing of the RAGE transcript, encoding a distinct carboxyterminal portion that lacks a transmembrane domain and thus is secreted (16). However, because the domain responsible for ligand binding is in the aminoterminal portion of RAGE (17), RAGE and sRAGE have identical ligand specificity. sRAGE is therefore a decoy molecule due to

This section was written by Lana E. Hanford, Cheryl L. Fattman, Lisa M. Schaefer, Jan J. Enghild, Zuzana Valnickova, and Tim D. Oury (Department of Pathology, University of Pittsburgh Medical Center, Pittsburgh, Pennsylvania; and Department of Molecular and Structural Biology, University of Aarhus, Aarhus, Denmark).

its ability to bind RAGE ligands and abrogate RAGE signaling. Previous studies by Brett and coworkers (4) have shown that total RAGE transcript levels (including RAGE and sRAGE transcripts) are highest in the lungs of humans compared with other normal organs. This observation suggested that RAGE and/or sRAGE may play a role in lung homeostasis. Thus, alterations in the levels of these proteins in the lungs may modulate the development of chronic diseases such as pulmonary fibrosis. In this study, we use the bleomycin model of pulmonary fibrosis to investigate the changes in the levels of sRAGE and membrane-bound RAGE as pulmonary fibrosis progresses.

Materials and Methods Purification of sRAGE Frozen untrimmed mouse lungs were purchased from Pel-Freez Biologicals (Rogers, AZ). Tissue was homogenized and sonicated in Homogenization Buffer (50 mM potassium phosphate, pH 7.4, 0.3 M potassium bromide) with proteinase inhibitors (3 mM diethylenetriaminepentacetic acid, 0.5 mM phenylmethylsulfonylfluoride) on ice. Homogenates were centrifuged at 20,000 ⫻ g for 20 min at 4⬚C. sRAGE was purified from the supernatant essentially as previously described (18). Aminoterminal sequencing (19) confirmed the identity of the purified protein as RAGE in this soluble fraction, sRAGE. Purified sRAGE (0.5 ␮g) was used as a positive control in Western blots.

Generation of ␣-RAGE Antibodies Antibodies against RAGE (␣-RAGE) were raised against mouse RAGE residues 188–207 (Genbank accession # Q62151) by Anaspec (San Jose, California). New Zealand white rabbits were immunized with the RAGE peptide, and serum containing ␣-RAGE antibodies was collected. Based on the immunizing peptide sequence, this antibody is able to recognize both membrane-bound RAGE and sRAGE.

Soluble Protein and Membrane Protein Preparations For Figure 1, indicated tissues were harvested from untreated male C57BL/6 mice; otherwise, lungs were harvested from mice treated as indicated. Tissues were homogenized and briefly sonicated in homogenization buffer with proteinase inhibitors (see Purification of sRAGE above) on ice. Homogenates were centrifuged for 20 min at 20,000 ⫻ g at 4⬚C, and supernatants (“soluble proteins”) were used for Western blot analysis. Total protein concentration of each supernatant was determined using the Coomassie Plus protein assay (Pierce, Rockford, IL). Pellets from the above preparation were resolubilized in Homogenization buffer with 1.0% octyl-␤-glucopyranoside (Fisher, Fair Lawn, NJ), homogenized, briefly sonicated, and incubated overnight at 4⬚C on a rocking platform. Samples were then centrifuged at 20,000 ⫻ g for 10 min at 4⬚C. Total protein in the supernatant (“membrane protein preparation”) was quantified using the Coomassie Plus protein assay (Pierce).

S78


Bleomycin Treatments Eight-week-old C57BL/6 mice (Taconic, Germantown, NY) were given one intratracheal injection of 0.075 U (Figure 2) or 0.1 U (Figures 3–5) (dose is based on the potency of the lot) of bleomycin sulfate (ICN, Costa Mesa, CA) in 0.9% saline or an equal volume of 0.9% saline, and killed 2, 4, or 7 d later (4–5 mice per group) (20). Lungs were removed and processed for Western blot analysis or RNA isolation (see below).

Western Blotting Soluble or membrane protein preparations or purified sRAGE (0.5 ␮g) was subjected to SDS-PAGE in 5–15% gradient polyacrylamide gels under reducing conditions, and electrophoretically transferred to an Immobilon-P membrane (Millipore, Bedford, MA) as previously described (21, 22). Membranes were blocked overnight at 4⬚C in blocking solution (phosphate-buffered saline [PBS] containing 0.3% Tween-20, 5% milk). All membranes were incubated for 1 h in the indicated primary antibody (␣-RAGE, ␣-actin (Oncogene, San Diego, CA) or ␣-mouse serum albumin (␣-MSA; ICN) and 1 h in the secondary antibody (horseradish peroxidase–conjugated goat anti-rabbit IgG or sheep anti-mouse IgG [Amersham, Buckinghamshire, UK]), with various washes in PBST (PBS containing 0.3% Tween-20) in between. Antibody detection was performed using the ECL detection system (Amersham). Densitometry was performed on the resulting autoradiograph using a Kodak DC120 zoom digital camera and the Kodak Digital Science 1D analysis software (v. 3.0). Statistical analysis was performed using the Student’s t test.

Bronchoalveolar Lavage Fluid and Serum Broncheoalveolar lavage fluid (BALF) was collected by instilling intratracheally and removing 1 ml of 0.9% saline. BALF was centrifuged at 16,000 ⫻ g, and the supernatant was used for Western blot analysis. Blood was collected from mice and allowed to clot at room temperature overnight. Serum was then collected after centrifugation at 16,000 ⫻ g and was used for Western blot analysis.

Quantitative RT-PCR Total RNA was isolated from mouse lungs as described (23, 24). RAGE mRNA was assayed quantitatively using a LightCycler instrument (Roche Molecular Biochemicals, Indianapolis, IN) and the LightCycler RNA amplification kit SYBR Green I (Roche Molecular Biochemicals) (23, 25). RT-PCR products were measured in real-time, and are reported as a function of crossing point, the cycle number at which PCR amplification becomes linear. RAGE primers, designed using Genbank accession # L33412, are as follows: (bases 1090–1106) forward, 5⬘-GGCGAAAACGA CAACC-3⬘, and (bases 1324–1347) reverse, 5⬘-CGTATCAAAT GTTTACTCAGCAT-3⬘. RAGE mRNA levels were normalized to the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (G3PDH) mRNA levels. G3PDH primers are as follows: forward, 5⬘-TTCTTACTCCTTGGAGGCCATG-3⬘ and reverse, 5⬘-CATCTTGGGCTACACTGAGGAC. Total reaction volumes were 20 ␮l, including 0.5 ␮g total RNA, 0.5 ␮M each primer, and 5 mM or 6 mM MgCl2 (RAGE and G3PDH reactions, respectively). Reverse transcription occurred at 55⬚C for 10 min, followed by denaturation at 95⬚C for 30 s. PCR amplification (40 cycles) on the resulting cDNA was performed using a 65⬚C, 10 s annealing step and a 72⬚C, 13 s extension step, followed by denaturation at 95⬚C. Amplification curves were produced by the LightCycler

quantification software program. Product specificity was assured by analysis of melting curves and by agarose gel electrophoresis. Duplicates of each sample were pretreated with RNase before RT-PCR to ensure that products were amplified from mRNA rather than DNA contaminants.

Results sRAGE Is Highly Expressed in Mouse Lungs Studies by Brett and colleagues (4) examining the mRNA levels of RAGE/sRAGE together showed that the highest levels of these transcripts are found in the lungs compared with other normal human tissues. However, sRAGE protein levels have not been compared among tissues. Untreated male C57BL/6 mice (n ⫽ 2) were killed, and soluble tissue homogenates were prepared from various organs and subjected to Western blotting for sRAGE (Figure 1). Note that the lung contains markedly higher levels of sRAGE protein than all other tissues examined. Notably, sRAGE is not detected in the BALF or sera of control or bleomycin animals, suggesting that this protein is predominantly associated with the matrix in the lung. (Figure 3). Decreased sRAGE Protein Levels in the Lungs after Bleomycin Treatment To examine the effect of bleomycin treatment on lung sRAGE levels, C57BL/6 mice were intratracheally injected with 0.075 U bleomycin or an equal volume of 0.9% saline. Two, four, or seven days later, lungs were isolated from each animal and used to prepare soluble protein homogenates that were subjected to Western blotting. Figure 2 demonstrates that there is a significant loss of lung sRAGE protein levels after bleomycin treatment compared with saline-treated control lungs at 2 d, with accentuated losses as the injury progresses through the inflammatory phase (up to Day 7). The loss of pulmonary sRAGE could not be accounted for by diffusion of the protein into the BALF or sera (Figure 3). Decreased Membrane-Bound RAGE in the Lungs 7 d after Bleomycin Treatment To determine if the decrease in sRAGE protein after bleomycin treatment was accompanied by an increase in membrane-bound RAGE, membrane preparations were prepared from lungs of saline- or bleomycin-treated mice, 7 d after treatment. Western blot analysis of these preparations (Figure 4) shows, in contrast, that RAGE protein levels in the lung are also decreased 7 d after bleomycin treatment compared with control animals. RAGE/sRAGE mRNA Levels after Bleomycin Treatment To determine if the decrease in sRAGE and membrane RAGE protein levels is due to decreased mRNA production, quantitative RT-PCR was performed using primers for a sequence found in both forms of RAGE mRNAs. Malherbe and coworkers (16) showed that human sRAGE mRNA is produced by alternative splicing of the RAGE mRNA, causing a shift in the reading frame and a consequent lack of a transmembrane domain-coding region.


S79

Figure 1. Western blot analysis of sRAGE in mouse tissues. Forty micrograms of soluble protein preparation from each C57BL/6 mouse tissue was electrophoresed and immunoblotted with ␣-RAGE (top panel). The membrane was stripped and probed with ␣-mouse actin as a loading control. Purified sRAGE (0.5 ␮g), migrating at ⵑ 55 kD, was loaded as a positive control. Results are representative of two independent experiments. Note the high expression of sRAGE in the lung.

However, the mouse sRAGE mRNA sequence is not currently available in the public domain, so we were unable to design primers specific to either RAGE or sRAGE. We therefore used primers for the RAGE gene downstream of the putative splice site for the mouse gene. Consequently, quantitative RT-PCR on total lung RNA using these primers will amplify both RAGE and sRAGE. Figure 5 shows that there is a trend of increased total RAGE (sRAGE ⫹ membrane RAGE) mRNA 7 d after bleomycin treatment compared with controls. It therefore appears that the decrease in sRAGE and membrane RAGE protein levels cannot be completely explained by decreased mRNA production.

Discussion RAGE is a molecule that has been receiving increasing attention over the past decade as a propagation factor for

an array of pathophysiologies, including diabetic atherosclerosis, amyloidoses, and chronic inflammation (reviewed in Ref. 15). In these RAGE-mediated pathologies, membranebound RAGE is upregulated, at least partially due to a positive feedback loop initiated by RAGE-ligand binding and culminating in increased RAGE transcription (26, 27). sRAGE, the secreted isoform of RAGE, acts as a decoy by binding RAGE ligands and preventing RAGE signaling. In humans, sRAGE has been found to result from alternative splicing of the RAGE transcript (16). Brett and colleagues (4) found that RAGE/sRAGE mRNA was most abundant in the lung compared with other human tissues studied, suggesting that one or both of these isoforms plays a role in lung homeostasis. Thus, an imbalance in the RAGE/ sRAGE axis in the lung may promote pulmonary pathologies such as pulmonary fibrosis.

Figure 2. Western blot analysis of sRAGE in mouse lungs after bleomycin injury. (A ) Lungs from mice treated 2, 4, or 7 d earlier were isolated and used to prepare soluble protein preparations. Thirty micrograms were loaded into gels, electrophoresed, and immunoblotted with anti-RAGE (left set). Membranes were stripped and re-probed with anti-mouse serum albumin (MSA) (right set) as a loading control. Purified sRAGE (0.5 ␮g) was loaded as a positive control. (B ) Densometric analysis of blots from A, reported as the ratio of anti-RAGE band intensity normalized to antiMSA band intensity. Note that sRAGE protein levels decrease with the progression of bleomycin-induced injury. Striped bars, saline; shaded bars, bleomycin. Statistical analysis was performed using Student’s t test. *P ⬍ 0.002.

S80


Figure 3. Western blot analysis of sRAGE in BALF and sera. Bronchoalveolar lavage fluid (BALF) and serum were collected from mice 7 d after treatment with saline or bleomycin (four mice per group). Thirty micrograms of each BALF sample (A ) or serum sample (B ) were loaded, electrophoresed, and immunoblotted. Membranes were probed with ␣-RAGE. Purified sRAGE (0.5 ␮g) was loaded as a positive control. sRAGE is undetectable in the BALF (A ) and sera (B ) of control and bleomycin-treated mice.

We found that among the normal mouse tissues studied, the lung has the highest level of sRAGE protein (Figure 1). This supports the possibility that sRAGE plays an important role in lung homeostasis. sRAGE is likely to play a protective role because it is found at relatively high levels under normal conditions (organs in Figure 1 were harvested

Figure 4. Western blot analysis of membrane RAGE in mouse lungs after bleomycin injury. (A ) Membrane protein preparations were prepared as described in Materials and Methods. Thirty micrograms of total octyl-␤-glucopyranoside soluble protein were loaded into the gel, electrophoresed, and immunoblotted. The membrane was probed with anti-RAGE antibody (top), stripped, then probed with anti-mouse actin as a loading control (bottom). Membrane RAGE migrates at ⵑ 65 kD; actin migrates at ⵑ 50 kD. (B ) Densometric analysis of blots in A expressed as the ratio of each sample’s anti-RAGE to anti-actin band intensity. Note the decrease of membrane RAGE 7 d after bleomycin treatment. Statistical analysis was performed using Student’s t test. *P ⬍ 0.0005.

from untreated mice), and because it has the capacity to prevent inflammatory membrane RAGE signaling. This study demostrates that as bleomycin-induced pulmonary fibrosis progresses, sRAGE protein is depleted from the lung (Figure 2). It has been proposed that sRAGE-ligand complexes are degraded (28). Because we were unable to detect any increase in sRAGE protein in the BALF or serum after bleomycin treatment (Figure 3), our data support this hypothesis. Alternatively, the decrease in sRAGE with progression of pulmonary fibrosis could be a dilutional effect due to the pulmonary edema that occurs with pulmonary fibrosis, although our decreases in sRAGE were significant even after normalization to albumin. In either case, the effect is that sRAGE, a potentially protective protein, will be at lower concentrations in the lung parenchyma and therefore will be less effective at inhibiting membrane RAGE signaling. We hypothesized that the decrease in sRAGE protein would be accompanied by an increase in membrane-bound RAGE, which could then propagate inflammation that contributes to the injury. In contrast, these studies demonstrated that membrane RAGE protein levels are also decreased in response to bleomycin injury (Figure 4). The decrease in membrane RAGE is not likely to be due to a dilutional effect because soluble proteins, including those that leak from the vasculature during edema, are removed from the preparation before membrane proteins are solubilized. Interestingly, the decrease in both sRAGE and membrane RAGE protein does not appear to be due to decreased transcription of the RAGE gene as shown by quantitative RT-PCR (Figure 5). Investigating alternative methods of regulation such as mRNA stability and posttranslational modifications should provide insight.

Figure 5. Quantitative real time RT-PCR analysis of total RAGE message in control and bleomycin exposed mice. Total lung RNA was isolated from mice in each treatment group (three mice/group) and subjected to quantitative RT-PCR using a LightCycler instrument. The primers used are directed at sequence shared by both membrane RAGE and sRAGE mRNA. The mean crossing point for the RAGE product was normalized to that of the housekeeping gene glyceraldehyde-3-phosphate dehygrogenase (G3PDH). Statistical analysis was performed using Student’s t test; P ⫽ 0.21. Striped bars, saline; shaded bars, bleomycin.


RAGE ligands include advanced glycation end products (AGEs), s100/calgranulins, amphoterin (high mobility group protein-1, HMGB1), and amyloid fibrils. We speculate that AGEs may be the predominant RAGE ligand to participate in injuries leading to pulmonary fibrosis. Matsuse and coworkers (29) reported elevated levels of AGEs in lung sections from human cases of IPF. Further, formation of the most well-studied AGEs, carboxymethyl-lysine and pentosidine, is termed glycoxidation because it requires an oxidation step (30, 31). As a result, the transition of a reversibly glycated amine to an irreversible AGE is more likely to occur in an oxidative environment, such as the pulmonary fibrotic milieu. However, s100/calgranulins, which participate in chronic inflammatory settings (11), and HMGB1, which plays a role in acute lung inflammation (32), may contribute to this injury process as well. In conclusion, these studies demonstrate that bleomycin injury leads to a significant loss of pulmonary sRAGE, a protein predicted to have beneficial protective effects against inflammatory injuries. The simultaneous loss of membrane RAGE in this injury model was also observed. These findings suggest that alterations in RAGE signaling pathways may contribute to the pathogenesis of pulmonary fibrosis. Further studies are currently under way to investigate this possibility. Acknowledgments: The writers of this section thank Dr. James Crapo and Dr. Ann Marie Schmidt for helpful discussions. This work was supported by National Institutes of Health Grants RO1 HL63700-02

References 1. Coultas, D. B., R. E. Zumwalt, W. C. Black, and R. E. Sobonya. 1994. The epidemiology of interstitial lung diseases. Am. J. Respir. Crit. Care Med. 150:967–972. 2. Bjoraker, J. A., J. H. Ryu, M. K. Edwin, J. L. Myers, H. D. Tazelaar, D. R. Schroeder, and K. P. Offord. 1998. Prognostic significance of histopathologic subsets in idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 157:199–203. 3. Phan, S. H., and R. S. Thrall. editors. 1995. Pulmonary Fibrosis, Lung Biology in Health and Disease. Marcel Dekker, Inc., New York. 4. Brett, J., A. M. Schmidt, S. D. Yan, Y. S. Zou, E. Weidman, D. Pinsky, R. Nowygrod, M. Neeper, C. Przysiecki, A. Shaw, A. Migheli, and D. Stern. 1993. Survey of the distribution of a newly characterized receptor for advanced glycation end products in tissues. Am. J. Pathol. 143:1699–1712. 5. Katsuoka, F., Y. Kawakami, T. Arai, H. Imuta, M. Fujiwara, H. Kanma, and K. Yamashita. 1997. Type II alveolar epithelial cells in lung express receptor for advanced glycation end products (RAGE) gene. Biochem. Biophys. Res. Commun. 238:512–516. 6. Owen, W. F., Jr., F. F. Hou, R. O. Stuart, J. Kay, J. Boyce, G. M. Chertow, and A. M. Schmidt. 1998. Beta 2-microglobulin modified with advanced glycation end products modulates collagen synthesis by human fibroblasts. Kidney Int. 53:1365–1373. 7. Collison, K. S., R. S. Parhar, S. S. Saleh, B. F. Meyer, A. A. Kwaasi, M. M. Hammami, A. M. Schmidt, D. M. Stern, and F. A. Al-Mohanna. 2002. RAGE-mediated neutrophil dysfunction is evoked by advanced glycation end products (AGEs). J. Leukoc. Biol. 71:433–444. 8. Neeper, M., A. M. Schmidt, J. Brett, S. D. Yan, F. Wang, Y. C. Pan, K. Elliston, D. Stern, and A. Shaw. 1992. Cloning and expression of a cell surface receptor for advanced glycosylation end products of proteins. J. Biol. Chem. 267:14998–15004. 9. Yamamoto, Y., I. Kato, T. Doi, H. Yonekura, S. Ohashi, M. Takeuchi, T. Watanabe, S. Yamagishi, S. Sakurai, S. Takasawa, H. Okamoto, and H. Yamamoto. 2001. Development and prevention of advanced diabetic nephropathy in RAGE-overexpressing mice. J. Clin. Invest. 108:261–268. 10. Park, L., K. G. Raman, K. J. Lee, Y. Lu, L. J. Ferran, Jr., W. S. Chow, D. Stern, and A. M. Schmidt. 1998. Suppression of accelerated diabetic atherosclerosis by the soluble receptor for advanced glycation endproducts. Nat. Med. 4:1025–1031.

S81

11. Hofmann, M. A., S. Drury, C. Fu, W. Qu, A. Taguchi, Y. Lu, C. Avila, N. Kambham, A. Bierhaus, P. Nawroth, M. F. Neurath, T. Slattery, D. Beach, J. McClary, M. Nagashima, J. Morser, D. Stern, and A. M. Schmidt. 1999. RAGE mediates a novel proinflammatory axis: a central cell surface receptor for S100/calgranulin polypeptides. Cell 97:889–901. 12. Schmidt, A. M., S. D. Yan, J. Brett, R. Mora, R. Nowygrod, and D. Stern. 1993. Regulation of human mononuclear phagocyte migration by cell surface-binding proteins for advanced glycation end products. J. Clin. Invest. 91:2155–2168. 13. Taguchi, A., D. C. Blood, G. del Toro, A. Canet, D. C. Lee, W. Qu, N. Tanji, Y. Lu, E. Lalla, C. Fu, M. A. Hofmann, T. Kislinger, M. Ingram, A. Lu, H. Tanaka, O. Hori, S. Ogawa, D. M. Stern, and A. M. Schmidt. 2000. Blockade of RAGE-amphoterin signalling suppresses tumour growth and metastases. Nature 405:354–360. 14. Li, J., and A. M. Schmidt. 1997. Characterization and functional analysis of the promoter of RAGE, the receptor for advanced glycation end products. J. Biol. Chem. 272:16498–16506. 15. Schmidt, A. M., S. D. Yan, S. F. Yan, and D. M. Stern. 2000. The biology of the receptor for advanced glycation end products and its ligands. Biochim. Biophys. Acta 1498:99–111. 16. Malherbe, P., J. G. Richards, H. Gaillard, A. Thompson, C. Diener, A. Schuler, and G. Huber. 1999. cDNA cloning of a novel secreted isoform of the human receptor for advanced glycation end products and characterization of cells co-expressing cell-surface scavenger receptors and Swedish mutant amyloid precursor protein. Brain Res. Mol. Brain Res. 71:159–170. 17. Kislinger, T., C. Fu, B. Huber, W. Qu, A. Taguchi, S. Du Yan, M. Hofmann, S. F. Yan, M. Pischetsrieder, D. Stern, and A. M. Schmidt. 1999. N(epsilon)(carboxymethyl)lysine adducts of proteins are ligands for receptor for advanced glycation end products that activate cell signaling pathways and modulate gene expression. J. Biol. Chem. 274:31740–31749. 18. Schmidt, A. M., M. Vianna, M. Gerlach, J. Brett, J. Ryan, J. Kao, C. Esposito, H. Hegarty, W. Hurley, M. Clauss, F. Wang, Y.C.E. Pan, T.C. Tsang, and D. Stern. 1992. Isolation and characterization of two binding proteins for advanced glycosylation end products from bovine lung which are present on the endothelial cell surface. J. Biol. Chem. 267:14987–14997. 19. Matsudaira, P. 1987. Sequence from picomole quantities of proteins electroblotted onto polyvinylidene difluoride membranes. J. Biol. Chem. 262: 10035–10038. 20. Fattman, C. L., C. T. Chu, S. M. Kulich, J. J. Enghild, and T. D. Oury. 2001. Altered expression of extracellular superoxide dismutase in mouse lung after bleomycin treatment. Free Radic. Biol. Med. 31:1198–1207. 21. Oury, T. D., J. D. Crapo, Z. Valnickova, and J. J. Enghild. 1996. Human extracellular superoxide dismutase is a tetramer composed of two disulphide-linked dimers: a simplified, high-yield purification of extracellular superoxide dismutase. Biochem. J. 317:51–57. 22. Fattman, C. L., J. J. Enghild, J. D. Crapo, L. M. Schaefer, Z. Valnickova, and T. D. Oury. 2000. Purification and characterization of extracellular superoxide dismutase in mouse lung. Biochem. Biophys. Res. Commun. 275:542–548. 23. Oury, T. D., L. M. Schaefer, C. L. Fattman, A. Choi, K. E. Weck, and S. C. Watkins. 2002. Depletion of pulmonary EC-SOD after exposure to hyperoxia. Am. J. Physiol. Lung Cell. Mol. Physiol. 283:L777–L784. 24. Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156–159. 25. Giles, B. L., H. Suliman, L. B. Mamo, C. A. Piantadosi, T. D. Oury, and E. Nozik-Grayck. 2002. Prenatal hypoxia decreases lung extracellular superoxide dismutase expression and activity. Am. J. Physiol. Lung Cell. Mol. Physiol. 283:L549–L554. 26. Li, J., and A. M. Schmidt. 1997. Characterization and functional analysis of the promoter of RAGE, the receptor for advanced glycation end products. J. Biol. Chem. 272:16498–16506. 27. Tanaka, N., H. Yonekura, S. Yamagishi, H. Fujimori, Y. Yamamoto, and H. Yamamoto. 2000. The receptor for advanced glycation end products is induced by the glycation products themselves and tumor necrosis factoralpha through nuclear factor-kappa B, and by 17beta-estradiol through Sp-1 in human vascular endothelial cells. J. Biol. Chem. 275:25781–25790. 28. Renard, C., O. Chappey, M. P. Wautier, M. Nagashima, E. Lundh, J. Morser, L. Zhao, A. M. Schmidt, J. M. Scherrmann, and J. L. Wautier. 1997. Recombinant advanced glycation end product receptor pharmacokinetics in normal and diabetic rats. Mol. Pharmacol. 52:54–62. 29. Matsuse, T., E. Ohga, S. Teramoto, M. Fukayama, R. Nagai, S. Horiuchi, and Y. Ouchi. 1998. Immunohistochemical localisation of advanced glycation end products in pulmonary fibrosis. J. Clin. Pathol. 51:515–519. 30. Baynes, J. W. 1991. Role of oxidative stress in development of complications in diabetes. Diabetes 40:405–412. 31. Thorpe, S. R., and J. W. Baynes. 1996. Role of the Maillard reaction in diabetes mellitus and diseases of aging. Drugs Aging 9:69–77. 32. Abraham, E., J. Arcaroli, A. Carmody, H. Wang, and K. J. Tracey. 2000. HMG-1 as a mediator of acute lung inflammation. J. Immunol. 165:2950– 2954.

S82


The Role of Heme Oxygenase-1 in Pulmonary Fibrosis Introduction As organisms that exist in a predominantly oxidizing environment, we are vulnerable to injury from the very air that we breathe. Over the millennia, cellular defense mechanisms have evolved as protection against oxidative stress. One of the less well known but critical defenders of cellular homeostasis is the microsomal enzyme heme oxygenase (HO). HO is responsible for degradation of heme to biliverdin, free iron, and carbon monoxide (CO) (Figure 1). Biliverdin is subsequently converted to bilirubin through the action of biliverdin reductase, and free iron is sequestered by ferritin. The inducible form of HO, called HO-1, is a stress-responsive protein. Through experiments with gene deletion in mice (1) and a single case of human HO-1 deficiency (2), it has become clear that this enzyme is necessary to the survival of organisms. This is consistent with the observation that both HO and its substrate, heme, are highly conserved molecules across almost all forms of life, from algae to mammals. Molecules so evolutionarily conserved and ubiquitous generally serve a necessary and fundamental purpose. At least part of the cytoprotective function of HO-1 may depend upon the prevention of free heme from participating in pro-oxidant reactions (3). A major focus of interest, however, is in the products of enzymatic heme breakdown as mediators of cytoprotection. The three products of this reaction—bilirubin, CO, and ferritin induced by free iron release—all have cytoprotective function (4–6). These molecules are candidate effectors of the anti-inflammatory, antiapoptotic, and antiproliferative functions of HO-1, and they represent targets of active research.

HO-1 and Oxidative Lung Injury One common model of pulmonary oxidative stress is exposure to hyperoxia. Hyperoxic stress leads to increased HO-1 expression in the lungs of rodents (8), and overexpression of HO-1 in isolated pulmonary epithelial cells (8) and rat fetal lung cells (9) has been shown to confer protection against hyperoxic injury. This same protective phenomenon has been demonstrated in vivo with adenoviral transfer of HO-1 into rat lungs (10): rats overexpressing HO-1 demonstrate marked resistance to oxygen-induced lung injury and survive longer in a hyperoxic environment. However, there may be a threshold effect for cytoprotection by HO-1. Suttner and coworkers observed that although moderate overexpression of HO-1 in fibroblasts conferred protection against oxidative injury, higher levels of HO-1 were detrimental (9). There is evidence that CO elaborated during heme catabolism by HO-1 accounts for at least some of the protective effects of HO-1 in the lung. Rats exposed to hyperoxia in

This section was written by Danielle Morse (Division of Pulmonary, Allergy and Critical Care Medicine, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania).

the presence of a low concentration of CO (250 ppm) exhibit less lung injury than control rats exposed to oxygen alone (11). A similar study by Clayton and colleagues demonstrated a statistically significant reduction in pulmonary edema with exposure to CO and hyperoxia, but no difference in other markers of lung injury (12). The mechanism by which CO might provide pulmonary cytoprotection has not been entirely elucidated, but downregulation of proinflammatory cytokines such as interleukin (IL)-1␤ and tumor necrosis factor (TNF)-␣ along with augmentation of the anti-inflammatory cytokine IL-10 appear to play a role (13). The potential role for IL-10 has been further supported by a recent murine study demonstrating resistance to lipopolysaccharide (LPS)-induced lung injury and enhanced IL-10 production by alveolar macrophages after transfer of HO-1 cDNA (14). In the past several years, HO-1 has been implicated in a number of pulmonary diseases. Smokers are now known to have increased airway expression of HO-1 (15), and microsatellite polymorphisms in the HO-1 gene promoter have been linked with increased susceptibility to emphysema (16). Exhaled carbon monoxide, a marker of HO activity, is elevated in humans with asthma, and inflammatory cells of patients with asthma have increased HO-1 protein content (17). In a murine asthma model, our laboratory has observed that mice treated with inhaled CO demonstrate reduced bronchoalveolar lavage levels of IL-5, prostaglandin E2, leukotriene B4, and eosinophils (18). Hypoxia-induced pulmonary hypertension, vascular remodeling, and inflammation have been attenuated through enhanced HO-1 expression in rodent models (19). Influenza virus–induced lung injury in mice has also been prevented through transfer of HO-1 cDNA (20). Oxidative injury contributes to all of these disease processes, and it stands to reason that HO-1 would be of central importance in the maintenance of homeostasis under these circumstances. There have been no published data to date examining the role of HO-1 in pulmonary fibrosis. There is strong evidence, however, that oxidative stress is implicated in the pathogenesis of idiopathic pulmonary fibrosis (IPF) (21), and therefore good rationale to believe that HO-1 may be important in this disease process. We have preliminary evidence that CO may protect against bleomycin-induced lung injury in mice. When lung histology was examined in a blinded fashion by a pulmonary pathologist, mice treated with CO and bleomycin were found to have less severe lung injury than mice treated with bleomycin alone (Figure 2). This supports a role for HO-1 and CO in pulmonary fibrosis.

Potential Roles for HO-1 in Pulmonary Fibrosis The pathogenesis of idiopathic pulmonary fibrosis is as yet poorly understood, although several schemes have been proposed. The focus of most theories involves chronic inflammation followed by uncontrolled and exaggerated tissue repair. This is supported by the microscopic appearance of IPF/usual interstitial pneumonitis (UIP) as a pattern of


S83

Figure 1. HO accomplishes the first rate-limiting step of heme degradation as it cleaves the ␣-meso carbon bridge of heme molecules to yield equimolar quantities of biliverdin IXa, free iron, and carbon monoxide (CO). Biliverdin is subsequently converted to bilirubin through the action of biliverdin reductase, and free iron is sequestered by ferritin.

alternating regions of normal tissue, interstitial inflammation, increased matrix deposition, and end-stage cystic destruction. Most schemes focus on the fibroblast and its response to interactions with other cells in the lung because it is the final common mediator of fibrosis. Cell–cell interactions are complex, however, and leukocytes, fibroblasts, and epithelial cells are all capable of influencing one another in almost any combination. The part that HO-1 plays in this intricate scheme remains poorly defined. In a cDNA array analysis of a murine model of fibrosis, HO-1 was one of the four most differentially expressed genes (7), lending credence to a role for this molecule in fibrosis. In view of the known properties of HO-1 and CO, the possible roles for HO-1 could involve protection against oxidative injury, dampening of inflammation, decreased fibroblast proliferation, inhibition of matrix deposition, or inhibition of apoptosis.

Inflammatory Mediators The role of inflammation in the pathogenesis of pulmonary fibrosis remains controversial. Although the number of infiltrating leukocytes found in lung specimens with UIP is low, there is evidence in both human and animal models that inflammatory cytokines are involved in the development of fibrosis (22). Polymorphisms of IL-1 RA, TNF-␣, and IL-6 genes are associated with increased risk of IPF in humans (23), and TNF-␣ protein is increased in the lungs of patients with IPF. Moreover, transgenic overexpression of TNF-␣ produces fibrosing alveolitis in mice (24), and deletion of the TNF-␣ receptor protects against asbestos- and bleomycininduced fibrosis (25). IL-6 is a pleiotropic cytokine which has been shown to stimulate fibroblast growth and the production of collagen and glycosaminoglycan (26). It is secreted in large amounts by fibroblasts from fibrotic lesions (26), and overexpression of IL-6 causes interstitial pneumonia (27). IL-1␤ promotes fibroblast proliferation and collagen production, and appears to be an active participant in early fibrosis (28). Transient overexpression of IL-1␤ in mice is also capable of inducing pulmonary fibrosis (29). Some of the effects of TNF-␣, IL-1␤, and IL-6 may be attributable to the induction of downstream chemokines. For instance, TNF-␣ and IL-6 are known to mediate macrophage inflammatory protein-1␣ (MIP-1␣) expression. Fibroblasts isolated from patients with IPF exhibit enhanced

Figure 2. Mice were treated with intratracheal administration of bleomycin and were subsequently exposed to continuous CO (250 ppm) (n ⫽ 6) or ambient air (n ⫽ 5). After 14 d, mice were killed and the lungs were stained with H&E. The histology was reviewed in a blinded fashion by a pulmonary pathologist and categorized as “no injury,” “mild injury,” or “moderate/severe injury.” One mouse in each group had no injury. Of the others, the CO-treated animals exhibited less severe injury than the group exposed to ambient air.

monocyte chemoattractant protein (MCP-1) and MIP-1␣ production (30, 31), and serum levels of these chemokines correlate with pulmonary fibrosis in patients with scleroderma (32). Immunoneutralization of MCP-1 in a bleomycin model results in 30% fewer recruited mononuclear cells, suggesting that this chemokine is active in recruiting leukocytes in fibrotic lung disease (33). MCP-1 itself contributes indirectly to fibroblast collagen production by markedly increasing TGF-␤ production (34), illustrating the interconnectedness of extracellular chemical signals. IL-10 is known to reduce many inflammatory reactions, and it participates in extracellular matrix remodeling by decreasing matrix synthesis and increasing collagenase secretion (35). Overexpression of IL-10 in a mouse model has been shown to inhibit fibrosis caused by bleomycin instillation (36). As previously noted, HO-1 and its byproduct, CO, have been shown to decrease TNF and IL-1␤ production in vivo and in vitro (13). This is associated with a concomitant increase in secretion of the anti-inflammatory cytokine IL-10. We have also demonstrated that exogenous administration of CO to mice or macrophages leads to a decrease in the elaboration of IL-6 (37). New data indicate that the effect of CO extends to MCP-1 in vitro but not to MIP-1␣ (Figure 3). Figure 3 illustrates that macrophages (RAW 264.7) treated with LPS and CO elaborate significantly less MCP-1 than macrophages treated with LPS alone. On the other hand, treatment with CO had no effect on LPS-stimulated MIP-1␣ production. The sum total of the cytokine effects of CO, including inhibition of IL-1␤, TNF-␣, IL-6, and MCP-1 and augmentation of IL-10, should result in a cellular environment that is inhibitory to fibrosis.

Fibroblast Proliferation and Matrix Deposition Studies which aim to halt or reverse fibrosis have focused on both matrix deposition and fibroblast proliferation (38).

S84


Figure 3. Effects of CO on LPS-induced MCP-1 and MIP-1␣ production in vitro. Macrophages (RAW 264.7) were pretreated with CO for 2 h before stimulation with 1 ␮g/ml LPS. Media was collected after 5 h for measurement of MCP-1 and MIP-1␣ by ELISA. (A ) LPS-stimulated MCP-1 elaboration by RAW 264.7 macrophages is decreased in the presence of 250 ppm CO. (B ) LPS-stimulated MIP-1␣ production is not affected by treatment with CO.

There are no published data dealing directly with HO-1 effects on fibrogenesis. There is evidence that oxidative stress is of central importance in maintaining a fibrotic fibroblast phenotype in scleroderma (39), and HO-1 is invariably upregulated under conditions of oxidative stress. It has also been demonstrated that tissue hypoxia plays a role in systemic sclerosis, and that skin fibroblasts from patients with scleroderma have increased expression of HO-1 (40). Plasminogen activator inhibitor-1 (PAI-1) appears to play a pro-fibrogenic role in IPF; in a model of ischemia-reperfusion, CO has been shown to inhibit PAI-1 production (41). These findings provide indirect evidence for a role of HO-1 in anti-fibrogenesis. Pulmonary fibrosis is characterized histologically by an increased number of fibroblasts, particularly by fibroblastic foci at the leading edge of disease. Decreased proliferation of fibroblasts may lead to slower or halted progression of disease. Heme oxygenase-1 and CO have been shown to decrease proliferation of smooth muscle cells (42–45), which may be one mechanism by which these molecules inhibit atherogenesis and vascular intimal hyperplasia (45). Preliminary evidence from our laboratory indicates that CO exerts the same antiproliferative effects on fibroblasts as on smooth muscle cells (Figure 4).

Cell Signaling in Pulmonary Fibrosis Work dealing with cell signaling in pulmonary fibrosis has focused primarily on the mitogen activated protein kinase pathways (MAPK). Involvement of the MAPKs in the pathogenesis of pulmonary fibrosis has been demonstrated in several ways. Chemical inhibition of the p38 pathway results in diminished fibrosis in a bleomycin rodent model (46). Conversely, we have demonstrated in our laboratory that absence of the JNK pathway (through gene deletion) results in greater oxidative lung injury in a murine model (47). The MAPK pathways are involved in cytokine signaling and fibroblast migration and proliferation. Myofibroblast migration has been shown to depend on activation of the p38 MAPK signaling pathway, whereas the ERK pathway has been shown to mediate platelet-derived growth factor– induced proliferation (48) Both JNK and ERK pathways are involved in downregulation of fibroblast proliferation by overexpression of type II TGF-␤ receptor (49). The JNK pathway appears to be critical to TGF-␤–induced phenotypic change of lung fibroblasts to myofibroblasts (50). Reactive oxygen species play a role in platelet-derived growth factor and TGF-␤ gene expression, through an ERK-dependent mechanism (51). Given that both HO-1 and the MAPK are activated by stressful stimuli, it is reasonable to postulate a relationship between the MAPK and HO-1. Lu and colleagues have reported that constitutive activation of ERK and p38 pathway components results in increased HO-1 reporter gene activity, and that dominant-negative components abrogate arsenite-induced reporter gene activity (52). These findings were confirmed using chemical inhibitors of the ERK and p38 pathways. More saliently, TGF-␤1 has been shown to induce HO-1 via the p38 pathway (53). There is evidence of MAPK pathway involvement downstream of HO-1 activation as well: CO has cytoprotective and anti-apoptotic effects that appear to be mediated through MAPK pathways, specifically the p38 pathway (54).

Therapies for IPF? Figure 4. Effect of exogenous CO on fibroblast proliferation. Human fibroblasts (MRC-5) were serum-starved for 48 h and subsequently stimulated with 10% FBS in the presence or absence of 250 ppm CO. 3H-thymidine uptake was assessed after 24 h. Cells treated with CO had significantly lower uptake of 3H-thymidine than control cells, indicating an antiproliferative effect of CO.

There are many reasons to believe that heme oxygenase, an enzyme found throughout the animal kingdom, is intimately involved in the resolution of inflammation and control of fibrosis. Demonstration of this fact would in itself advance our understanding of fibrosis, and this knowledge would be


applicable not only to idiopathic lung fibrosis but to fibrosis of other origins and in other organs. Perhaps more importantly, this knowledge would open the door to the development of new treatments. The obvious target and ultimate goal of most research in HO-1 is to find a therapeutic use, and there have been several approaches to this issue. Gene transfer has been attempted in animals, with promising results, although current limitations to this approach in humans are widely appreciated. The antioxidant and cytoprotective effects of CO, bilirubin, and ferritin have been demonstrated experimentally, but given the potential toxicities of these products of HO-1, they have yet to be used therapeutically in human studies. There is evidence that high serum bilirubin levels lead to improvement in pulmonary fibrosis in humans and in an experimental rat model (55); whether bilirubin levels could safely be manipulated in humans is unknown. Low concentrations of inhaled CO are currently used diagnostically to estimate lung diffusing capacity in patients, so it is not unthinkable that CO could be used therapeutically. Of interest, one of the few indicators of improved prognosis in IPF is active cigarette smoking at the time of diagnosis (56). This phenomenon has not been explained, but may be related to the ⵑ 11 mg of CO (or 1–6% CO gas) (57) inhaled with each cigarette. This represents 1,000-fold higher CO exposure than has been used in animal and cell exposures. Our own experience with animal studies suggests that exposures of 250 ppm for up to 2 mo does not have notable toxic effects. Motterlini and coworkers have described the use of chemical CO donors in the form of transition metal carbonyls (58), which represents a novel approach to administering this gas without inhalation. The future will show which (if any) of these approaches could ultimately be of benefit in IPF. References 1. Poss, K. D., and S. Tonegawa. 1997. HO-1 is required for mammalian iron reutilization. Proc. Natl. Acad. Sci. USA 94:10919–10924. 2. Yachie, A., Y. Niida, T. Wada, N. Igarashi, H. Kaneda, T. Toma, K. Ohta, Y. Kasahara, and S. Koizumi. 1999. Oxidative stress causes enhanced endothelial cell injury in human heme oxygenase-1 deficiency. J. Clin. Invest. 103:129–135. 3. Keyse, S. M., and R. M. Tyrrell. 1989. Heme oxygenase is the major 32kDa stress protein induced in human skin fibroblasts by UVA radiation, hydrogen peroxide, and sodium arsenite. Proc. Natl. Acad. Sci. USA 86:99– 103. 4. Oberle, S., P. Schwartz, A. Abate, and H. Schroder. 1999. The antioxidant defense protein ferritin is a novel and specific target for pentaerithrityl tetranitrate in endothelial cells. Biochem. Biophys. Res. Commun. 261: 28–34. 5. Yesilkaya, A., R. Altinayak, and D. K. Korgun. 2000. The antioxidant effect of free bilirubin on cumene-hydroperoxide treated human leukocytes. Gen. Pharmacol. 35:17–20. 6. Otterbein, L. E., and A. M. K. Choi. 2000. Heme oxygenase: colors of defense against cellular stress. Am. J. Physiol. Lung Cell. Mol. Physiol. 279:L1029– L1037. 7. Kaminski, N., J. D. Allard, J. F. Pittet, F. Zuo, M. J. Griffiths, D. Morris, X. Huang, D. Sheppard, and R. A. Heller. 2000. Global analysis of gene expression in pulmonary fibrosis reveals distinct programs regulating lung inflammation and fibrosis. Proc. Natl. Acad. Sci. USA 97:1778–1783. 8. Lee, P. J., J. Alam, S. L. Sylvester, N. Inamdar, L. Otterbein, and A. M. Choi. 1996. Regulation of heme oxygenase-1 expression in vivo and in vitro in hyperoxic lung injury. Am. J. Respir. Cell Mol. Biol. 14:556–568. 9. Suttner, D. M., K. Sridhar, C. S. Lee, T. N. Hansen, and P. A. Dennery. 1999. Protective effects of transient HO-1 overexpression on susceptibility to oxygen toxicity in lung cells. Am. J. Physiol. Lung Cell Mol. Physiol. 276:L443–L451. 10. Otterbein, L. E., J. K. Kolls, L. L. Mantell, J. L. Cook, J. Alam, and A. M. Choi. 1999. Exogenous administration of heme oxygenase-1 by gene trans-

S85

11. 12.

13.

14.

15.

16.

17. 18. 19.

20.

21. 22. 23.

24.

25. 26.

27.

28. 29. 30.

31.

32.

fer provides protection against hyperoxia-induced lung injury. J. Clin. Invest. 103:1047–1054. Otterbein, L. E., L. L. Mantell, and A. M. Choi. 1999. Carbon monoxide provides protection against hyperoxic lung injury. Am. J. Physiol. Lung Cell. Mol. Physiol. 276:L688–L694. Clayton, C. E., M. S. Carraway, H. B. Suliman, E. D. Thalmann, K. N. Thalmann, D. E. Schmechel, and C. A. Piantadosi. 2001. Inhaled carbon monoxide and hyperoxic lung injury in rats. Am. J. Physiol. Lung Cell. Mol. Physiol. 281:L949–L957. Otterbein, L. E., F. H. Bach, J. Alam, M. Soares, H. Tao Lu, M. Wysk, R. J. Davis, R. A. Flavell, and A. M. Choi. 2000. Carbon monoxide has antiinflammatory effects involving the mitogen-activated protein kinase pathway. Nat. Med. 6:422–428. Inoue, S., M. Suzuki, Y. Nagashima, S. Suzuki, T. Hashiba, T. Tsuburai, K. Ikehara, T. Matsuse, and Y. Ishigatsubo. 2001. Transfer of HO-1 cDNA by a replication-deficient adenovirus enhances IL-10 production from alveolar macrophages that attenuates lipopolysaccharide-induced acute lung injury in mice. Hum. Gene Ther. 12:967–979. Maestrelli, P., A. H. El Messlemani, O. De Fina, Y. Nowicki, M. Saetta, C. Mapp, and L. M. Fabbri. 2001. Increased expression of HO-1 in alveolar spaces and HO-2 in alveolar walls of smokers. Am. J. Respir. Crit. Care Med. 164:1508–1513. Yamada, N., M. Yamaya, S. Okinaga, K. Nakayama, S. Shibahara, and H. Sasaki. 2000. Microsatellite polymorphism in the HO-1 gene promoter is associated with susceptibility to emphysema. Am. J. Hum. Genet. 66:187– 195. Horvath, I., L. E. Donnelly, A. Kiss, P. Paredi, S. A. Kharitonov, and P. J. Barnes. 1998. Raised levels of exhaled CO are associated with an increased expression of HO-1 in airway macrophages in asthma. Thorax 53:668–672. Chapman, J. T., L. E. Otterbein, J. A. Elias, and A. M. K. Choi. 2001. Carbon monoxide attenuates aeroallergen-induced inflammation in mice. Am. J. Physiol. Lung Cell. Mol. Physiol. 281:L209–L216. Minamino, T., H. Christou, C. M. Hsieh, Y. Liu, V. Dhawan, N. G. Abraham, M. A. Perrella, S. A. Mitsialis, and S. Kourembanas. 2001. Targeted expression of HO-1 prevents the pulmonary inflammatory and vascular responses to hypoxia. Proc. Natl. Acad. Sci. USA 98:8798–8803. Hashiba, T., M. Suzuki, Y. Nagashima, S. Suzuki, S. Inoue, T. Tsuburai, T. Matsuse, and Y. Ishigatubo. 2001. Adenovirus-mediated transfer of HO-1 cDNA attenuates severe lung injury induced by the influenza virus in mice. Gene Ther. 8:1499–1507. Rahman, I., E. Skwarska, M. Henry, M. Davis, C.M. O’Connor, M.X. FitzGerald, A. Greening, and W. MacNee. Systemic and pulmonary oxidative stress in idiopathic pulmonary fibrosis. Free Radic. Biol. Med. 27:60–68. Sleijfer, S. 2001. Bleomycin-induced pneumonitis. Chest 120:617–624. Pantelidis, P., G. C. Fanning, A. U. Wells, K. I. Welsh, and R. M. Du Bois. 2001. Analysis of TNF-␣, lymphotoxin-␣, TNF receptor II, and IL-6 polymorphisms in patients with idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 163:1432–1436. Miyazaki, Y., K. Araki, C. Vesin, I. Garcia, Y. Kapanci, J. A. Whitsett, P. F. Piguet, and P. Vassalli. 1995. Expression of a tumor necrosis factor-alpha transgene in murine lung causes lymphocytic and fibrosing alveolitis: a mouse model of progressive pulmonary fibrosis. J. Clin. Invest. 96:250–259. Liu, J. Y., D. M. Brass, G. W. Hoyle, and A. R. Brody. 1998. TNF-alpha receptor knockout mice are protected from the fibroproliferative effects of inhaled asbestos fibers. Am. J. Pathol. 153:1839–1847. Kondo, K., T. Okada, T. Matsui, S. Kato, K. Date, M. Yoshihara, Y. Nagata, H. Takagi, M. Yoneda, and I. Sugie. 2001. Establishment and characterization of a human B cell line from the lung tissue of a patient with scleroderma; extraordinary high level of IL-6 secretion by stimulated fibroblasts. Cytokine 13:220–226. Yoshida, M., J. Sakuma, S. Hayashi, K. Abe, I. Saito, S. Harada, M. Sakatani, S. Yamamoto, N. Matsumoto, and Y. Kaneda. 1995. A histologically distinctive interstitial pneumonia induced by overexpression of the interleukin 6, transforming growth factor beta 1, or platelet-derived growth factor B gene. Proc. Natl. Acad. Sci. USA 92:9570–9574. Pan, L. H., H. Ohtani, K. Yamauchi, and H. Nagura. 1996. Co-expression of TNF alpha and IL-1 beta in human acute pulmonary fibrotic diseases: an immunohistochemical analysis. Pathol. Int. 46:91–99. Kolb, M., P. J. Margetts, D. C. Anthony, F. Pitossi, and J. Gauldie. 2001. Transient expression of IL-1beta induces acute lung injury and chronic repair leading to pulmonary fibrosis. J. Clin. Invest. 107:1529–1536. Standiford, T. J., M. W. Rolfe, S. L. Kunkel, J. P. Lynch III, M. D. Burdick, A. R. Gilbert, M. B. Orringer, R. I. Whyte, and R. M. Strieter. 1993. Macrophage inflammatory protein-1 alpha expression in interstitial lung disease. J. Immunol. 151:2852–2863. Antoniades, H. N., J. Neville-Golden, T. Galanopoulos, R. L. Kradin, A. J. Valente, and D. T. Graves. 1992. Expression of monocyte chemoattractant protein 1 mRNA in human idiopathic pulmonary fibrosis. Proc. Natl. Acad. Sci. USA 89:5371–5375. Hasegawa, M., S. Sato, and K. Takehara. 1999. Augmented production of chemokines MCP-1, MIP-1alpha and MIP-1beta in patients with systemic sclerosis: MCP-1 and MIP-1alpha may be involved in the development of pulmonary fibrosis. Clin. Exp. Immunol. 117:159–165.

S86


33. Smith, R. E., R. M. Strieter, S. H. Phan, N. Lukacs, and S. L. Kunkel. 1998. TNF and IL-6 mediate MIP-1alpha expression in bleomycin-induced lung injury. J. Leukoc. Biol 64:528–536. 34. Gharaee-Kermani, M., E. M. Denholm, and S. H. Phan. 1996. Costimulation of fibroblast collagen and transforming growth factor beta1 gene expression by MCP-1 via specific receptors. J. Biol. Chem. 271:17779–17784. 35. Reitamo, S., A. Remitz, K. Tamai, and J. Uitto. 1994. Interleukin-10 modulates type I collagen and matrix metalloprotease gene expression in cultured human skin fibroblasts. J. Clin. Invest. 94:2489–2492. 36. Arai, T., K. Abe, H. Matsuoka, M. Yoshida, M. Mori, S. Goya, H. Kida, K. Nishino, T. Osaki, I. Tachibana, Y. Kaneda, and S. Hayashi. 2000. Introduction of the interleukin-10 gene into mice inhibited bleomycininduced lung injury in vivo. Am. J. Physiol. Lung Cell. Mol. Physiol. 278: L914–L922. 37. Dyck, D., L. E. Otterbein, and A. M. K. Choi. 2000. Carbon monoxide attenuates lipopolysaccharide-induced cytokine expression of IL-6 and IL-1␤. Am. J. Respir. Crit. Care Med. 161:A664. (Abstr.) 38. Tan, A., H. Levrey, C. Dahm, V. A. Polunovsky, J. Rubins, and P. B. Bitterman. 1999. Lovastatin induces fibroblast apoptosis in vitro and in vivo: a possible therapy for fibroproliferative disorders. Am. J. Respir. Crit. Care Med. 159:220–227. 39. Sambo, P., S. S. Baroni, M. Luchetti, P. Paroncini, S. Dusi, G. Orlandini, and A. Gabrielli. 2001. Oxidative stress in scleroderma: maintenance of scleroderma fibroblast phenotype by the constitutive up-regulation of reactive oxygen species generation through the NADPH oxidase complex pathway. Arthritis Rheum. 44:2653–2664. 40. Panchenko, M. V., H. W. Farber, and J. H. Korn. 2000. Induction of heme oxygenase-1 by hypoxia and free radicals in human dermal fibroblasts. Am. J. Physiol. Cell Physiol. 278:C92–C101. 41. Fujita, T., K. Toda, A. Karimova, S.-F. Yan, Y. Naka, S.-F. Yet, and D. J. Pinsky. 2001. Paradoxical rescue from ischemic lung injury by inhaled carbon monoxide driven by derepression of fibrinolysis. Nat. Med. 7:598– 604. 42. Zhang, M., B. H. Zhang, L. Chen, and W. An. 2002. Overexpression of heme oxygenase-1 protects smooth muscle cells against oxidative injury and inhibits cell proliferation. Cell Res. 12:123–132. 43. Minamino, T., H. Christou, C. M. Hsieh, Y. Liu, V. Dhawan, N. G. Abraham, M. A. Perrella, S. A. Mitsialis, and S. Kourembanas. 2001. Targeted expression of heme oxygenase-1 prevents the pulmonary inflammatory and vascular responses to hypoxia. Proc. Natl. Acad. Sci. USA. 98(15):8798–8803. 44. Ruiping, S., R. S. Mahidhara, F. Liu, W. Ning, L. E. Otterbein, and A. M. K. Choi. 2002. Carbon monoxide inhibits human airway smooth muscle cell proliferation via mitogen activated protein kinase pathway. Am. J. Respir. Cell Mol. Biol. 27:603–610. 45. Otterbein, L. E., B. S. Zuckerbraun, H. Manabu, F. Liu, R. Song, A. Usheva, C. Stachulak, N. Bodyak, R. N. Smith, E. Csizmadia, R. J. Flavell, T. R. Billiar, E. Tzeng, F. H. Bach, A. M. K. Choi, and M. P. Soares. 2003. Carbon

46.

47.

48. 49.

50.

51.

52.

53.

54.

55.

56. 57. 58.

monoxide suppresses arteriosclerotic lesions associated with chronic graft rejection and with balloon injury. Nat. Med. 9:1–8. Matsuoka H., T. Arai, M. Mori, S. Goya, H. Kida, H. Morishita, H. Fujiwara, I. Tachibana, T. Osaki, and S. Hayashi. 2002. A p38 MAPK inhibitor, FR167653, ameliorates murine bleomycin-induced pulmonary fibrosis. Am. J. Physiol. Lung Cell. Mol. Physiol. 283:L103–L112. Morse, D., L. E. Otterbein, S. Watkins, S. Alber, Z. Zhou, R. A. Flavell, R. J. Davis, and A. M. K. Choi. 2003. Deficiency in the c-Jun-NH2-terminal kinase (JNK) signaling pathway promotes resistance to hyperoxic lung injury in mice. Am. J. Physiol. Lung Cell. Mol. Physiol. (In press) Kothapalli, D., and G. R. Grotendorst. 2000. CTGF modulates cell cycle progression in cAMP-arrested NRK fibroblasts. J. Cell. Physiol. 182:119– 126. Goldberg, H. J., T. Huszar, M. M. Mozes, L. Rosivall, and I. Mucsi. 2002. Overexpression of the type II TGF␤ receptor inhibits fibroblasts proliferation and activates ERK and c-Jun N-terminal kinase. Cell Biol. Int. 26:165– 174. Hashimoto, S., Y. Gon, I. Takeshita, K. Matsumoto, S. Maruoka, and T. Horie. 2001. TGF␤1 induces phenotypic modulation of human lung fibroblasts to myofibroblast through a JNK-dependent pathway. Am. J. Respir. Crit. Care Med. 163:152–157. Dai, J., and A. Churg. 2001. Relationship of fiber surface iron and active oxygen species to expression of procollagen, PDGF-A, and TGF-␤(1) in tracheal explants exposed to amosite asbestos. Am. J. Respir. Cell Mol. Biol. 24:427–435. Lu, T. H., R. W. Lambrecht, J. Pepe, Y. Shan, and H. L. Bonkovsky. 1998. Molecular cloning, characterization, and expression of the chicken HO-1 gene in transfected primary cultures of chick embryo liver cells. Gene 207:177–186. Ning, W., R. Song, C. Li, E. Park, A. Mohsenin, A. M. K. Choi, and M. E. Choi. 2002. Transforming growth factor-␤1 stimulates heme oxygenase-1 via the p38 mitogen-activated protein kinase in A549 pulmonary epithelial cells. Am. J. Physiol. Lung Cell. Mol. Physiol. 283:L1094–L1102. Brouard, S., L. E. Otterbein, J. Anrather, E. Tobiasch, F. H. Bach, A. M. Choi, and M. P. Soares. 2000. Carbon monoxide generated by heme oxygenase-1 suppresses endothelial cell apoptosis. J. Exp. Med. 192:1015– 1026. Wang, H. D., M. Yamaya, S. Okinaga, Y. X. Jia, M. Kamanaka, H. Takahashi, L. Y. Guo, T. Ohrui, and H. Sasaki. 2002. Bilirubin ameliorates bleomycininduced pulmonary fibrosis in rats. Am. J. Respir. Crit. Care Med.. 165:406– 411. American Thoracic Society, European Respiratory Society. 2000. Idiopathic pulmonary fibrosis: diagnosis and treatment (international consensus statement). Am. J. Respir. Crit. Care Med. 161:646–664. Jarvis, M. J. 2001. Trends in weighted tar, nicotine, and CO yields of UK cigarettes. Thorax 56:960–963. Motterlini, R., J. E. Clark, R. Foresti, P. Sarathchandra, B. E. Mann, and C. J. Green. 2002. Carbon monoxide-releasing molecules: characterization of biochemical and vascular activities. Circ. Res. 90:E17–E24.


S87

Fibroblast Phenotypes in Pulmonary Fibrosis A key feature of pulmonary fibrosis is the presence of fibroblasts at sites of active fibrosis. In fact, the presence of a distinct lesion, termed a “fibroblastic focus,” composed of fibroblasts or fibroblast-like cells clustered together and relatively well-demarcated from surrounding cells, has been used as part of the histopathologic criteria for the diagnosis of usual interstitial pneumonitis (UIP), now considered to be synonymous with idiopathic pulmonary fibrosis (IPF) (1). Furthermore, the presence of such areas of active fibrosis is the most reliable prognosticator of progressive fibrosis leading to end-stage lung disease and a fatal outcome (2). Finally, there is ample evidence to suggest that the cells in these areas of active fibrosis are the main cellular source for extracellular matrix expression that typifies fibrosis. All these factors argue for a critical role or roles for these cells in the pathogenesis of progressive fibrosis. In fact, the presumed persistence of these cells may be the basis for disease progression instead of resolution, resulting in endstage lung disease. Hence, understanding the origin of these cells and their functional analysis should uncover key mechanisms involved in the pathogenesis of IPF and other fibrotic diseases. The situation, however, is complicated by evidence showing that these cells, even within the so-called fibroblastic foci, are phenotypically heterogeneous. The relationship, if any, between these various fibroblast phenotypes is unclear but worthy of study because the findings may provide novel insight into the potential origins of these cells and how they emerge de novo in fibrotic lesions. The objective of this section is to briefly review and highlight the evidence for the presence of diverse fibroblast phenotypes, their potential roles in pulmonary fibrosis, their origin(s), the mechanism of their emergence, and their possible fate in the context of disease progression versus resolution.

Fibroblast Phenotypes There is ample published evidence for heterogeneity in the phenotype of fibroblasts isolated from fibrotic lung tissue. This has been reported in animal model studies as well as in analysis of lung cells and tissue from patients with pulmonary fibrosis, and reviewed in a more comprehensive manner elsewhere (e.g., Refs. 3–5). An abbreviated review is presented here to exemplify the diversity of phenotypes, and their potential contribution to the pathogenesis of fibrosis and its diverse manifestations. Because fibrosis is characterized by increased cellularity and extracellular matrix deposition, early studies have attempted to analyze whether these characteristics are due to increased proliferative and synthetic capacity of the fibroblasts that could be isolated from fibrotic lung tissue. Such early studies have yielded conflicting results, possibly due to varying methods in cell isolation and heterogeneity in the distribution of the lesions typically encountered in the

This section was written by Sem H. Phan (Department of Pathology, University of Michigan, Ann Arbor, Michigan).

various idiopathic interstitial pneumonitides (IIPs). Even in those early studies, however, it is recognized that there are differences in the phenotypic characteristics of the fibroblast-like cells in fibrotic lung relative to those from nonfibrotic control lung. Thus the de novo presence of ␣-smooth muscle actin expressing myofibroblasts is noted in lung fibrotic lesions in both human and animal model studies (6–9). Subsequently these myofibroblasts are found to be the primary source of heightened type I procollagen gene expression in an animal model of lung injury and fibrosis (9). They are also thought to contribute to the altered mechanical properties of lung tissue (10). However, it is clear that even within active fibrotic lesions, the fibroblast population is quite heterogeneous, at least in terms of myofibroblast phenotype and collagen gene expression (9). Thus the myofibroblast phenotype that emerges de novo in fibrotic lungs appears to embody, and thus to be the likely cause for, most of the properties that typify the fibrotic lesion encountered in pulmonary fibrosis. Hence it could perhaps be construed as the “reference” fibroblast phenotype in active fibrosis that other phenotypes should be related or compared with in understanding how they emerge and participate in fibrosis. This is especially germane because the role(s) of some of the other reported phenotypes in fibrosis is not readily apparent based solely on their distinct phenotypic characteristics. Of relevance to pulmonary fibrosis is the Thy 1⫹ fibroblast phenotype that also exhibits profibrogenic properties (11). In contrast to Thy 1⫺ fibroblasts, Thy 1⫹ cells express higher levels of interstitial collagen, constitutively and in response to cytokine stimulation, consistent with a matrix deposition role in fibrosis. However, and interestingly, it is the Thy 1⫺ fibroblast that is more responsive to cytokine treatment and in vivo with respect to cell proliferation, interleukin (IL)-6, transforming growth factor (TGF)-␤1, platelet-derived growth factor-␣ receptor, and Ia (MHC class II) expression (12–14). Thus the potential roles of these two fibroblast phenotypes in fibrosis are not as immediately apparent as the myofibroblast, although the evidence based on their functional properties seems to point toward the Thy 1⫺ fibroblast as potentially playing a greater role than the Thy 1⫹ fibroblast. The relationship, if any, of these fibroblasts to myofibroblasts is unknown. More directly relevant to human IPF is the report of a low cyclooxygenase-2 (COX-2)–expressing phenotype in lung fibroblasts isolated from patients with IPF (15). Cells from fibrotic lung fail to respond to a variety of agonists in terms of induction of COX-2 expression. Cells of similar phenotype have also been reported in bleomycin-induced fibrotic lung (16). These cells, as well as lung fibroblasts isolated from COX-2–deficient mice, do not upregulate prostaglandin E2 (PGE2) production in response to TGF-␤1, and are unresponsive to its antiproliferative effect (16, 17). Because PGE2 is also known to inhibit collagen production, this low COX-2–expressing phenotype may account for the heightened matrix deposition and cellularity in fibrotic le-

S88


sions. Indeed, COX-2–deficient mice are known to have a more exuberant lung fibrotic response in animal model studies (17, 18). As with the Thy 1⫹ phenotype, the relationship of this low COX-2–expressing cell to myofibroblasts is also unknown. More recently, a telomerase-expressing fibroblast phenotype has been isolated from lungs of rats with bleomycininduced pulmonary fibrosis (19). As with the other phenotypes, this one also arises de novo, and its emergence correlates with the period of active fibrosis in this animal model. The role of this fibroblast phenotype in fibrosis is unclear, although this complex enzyme is known to be expressed by cells with high proliferative capacity and by certain cancerous cells, thus suggesting a possible role in cell proliferation to account for the increased cellularity of fibrotic lesions. It appears, however, that the significance of this phenotype extends beyond the well-known role of telomerase in elongating or maintaining telomere length (20). There is evidence that this phenotype can be differentiated to the myofibroblast phenotype under the influence of certain cytokines (21), but the mechanism is unknown. Thus, this brief review of several relatively well-characterized fibroblast phenotypes illustrates the de novo emergence of different subpopulations or populations of fibroblasts in pulmonary fibrosis. The origin of these fibroblasts with distinct phenotypes is unclear, but their phenotypes appear to be relatively stable, suggesting either differentiation from resident cell populations, and/or migration into the lung from extrapulmonary source(s) with or without local differentiation. Whether all these different fibroblasts eventually differentiate to myofibroblasts is also unknown. Thus, there are a number of important questions that remain unanswered with respect to fibroblast phenotypes in pulmonary fibrosis. The importance of studying these issues as a means of understanding the pathogenesis of pulmonary fibrosis rests on the fact that many of these phenotypic characteristics could account for many of the typical properties encountered in fibrotic lesions. This implies that understanding the function and origin of these fibroblast phenotypes, the mechanism of their emergence, and their fate in the natural history of pulmonary fibrotic diseases, may be key to understanding why fibrosis could become progressive and lead to end-stage disease, instead of resolving to allow for successful healing and survival of the patient.

The Roles of Fibroblast Phenotypes in Fibrosis The roles of the distinct phenotypes have been alluded to in the preceding paragraphs reviewing their identification and characterization. Preeminent among these is probably the production and deposition of extracellular matrix, a hallmark of fibrosis and resulting scars. Clearly, many of the properties of the phenotypes described are consistent with the enhanced elaboration of matrix and its deposition. The reference phenotype, namely the myofibroblast, best exemplified this characteristic with direct evidence available to indicate this phenotype as the primary source of type I procollagen gene expression in fibrotic lesions (9). Because smooth muscle cells in fibrotic lung and other nonfibroblastic cell types do not appear to express this interstitial type of collagen that is a primary constituent of scars, it is indis-

putable that this ␣-smooth muscle cell expression (myofibroblast) phenotype plays a major role in the deposition of matrix. The low COX-2–expressing phenotype should also contribute in this respect, because it is less subject to the inhibitory role of PGE2 (15). The role of the Thy 1⫹ and Thy 1⫺ cells is less clear in this respect, although the former is known to express higher levels of matrix than the latter (see above). Whether these COX-2 and/or latter two phenotypes need to acquire the myofibroblast phenotype to exhibit these functional property is unknown. A related characteristic of pulmonary fibrosis is inflammation, which can be present to varying degrees, depending partly on etiology and partly on the stage of disease or disease activity. This appears to be minimal in IPF/UIP, but may be more intense in other IIPs (22, 23). Whether inflammation is critical for the pathogenesis of fibrosis, especially in IPF, is uncertain, although ineffectiveness of antiinflammatory therapy and sparse inflammatory infiltrate in IPF lesions have been cited as evidence for the lack of its importance (23). Nevertheless, the presence of inflammatory cells in fibrotic lesions has the potential of providing a source of profibrogenic cytokines/mediators that may promote fibrosis. In this respect, the ability of myofibroblasts to elaborate such cytokines (e.g., monocyte chemotactic protein-1, TGF-␤1, etc.) indicates potential roles in inflammation given the inflammatory activity of these cytokines (24, 26). In fact, there is direct evidence that myofibroblasts are the key source of such cytokines during the later stages of fibrosis (24, 26). Similarly, enhanced elaboration of cytokines by Thy 1⫺ fibroblasts provides a similar argument for a role by certain fibroblast phenotypes in inflammation (see above). Another significant property of fibrotic tissue is its altered mechanical properties, namely decreased compliance or increased contractility. The myofibroblast phenotype, due partly to its expression of ␣-smooth muscle actin, exhibits this mechanical property, as demonstrated in wound contraction (26, 27) and in vitro in contraction of fibroblast populated collagen lattices (28). Myofibroblasts exhibit enhanced ability to contract collagen gels that is dependent on heightened endogenous TGF-␤1 expression (28). Thus there is compelling evidence to suggest such a mechanical role for myofibroblasts in pulmonary fibrosis. Hence, the myofibroblast phenotype alone (of all reviewed phenotypes) could participate directly in the pathogenesis of fibrosis, and be responsible for all three key characteristics (matrix deposition, inflammation, altered mechanical properties) of the fibrotic lesion, which earns it the designation of reference fibroblast phenotype.

Origin of Fibroblast Phenotypes The origin of the various phenotypes that have been reported for fibroblasts in fibrotic lung is either unknown or controversial, and made more so by recent discoveries in the area of stem cell biology revealing greater plasticity of such cells than previously suspected. In view of the greater amount of information available for the myofibroblast, the discussion here will use this phenotype as an example of current knowledge on the possible origins of fibroblast phenotypes in fibrosis. Based on its key phenotypic marker of


Figure 1. Possible inter-relationships between fibroblast phenotypes. In vitro and in vivo evidence suggests that myofibroblasts can emerge de novo in response to TGF-␤ (and other agents such as IL-4 and endothelin) treatment. Furthermore, telomeraseexpressing fibroblasts, possibly emerging under the influence of bFGF, lose telomerase expression when treated with TGF-␤ or IL-4, two stimuli known to induce myofibroblast differentiation. Because telomerase expression appears to be limited to fibroblasts that do not express ␣-smooth muscle actin, the totality of the evidence suggests that the telomerase expressing fibroblast may represent an intermediate cell that can further differentiate to the myofibroblast. Further research is necessary to map out the actual relationship, if any, between suppression of telomerase expression and induction of ␣-smooth muscle actin expression.

␣-smooth muscle actin expression, other such actin-expressing cells, such as pericytes and smooth muscle cells, are first to be considered as potential sources of myofibroblasts. However, kinetic studies of the de novo appearance of myofibroblasts in an animal model suggest that myofibroblasts first arise from the adventitial areas of small bronchioles and adjacent vascular structures, areas that are normally devoid of any ␣-smooth muscle actin–expressing cells (9). Hence, it appears that myofibroblasts in lung fibrotic lesions may arise from resident fibroblasts in the airway and vascular adventitia, which subsequently differentiate to myofibroblasts under the influence of certain mediators. Indeed, this can be reproduced in vitro by treatment of isolated lung fibroblasts with cytokines such as TGF-␤1, IL-4, and IL-13 (28–30). The origins of other fibroblast phenotypes found in fibrotic lung are unknown, although the assumption is that they are also derived from resident lung fibroblasts as well. Thus, through some differentiation mechanism the emergence of these diverse, perhaps inter-related, phenotypes, is thought to be derived from pre-existing resident lung fibroblasts under the influence of factors secreted by adjacent lung cells, including epithelial, endothelial, and inflammatory cells (Figure 1). This concept, however, is now challenged by recent evidence that certain lung cells may be derived from progenitor cells in the bone marrow (31, 32). Indeed, and more germane to pulmonary fibrosis, myofibroblasts at sites of wound healing may be derived from nonresident, circulating cells, termed fibrocytes (33). These cells are distinct from known

S89

circulating leukocyte populations and express collagen I, CD11b, CD13, CD34, CD45RO, MHC class II, and CD86, and comprise 0.1–0.5% of the nonerythrocytic cells in peripheral blood. In culture, these cells are adherent and assume a spindle-shaped morphology, and can respond to TGF-␤ treatment by differentiating into myofibroblasts. When such cells are labeled with the fluorescent dye PKH26 and injected intravenously, they readily home into sites of tissue injury. This homing mechanism appears to be mediated by secondary lymphoid chemokine (SLC), the ligand for CCR7 (33). These findings raise the possibility that some, if not all, of the observed fibroblast phenotypes in fibrotic lungs may be derived from circulating fibrocytes. There is already evidence that this is the case with respect to the myofibroblast, at least in wound healing in the skin. It is tantalizing to speculate that this may be the case as well in pulmonary fibrosis, and in the case of the other fibroblast phenotypes that arise de novo during fibrosis. This certainly would account for the very different phenotypes and responses of the fibroblasts in injured/fibrotic lungs vis-a`-vis resident fibroblasts isolated from control/ normal lungs. Nevertheless, further studies are needed to directly confirm that fibrocytes are recruited to the lung in pulmonary fibrosis, and that they can then differentiate to give rise to the diverse phenotypes discussed in preceding paragraphs. If confirmed, this would be an important advance requiring a revision in current thinking in terms of the pathogenesis of IPF and other fibrotic lung diseases, and developing novel strategies for controlling the progression of undesirable fibrosis.

Mechanism of Emergence of Phenotypes There is evidence that at least for some phenotypes, their emergence is regulated by a variety of factors, some of which are known to be present in lung tissues undergoing fibrosis (Figure 1). Again, most of the information is available for the myofibroblast, with preliminary information available for the telomerase-expressing phenotype (21). As previously cited, lung fibroblasts can differentiate to myofibroblasts under the influence of TGF-␤ and a number of other cytokines. Further studies into how these cells differentiate have focused on the involved signaling pathways, and regulation of transcription of the ␣-smooth muscle actin gene, a key marker of differentiation. With respect to TGF-␤– or IL-13–induced myofibroblast differentiation, there is evidence of a role for Jun kinase (JNK), but not p38 MAP kinase (30, 34). In addition to the requirement for a soluble stimuli, such as TGF-␤, mechanical stress appears to be essential for maximal differentiation to myofibroblasts (35). In fact, without both these factors only an intermediate phenotype is observed, termed the proto-myofibroblast, consistent with a multistage process of differentiation. Studies of the ␣-smooth muscle actin promoter suggests the importance of a number of transcription factors in regulating expression of this gene. Studies in rat lung myofibroblasts confirmed the importance of the TGF-␤ control element (TCE) in ␣-smooth muscle actin gene expression induced by TGF-␤1, but in contrast to smooth muscle cells, the role of CArG elements cannot be demonstrated in myofibroblasts (36, 37). A number of transcription factors that

S90


can bind to the TCE has been reported, and include a variety of Kru¨ppel-like factors, Sp1 and Sp3 (38, 39). Thus, it appears that regulation of this gene in myofibroblast differentiation is likely to be complex and will require further study for complete elucidation. There is less or no information available on the mechanism of emergence of the other fibroblast phenotypes that have been reported in fibrotic lung lesions. There is, however, some evidence that the telomerase expressing phenotype may be induced by bFGF (Figure 1), but this appears to be significant only in cells isolated from injured lungs with only minimal response observed in fibroblasts isolated from control lung tissue (21). This indicates that there is either an intermediate activated phenotype that become fully responsive to basic fibroblast growth factor (bFGF), or a distinct (possibly nonresident and fibrocyte-derived) bFGF-responsive population of cells is recruited to injured lungs. In either case, subsequent exposure to high levels of bFGF expressed during lung injury and fibrosis may induce this phenotype with induction of telomerase gene expression. Further studies are required to elucidate how bFGF regulate telomerase gene expression. Thus, there is much to be done to begin to uncover the mechanisms responsible for emergence of these various fibroblast phenotypes. Current evidence suggests the importance of an ordered program of transcription factors in regulation of cell differentiation, and understanding this program is key to further progress in unraveling the key mechanisms in fibroblast phenotype emergence in pulmonary fibrosis. Indeed, there is evidence that exposing fibroblasts to cell extracts from lymphocytes or neuronal cells may program them to differentiate and assume the phenotypes of lymphocytes or neuronal cells, respectively (40). Thus, identification of the transcription factors responsible for ␣-smooth muscle actin may be instructive for elucidating the emergence of the myofibroblast, for instance.

Fate of Fibroblast Phenotypes In normal wound healing and animal models of self-limiting pulmonary fibrosis, the number of myofibroblasts gradually declines as the healing process or active fibrosis is successfully completed or terminated (9, 27, 41), but seems to persist in lung tissue from patients with progressive pulmonary fibrosis (7). Similarly, the number of telomerase-expressing fibroblasts appears to decline as active fibrosis wanes in an animal model (19). Thus, there seems to be some correlation between appearance of some of these fibroblast phenotypes and active fibrosis. This is hardly surprising considering the functional roles of some of these phenotypes as discussed above, especially for the reference myofibroblast phenotype. Thus, in addition to understanding the mechanism of their emergence, it would be insightful to also study the fate of these phenotypes, and especially its underlying cellular and molecular mechanisms. Studies of the fate of the myofibroblast are instructive in this regard. Successful healing is accompanied by disappearance of the myofibroblast that is critical for adequate deposition of extracellular matrix and wound contraction. The mechanism of this disappearance appears to be via apoptosis (42). Indeed, studies using lung myofibroblasts suggest that they

Figure 2. NO-mediated myofibroblast apoptosis and its inhibition by TGF-␤. The fate of the myofibroblast in normal repair is to disappear by apoptosis as healing nears completion. Although the actual trigger for apoptosis in this instance has not been identified, in vitro studies indicate that at least IL-1␤ is able to selectively induce apoptosis in rat lung myofibroblasts via induction of iNOS in adjacent fibroblasts, which themselves appear to be resistant to NO. This apoptotic response is associated with a reduction in expression of the anti-apoptotic protein bcl-2. TGF-␤ treatment abrogates the apoptotic response by suppression of iNOS induction and prevents the reduction in bcl-2 expression. Thus the potent fibrogenic effects of TGF-␤ are 2-fold with respect to promoting myofibroblast survival and persistence, namely by inducing myofibroblast differentiation and protecting the differentiated cell from apoptosis.

are selectively more susceptible to undergo NO-mediated apoptosis relative to fibroblasts (43). However, in the presence of TGF-␤1, these myofibroblasts are protected against apoptosis (Figure 2) by suppressing induction of inducible NO synthase (iNOS) and blocking reduction in expression of the anti-apoptotic protein, bcl-2 (44). This highlights and illustrates at the cellular level the critical importance of TGF-␤ in both myofibroblast emergence and persistence. The actual in vivo signal for myofibroblast apoptosis is unknown, and certainly warrants further investigation given its significance as a potential means of terminating fibrosis by induction of selective myofibroblast apoptosis. The fates of other fibroblast phenotypes either in animal models of pulmonary fibrosis, or in the context of the natural history of fibrotic lung diseases, are unknown or less well defined than that for myofibroblasts. There is recent evidence that the telomerase-expressing phenotype is also present during active fibrosis, but disappears when the fibrosis wanes (19). Furthermore, telomerase-expressing cells isolated from fibrotic lungs can be induced to differentiate to myofibroblasts by TGF-␤1 or IL-4, suggesting that this phenotype may be an intermediate toward terminal differentiation to the myofibroblast phenotype (Figure 1). It is clear, however, that this is not an obligatory intermediate phenotype, because normal lung (telomerase-negative) fibroblasts can differentiate directly to myofibroblasts when treated with the same cytokines, without expressing te-


lomerase. Nevertheless, the relationship between loss of telomerase expression and induction of ␣-smooth muscle actin expression in this transition to the myofibroblast phenotype is worthy of further study because it may provide clues as to the overall mechanism of myofibroblast emergence. It may be that the telomerase-expressing fibroblasts may be derived from the fibrocytes and thus capable of uniquely responding to select cytokines for differentiation to the myofibroblast that may be different from that derived from resident normal lung fibroblasts.

S91

15.

16.

17.

Conclusion The importance of studying the diverse fibroblast phenotypes that are present only in fibrotic lung lie in their known functional properties, which contribute directly or indirectly to the fibrotic process. These phenotypes appear to be stable, and their presence usually correlates with periods and sites of active fibrosis. There is strong suggestive evidence that it is the persistence of such fibroblast phenotypes, and especially the myofibroblast, that determines progressive fibrosis, whereas their disappearance may prove to be important in resolution and successful healing. Hence, further studies on these phenotypes along the lines of how this review is organized may be warranted. References 1. Katzenstein, A. A., and J. L. Myers. 1998. Idiopathic pulmonary fibrosis: clinical relevance of pathologic classification. Am. J. Respir. Crit. Care Med. 157:1301–1315. 2. King, T. E., Jr., M. I. Schwarz, K. Brown, J. A. Tooze, T. V. Colby, J. A. Waldron, Jr., A. Flint, W. Thurlbeck, and R. M. Cherniack. 2001. Idiopathic pulmonary fibrosis: relationship between histopathologic features and mortality. Am. J. Respir. Crit. Care Med. 164:1025–1032. 3. Phipps, P., editor. 1992. Fibroblast Heterogeneity in Pulmonary Fibrosis. CRC Press, Boca Raton, FL. 4. Fries, K. M., T. Blieden, R. J. Looney, G. D. Sempowski, M. R. Silvera, R. A. Willis, and R. P. Phipps. 1994. Evidence of fibroblast heterogeneity and the role of fibroblast subpopulations in fibrosis. Clin. Immunol. Immunopathol. 72:283–292. 5. Phan, S. H., and R. S. Thrall, editors. 1995. Pulmonary Fibrosis. Marcel Dekker, New York. 6. Mitchell, J., J. Woodcock-Mitchell, S. Reynolds, R. Low, K. O. Leslie, K. Adler, G. Gabbiani, and S. Omar. 1989. ␣-Smooth muscle actin in parenchymal cells of bleomycin-injured rat lung. Lab. Invest. 60:643–650. 7. Kuhn, C., and J. A. McDonald. 1991. The roles of the myofibroblast in idiopathic pulmonary fibrosis. Ultrastructural and immunohistochemical features of sites of active extracellular matrix synthesis. Am. J. Pathol. 138:1257–1265. 8. Kapanci, Y., A. Desmouliere, J. C. Pache, M. Redard, and G. Gabbiani. 1995. Cytoskeletal protein modulation in pulmonary alveolar myofibroblasts during idiopathic pulmonary fibrosis: possible role of transforming growth factor-␤ and tumor necrosis factor-␣. Am. J. Respir. Crit. Care Med. 152: 2163–2169. 9. Zhang, K., M. D. Rekhter, D. Gordon, and S. H. Phan. 1994. Co-expression of ␣-smooth muscle actin and type I collagen in fibroblast-like cells of rat lungs with bleomycin-induced pulmonary fibrosis: a combined immunohistochemical and in situ hybridization study. Am. J. Pathol. 145:114–125. 10. Adler, K. B., R. B. Low, K. O. Leslie, J. Mitchell, and J. N. Evans. 1989. Biology of disease: contractile cells in normal and fibrotic lung. Lab. Invest. 60:473–485. 11. Derdak, S., D. P. Penney, P. Keng, M. E. Felch, D. Brown, and R. P. Phipps. 1992. Differential collagen and fibronectin production by Thy 1⫹ and Thy 1- lung fibroblast subpopulations. Am. J. Physiol. 263:L283–L290. 12. Hagood, J. S., A. Mangalwadi, B. Guo, M. W. MacEwen, L. Salazar, and G. M. Fuller. 2002. Concordant and discordant interleukin-1–mediated signaling in lung fibroblast thy-1 subpopulations. Am. J. Respir. Cell Mol. Biol. 26:702–708. 13. McIntosh, J. C., J. S. Hagood, T. L. Richardson, and J. W. Simecka. 1994. Thy1(⫹) and (-) lung fibrosis subpopulations in LEW and F344 rats. Eur. Respir. J. 7:2131–2138. 14. Silvera, M. R., G. D. Sempowski, and R. P. Phipps. 1994. Expression of

18.

19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29.

30.

31. 32. 33. 34.

35. 36. 37.

38.

TGF-␤ isoforms by Thy-1⫹ and Thy-1- pulmonary fibroblast subsets: evidence for TGF-␤ as a regulator of IL-1 dependent stimulation of IL-6. Lymphokine Cytokine Res. 13:277–285. Wilborn, J., L. J. Crofford, M. D. Burdick, S. L. Kunkel, R. M. Strieter, and M. Peters-Golden. 1995. Cultured lung fibroblasts isolated from patients with idiopathic pulmonary fibrosis have a diminished capacity to synthesize prostaglandin E2 and to express cyclooxygenase-2. J. Clin. Invest. 95:1861–1868. Ogushi, F., T. Endo, K. Tani, K. Asada, T. Kawano, H. Tada, K. Maniwa, and S. Sone. 1999. Decreased prostaglandin E2 synthesis by lung fibroblasts isolated from rats with bleomycin-induced lung fibrosis. Int. J. Exp. Pathol. 80:41–49. Keerthisingam, C. B., R. G. Jenkins, N. K. Harrison, N. A. HernandezRodriguez, H. Booth, G. J. Laurent, S. L. Hart, M. L. Foster, and R. J. McAnulty. 2001. Cyclooxygenase-2 deficiency results in a loss of the antiproliferative response to transforming growth factor-␤ in human fibrotic lung fibroblasts and promotes bleomycin-induced pulmonary fibrosis in mice. Am. J. Pathol. 158:1411–1422. Bonner, J. C., A. B. Rice, J. L. Ingram, C. R. Moomaw, A. Nyska, A. Bradbury, A. R. Sessoms, P. C. Chulada, D. L. Morgan, D. C. Zeldin, and R. Langenbach. 2002. Susceptibility of cyclooxygenase-2 deficient mice to pulmonary fibrogenesis. Am. J. Pathol. 161:459–470. Nozaki, Y., T. Liu, K. Hatano, M. Gharaee-Kermani, and S. H. Phan. 2000. Induction of telomerase activity in fibroblasts from bleomycin-injured lungs. Am. J. Respir. Cell Mol. Biol. 23:460–465. Blasco, M. A. 2002. Telomerase beyond telomeres. Nat. Rev. Cancer 2:627– 633. Liu, T., M. Ullenbruch, Y. Nozaki, and S. H. Phan. 2002. Regulation of telomerase activity in lung fibroblasts. Am. J. Respir. Cell Mol. Biol. 26: 534–540. Gross, T. J., and G. W. Hunninghake. 2001. Idiopathic pulmonary fibrosis. N. Engl. J. Med. 345:517–525. Selman, M., T. E. King, Jr., and A. Pardo. 2001. Idiopathic pulmonary fibrosis: prevailing and evolving hypotheses about its pathogenesis and implications for therapy. Ann. Intern. Med. 134:136–151. Zhang, K., K. C. Flanders, and S. H. Phan. 1995. Cellular localization of transforming growth factor ␤ expression in bleomycin-induced pulmonary fibrosis. Am. J. Pathol. 147:352–361. Zhang, K., M. Gharaee-Kermani, M. L. Jones, J. S. Warren, and S. H. Phan. 1994. Monocyte chemoattractant protein-1 gene expression in bleomycininduced pulmonary fibrosis. J. Immunol. 153:4733–4741. Gabbiani, G., B. J. Hirschel, G. B. Ryan, P. R. Statkow, and G. Majno. 1972. Granulation tissue as a contractile organ: a study of structure and function. J. Exp. Med. 135:719–734. Gabbiani, G., G. B. Ryan, and G. Majno. 1971. Presence of modified fibroblasts in granulation tissue and their possible role in wound contraction. Experientia 27:549–550. Zhang, H., M. Gharaee-Kermani, K. Zhang, and S. H. Phan. 1996. Lung fibroblast contractile and ␣-smooth muscle actin phenotypic alterations in bleomycin-induced pulmonary fibrosis. Am. J. Pathol. 148:527–537. Desmouliere, A., A. Geinoz, F. Gabbiani, and G. Gabbiani. 1993. Transforming growth factor-␤1 induces ␣-smooth muscle actin expression in granulation tissue myofibroblasts and in quiescent and growing cultured fibroblasts. J. Cell Biol. 122:103–111. Hashimoto, S., Y. Gon, I. Takeshita, S. Maruoka, and T. Horie. 2001. IL-4 and IL-13 induce myofibroblastic phenotype of human lung fibroblasts through c-Jun NH2-terminal kinase-dependent pathway. J. Allergy Clin. Immunol. 107:1001–1008. Krause, D. S., N. D. Theise, M. I. Collector, O. Henegariu, S. Hwang, R. Gardner, S. Neutzel, and S. J. Sharkis. 2001. Multi-organ, multi-lineage engraftment by a single bone marrow-derived stem cell. Cell 105:369–377. Kotton, D. N., B. Y. Ma, W. V. Cardoso, E. A. Sanderson, R. S. Summer, M. C. Williams, and A. Fine. 2001. Bone marrow-derived cells as progenitors of lung alveolar epithelium. Development 128:5181–5188. Abe, R., S. C. Donnelly, T. Peng, R. Bucala, and C. N. Metz. 2001. Peripheral blood fibrocytes: differentiation pathway and migration to wound sites. J. Immunol. 166:7556–7562. Hashimoto, S., Y. Gon, I. Takeshita, K. Matsumoto, S. Maruoka, and T. Horie. 2001. Transforming growth factor-␤1 induces phenotypic modulation of human lung fibroblasts to myofibroblast through a c-Jun-NH2terminal kinase-dependent pathway. Am. J. Respir. Crit. Care Med. 163: 152–157. Tomasek, J. J., G. Gabbiani, B. Hinz, C. Chaponnier, and R. A. Brown. 2002. Myofibroblasts and mechano-regulation of connective tissue remodeling. Nat. Rev. Mol. Cell Biol. 3:349–363. Roy, S. G., Y. Nozaki, and S. H. Phan. 2001. Regulation of ␣-smooth muscle actin gene expression in myofibroblast differentiation from rat lung fibroblasts. Int. J. Biochem. Cell. Biol. 33:723–734. Hautmann, M. B., C. S. Madsen, and G. K. Owens. 1997. A transforming growth factor ␤ (TGF␤) control element drives TGF␤-induced stimulation of smooth muscle alpha-actin gene expression in concert with two CArG elements. J. Biol. Chem. 272:10948–10956. Adam, P. J., C. P. Regan, M. B. Hautmann, and G. K. Owens. 2000. Positive-

S92


and negative-acting Kruppel-like transcription factors bind a transforming growth factor beta control element required for expression of the smooth muscle cell differentiation marker SM22alpha in vivo. J. Biol. Chem. 275:37798–37806. 39. Cogan, J. G., S. V. Subramanian, J. A. Polikandriotis, R. J. Kelm, Jr., and A. R. Strauch. 2002. Vascular smooth muscle ␣-actin gene transcription during myofibroblast differentiation requires Sp1/3 protein binding proximal to the MCAT enhancer. J. Biol. Chem. 277:36433–36442. 40. Hakelien, A. M., H. B. Landsverk, J. M. Robl, B. S. Skalhegg, and P. Collas. 2002. Reprogramming fibroblasts to express T-cell functions using cell extracts. Nat. Biotechnol. 20:460–466.

41. Darby, I., O. Skalli, and G. Gabbiani. 1990. ␣-Smooth muscle actin is transiently expressed by myofibroblasts during experimental wound healing. Lab. Invest. 63:21–29. 42. Desmouliere, A., M. Redard, I. Darby, and G. Gabbiani. 1995. Apoptosis mediates the decrease in cellularity during the transition between granulation tissue and scar. Am. J. Pathol. 146:56–66. 43. Zhang, H., M. Gharaee-Kermani, and S. H. Phan. 1997. Regulation of lung fibroblast ␣-smooth muscle actin expression, contractile phenotype and apoptosis by IL-1␤. J. Immunol. 158:1392–1399. 44. Zhang, H., and S. H. Phan. 1999. Inhibition of myofibroblast apoptosis by transforming growth factor ␤1. Am. J. Respir. Cell Mol. Biol. 21:658–665.


S93

The Epithelial/Fibroblastic Pathway in the Pathogenesis of Idiopathic Pulmonary Fibrosis Tying Loose Ends

The prevailing hypothesis regarding the pathogenesis of the fibrotic lung disorders supports a sequence of events initiated by a lung injury, which is followed by an inflammatory process, and then by fibroproliferation and fibrosis. This hypothesis assumes that: (i ) chronic and unsolved inflammation precedes the fibrotic response, and (ii) it plays a major role in lung fibrogenesis. However, a growing body of evidence suggests that this sequence of events may explain the pathogenesis of most interstitial lung diseases (ILD) evolving to fibrosis, but not of idiopathic pulmonary fibrosis/usual interstitial pneumonia (IPF/UIP). In this context, we have recently proposed that there are at least two different pathogenic routes for developing pulmonary fibrosis, the inflammatory pathway represented by almost all non-IPF interstitial lung diseases and the epithelial pathway represented by IPF (1, 2). Morphologic evidence has clearly demonstrated that most cases of non-IPF ILD exhibit initially an inflammatory response with scant, if any, fibrosis. This diffuse or multifocal inflammatory reaction is observed in diseases of unknown (i.e., sarcoidosis, desquamative interstitial pneumonia) or known (i.e., hypersensitivity pneumonitis, drugs) damaging agents and may or may not evolve to fibrosis. By contrast, cases of IPF usually show scant inflammation, always alternating with zones of scarring, active fibrosis, normal lung, and honeycomb changes, and at all times the disease progress until the end-stage lung. Both the inflammatory and the epithelial pathways may release and activate a number of cytokines/growth factors inducing fibroblast migration/proliferation and phenotype change to myofibroblasts, with the subsequent accumulation and remodeling of extracellular matrix. Importantly, both pathogenic routes share many of the mechanisms/ molecules involved in fibrogenesis, but differ in others. The proposed epithelial/fibroblast sequence for IPF does not imply that there is no inflammation in the lungs, but that the inflammatory response neither precedes nor plays a relevant role in its pathogenesis. Thus, for example, it has been recently demonstrated that IPF/UIP lungs studied both in biopsy and subsequent explant specimens frequently show areas of nonspecific interstitial pneumonia (NSIP), that is, a uniform thickening of alveolar septa by fibrosis with variable amounts of admixed chronic inflammation (3). However, no evidence was found suggesting that NSIP is a precursor of IPF/UIP, and moreover, no case of UIP at explant had a prior biopsy showing NSIP (3).

This section was written by Moise´s Selman and Annie Pardo (Instituto Nacional de Enfermedades Respiratorias, Tlalpan, Me´xico; and Facultad de Ciencias, Universidad Nacional Auto´noma de Me´xico, Me´xico).

Epithelial Cells: Multifaceted Target and Effector Cells A marked disruption in the integrity of the alveolar epithelium with presence of several altered phenotypes is a distinctive feature in IPF lungs. Morphologic phenotypes may include: (i ) hyperplastic type 2 pneumocytes, (ii) reactive large and elongated epithelial cells (putative transitional cells among type 2 and type 1 pneumocytes), (iii) flattened and attenuated epithelial cells usually overlying the fibroblastic foci, (iv) bronchiolar-type epithelium lining the enlarged airspaces of honeycomb lesions, and (v ) squamous metaplasia. Importantly, lung carcinomas develop in a high percentage of patients with IPF, and it may be difficult to differentiate prominent reactive epithelial proliferations from well-differentiated adenocarcinomas (4). The reasons for all these epithelial changes are unknown, but some of them seem to be related to the initial insult, whereas others appear to represent a reactive response to lung remodeling. Regarding the former, although the etiology of IPF is unknown and probably multifactorial in a susceptibly host, the putative injuring candidates are likely associated with an initial alveolar epithelial damage. Thus, environmental exposure to different dusts, gastroesophageal reflux, and viral infections have been associated with the development of IPF, suggesting that diverse epithelial injuries may trigger the disease in different individuals (5–11). On the other hand, accelerated epithelial cell proliferation is noted in hyperplastic epithelial foci from IPF lungs, supporting the presence of regenerative epithelia after injury (12, 13). Additionally, numerous microscopic areas of alveolar epithelial cell dropout, often intercalated with hyperplastic cells, are noted in IPF lungs. The reason for epithelial cell loss is unclear, but it is likely interrelated to cell apoptosis and necrosis. In this context, a number of observations in IPF biopsy specimens have demonstrated evidence of programmed cell death in bronchiolar and alveolar epithelial cells, and moreover, epithelial apoptosis may be seen in otherwise normal areas of the lung parenchyma or colocalizing with areas of fibroblastic/myofibroblastic foci (14–16). Several mechanisms appear to be involved in pneumocytes apoptosis including a fas-signaling pathway which has been found upregulated in alveolar epithelial cells from IPF lungs, and the release by fibroblasts of angiotensin peptides (17, 18). Recently, it has been suggested that recurrent bronchiolar injury is also present in this disease, supporting the idea that epithelial damage is not restricted to the alveolar compartment (19). Furthermore, it was noticed that epithelial cells at sites of abnormal proliferation at the bronchiolo– alveolar junctions expressed the p63 gene which counteract the apoptotic and cell inhibitory functions of p53 after DNA damage. This finding may suggest that after alveolar epithe-

S94


lial cell death, progressive bronchiolar proliferation is primarily responsible for epithelial renewal endeavor in IPF lungs. In general terms, all this evidence supports the notion that a dysfunctional epithelial repair process with lack of appropriate re-epithelialization is a key feature of IPF. It is important to emphasize that the exquisite alveolar– capillary structures can adequately reorganize in adults following severe injuries by microorganisms, environmental insults, or blood-borne toxins (20). What is it, then, that fails during the development of IPF, when progressive and bizarre remodeling ensues? The answer is unknown, but should constitute a masterpiece in the understanding of the pathogenesis of IPF and in the rationale of new therapeutic approaches.

Epithelial Cells Actively Contribute to Lung Fibrogenesis Alveolar Epithelial Cells Are the Main Source of Growth Factors for Fibroblasts Studies performed in tracheal and lung explants have demonstrated that airway or lung epithelium damage may induce a fibrotic response, and that neither airspace nor circulating inflammatory cells are required for these effects (21, 22). Moreover, by coculturing airway epithelial cells and fibroblasts, it has been demonstrated that mechanical injury of epithelial cells induces myofibroblast differentiation (23). The appearance of myofibroblasts was synchronized with the epithelial redifferentiation process and extracellular matrix synthesis suggesting that mechanical injury to epithelium causes tissue remodeling (23). In IPF, there is increasing evidence supporting the idea that alveolar epithelial cells are the primary source of cytokines and growth factors involved in fibroblast migration and proliferation, and myofibroblast differentiation. Thus, various studies performed by in situ hybridization and immunohistochemistry have demonstrated that in this disease, alveolar epithelial cells are the main site of synthesis of platelet-derived growth factor (PDGF), transforming growth factor-␤ (TGF-␤), and tumor necrosis factor-␣ (TNF-␣), all of them central pieces for the development of pulmonary fibrosis (24–28). Likewise, endothelin-1, a multifunctional peptide able to induce mesenchymal cell mitosis is strongly upregulated in type 2 pneumocytes primarily in those located close to fibroblastic foci (29). Connective tissue growth factor (CTGF), a chemotactic and mitogenic factor for fibroblasts, is also upregulated in type 2 alveolar epithelial cells and fibroblasts in IPF lungs (30). In addition, it can be speculated that, like in some experimental models, alveolar epithelial cells may contribute to fibrogenesis not only because they synthesize profibrotic cytokines, but also because they might be unable to secrete some inhibitors of fibroblast migration/proliferation such as prostaglandin-E2 (31). Alveolar Epithelial Cells Induce a Procoagulant Intra-alveolar Environment Alveolar damage results in transudation of plasma proteins and activation of the coagulation mechanisms leading to the

formation of fibrin-rich intra-alveolar exudates. Persistent activation of intra-alveolar procoagulant activity and subsequent abnormal fibrin turnover enhances a fibrotic response. Importantly, there is a growing body of evidence supporting that alveolar epithelial cells contribute to the increased antifibrinolytic activities in IPF. Thus, it has been demonstrated that tissue factor, the primary cellular initiator of the coagulation protease cascade, and plasminogen activator inhibitor (PAI)-1 are strongly expressed by alveolar epithelial cells (32–34). Imokawa and coworkers (33) found that tissue factor mRNA and protein is primarily expressed by alveolar epithelial cells covering the affected alveolar septa and the fibroblastic foci, and that in the same patients, fibrin is deposited in the type II pneumocyte layer and the adjacent areas. Increased procoagulant activity may have several harmful consequences on the local milieu, including fibrin accumulation, lack of activation of some matrix metalloproteinases (MMPs) responsible for extracellular matrix turnover, impairment of epithelial cell migration, and a thrombinmediated increase of fibroblast activation and transition to myofibroblasts, thereby enhancing a fibrotic process (35–38). Alveolar Epithelial Cells Are an Important Source of MMPs Studies using oligonucleotide microarrays to evaluate gene expression patterns have demonstrated that several MMPs are strongly upregulated in IPF lungs (39). Importantly, at least two of them, collagenase-1 (MMP-1) and matrilysin (MMP-7), are mainly expressed by epithelial cells (39, 40). The significance of this finding in IPF is presently unknown since its activity do not only include the degradation of extracellular matrix components, but also the modulation of the activity of a number of growth factors and cytokines either by direct cleavage, or releasing them from extracellular matrix bound stores (41). Therefore, their presence can be related with epithelial cell migration, with the promotion of cell growth, or the induction of apoptosis, among other effects.

Other Human Fibrotic Diseases Driven by Epithelial Cells There are several human fibrotic disorders in which scarring is preceded by epithelial cell injury/activation, and were inflammatory infiltrates are rare or are not a feature of the disease. Following are some examples. Idiopathic Focal Segmental Glomerulosclerosis Idiopathic focal segmental glomerulosclerosis is a primary renal disease frequently associated with steroid-resistant nephrotic syndrome. Actually, despite diverse therapeutic approaches, most patients progress to chronic renal failure (42). A number of changes in glomerular visceral epithelial cells characterize this disorder, and include proliferation, hypertrophy, vacuolization, protein resorption droplets, nuclear changes, and separation from the glomerular basement membrane (43). Actually, podocyte degeneration and detachment from the glomerular basement membrane with epithelial hyperplasia, referred as the “cellular lesion,” are the initial events that are followed by the development of


S95

segmental scars. Inflammation is not a feature in this disorder. Interestingly, it is considered that the cellular-epithelial lesion (not the fibrotic lesion), mainly when it is widely distributed among the glomeruli, has adverse implications for therapeutic response and outcome (43). Several lines of evidence support the evolution from the cellular lesion to glomerular fibrosis. Thus for example, in serial biopsies from renal transplant recipients who develop recurrent focal segmental glomerulosclerosis, early onset of massive proteinuria coincides with minimal light microscopic changes. With time the epithelial lesion develops, but segmental scarring is only noticed in renal biopsies taken late in the clinical course, suggesting that the cellular (epithelial) lesion heals with the formation of segmental scar. (44).

lar matrix. These cells are fibroblasts/myofibroblasts that seem to be transdifferentiated from the epithelial cells. There is extracellular matrix accumulation including collagen types I and III, tenascin, and fibronectin, and the formation of a new epithelial-like layer extending between the subcapsular plaque and the underlying fibrotic reaction (50–52). Inflammation is not a feature in this disorder. TGF-␤ has been implicated as a key player in the cataractous changes, and increased expression of TGF-␤–inducible gene h3 has been observed in lens epithelial cells from patients with anterior polar cataracts (53). Furthermore, in both transgenic mouse and rat lens culture models TGF-␤ induces markers similar to those found in the human disease (52, 54).

Biliary Type Liver Fibrosis This fibrotic reaction develops in response to bile duct injury in chronic cholestatic liver diseases, and it has been recently postulated that the bile duct epithelial cells may be the key cells in the induction of biliary type liver fibrogenesis (45). They express and release a number of profibrotic mediators such as TGF-␤, CTGF, PDGF-BB, and endothelin-1 that activate different mesenchymal cell types, including hepatic stellate cells and portal fibroblasts. Conceivably, bile duct epithelial cells interacting with peribiliary myofibroblasts cause scarring in biliary type liver fibrosis. Actually, in the widely used model of bile duct ligation to induce cholestatic liver injury in rats, inflammation does not seem to play a role in fibrogenesis. Although neutrophilic infiltration occurs to a certain degree, inflammation is not a prominent feature in this model (45). Likewise, in patients with cystic fibrosis–associated liver disease, inflammation is not a prominent finding. The main morphologic characteristics include accumulation of myofibroblasts colocalized with fibrosis around bile ducts, without significant inflammatory infiltrates (46). In this disease, there is an impairment of ⌬F508 cystic fibrosis transmembrane conductance regulator processing in bile-duct epithelial cells, which exhibit aberrant cytoplasmic immunolocalization of cystic fibrosis transmembrane conductance regulator. As mentioned, inflammatory infiltrates are rare, suggesting that immunoinflammatory mechanisms are unlikely to be involved in initiation of cystic fibrosis–associated liver disease (47).

Fibroblastic/Myofibroblastic Foci and Lung Remodeling

Anterior Subcapsular Cataract The lens consists of only two cell types, epithelial and fiber cells. The continued growth of the lens occurs through mitosis of lens epithelial cells and differentiation of these cells into elongated fiber cells (48). Earlier histopathologic studies demonstrated that hyperplasia of the lens epithelium is the first and most important feature contributing to opacification of the posterior capsule (49). Opacities correspond to subcapsular plaques containing aberrant cells and accumulations of extracellular matrix. Lenticular plaques that characterize anterior subcapsular cataracts and anterior polar cataracts are derived from the lens epithelium, and are primarily comprised of spindleshaped cells interspersed with accumulations of extracellu-

Alveolar epithelial cell injury/activation results in the formation of fibroblastic/myofibroblastic foci, which are a consistent finding in IPF/UIP. They are characterized by small interstitial subepithelial aggregates of spindle-shaped fibroblasts and myofibroblasts within myxoid stroma (3). There is a growing appreciation that fibroblastic/myofibroblastic foci, usually dispersed throughout the lung parenchyma, represent the active process of fibrogenesis, and in this context they are considered key players in the progressive and irreversible biopathological nature of IPF. Actually, the amount of fibroblast/myofibroblasts foci is judged the main histopathologic prognostic factor for mortality in patients with IPF (55, 56). The mechanisms by which these peculiar foci are molded in IPF/UIP are largely unknown but seem to be at least partially dependent on alveolar epithelial cell activation (2). Fibroblasts should acquire first a migratory phenotype, then a proliferative phenotype when the fibroblastic foci are probably formed, and finally a myofibroblast contractile profibrotic phenotype. Differences in proliferative capacity between fibroblasts and myofibroblasts may be related to telomerases, the biological clocks of replicative lifespan. This is consistent with the preferential expression of telomerase activity in fibroblasts relative to myofibroblasts (57). Myofibroblasts are ultrastructurally and metabolically distinctive mesenchymal cells identified as a crucial participant in various fibrotic disorders. Myofibroblasts may participate in remodeling and progressive destruction of the lung parenchyma through several mechanisms, including increased extracellular matrix synthesis and contractility of lung parenchyma (1, 58). These cells secrete gelatinases A and B (MMP-2 and MMP-9), which may disrupt the basement membranes contributing to dysfunctional re-epithelialization and enhancing fibroblast migration to the alveolar spaces (1, 40). In addition, they synthesize angiotensin peptides which induce epithelial cell apoptosis (15, 18). The final event in this until now uncontrollable sequence is the complete remodeling/destruction of the lung parenchyma, probably at the edges of the fibroblastic/myofibroblastic foci, with the formation of dense scarring and honeycombing.

S96


Does Lung Epithelial Cells Transdifferentiate in Fibroblasts? Several lines of research strongly suggest that in some forms of tissue fibrosis an epithelial–mesenchymal transition actively participate in the local formation of interstitial fibroblasts. This process has been particularly studied in renal fibrosis, where it has been hypothesized that when basement membrane is injured by MMPs or disrupted by alterations in assembly, epithelial cells synthesize a number of cytokines that initiate the transition to fibroblasts (59, 60). Thus, tubular epithelium plays a pivotal role in kidney scarring, not only because they are a source of fibrogenic growth factors, but because potentially contributes to increased numbers of fibroblasts by epithelial-mesenchymal transdifferentiation (60). According to these findings, epithelial cells that detach from their basement membrane may undergo apoptosis, enter into epithelial–mesenchymal transition, or reside and/or divide as fibroblasts (61). Whether this process takes place in the lung in IPF or in other forms of pulmonary fibrosis is largely unknown, but awaits urgent evaluation in vitro and in vivo. Interestingly, the so-called “reactive large and elongated alveolar epithelial cells” appear histologically similar to fibroblasts. References 1. Selman, M., T. E. King, and A. Pardo. 2001. Idiopathic pulmonary fibrosis: prevaling and evolving hypotheses about its pathogenesis and implications for therapy. Ann. Intern. Med. 134:136–151. 2. Pardo, A., and M. Selman. 2002. Molecular mechanisms of pulmonary fibrosis. Front. Biosci. 7:d1743–d1761. 3. Katzenstein, A. L., D. A. Zisman, L. A. Litzky, B. T. Nguyen, and R. M. Kotloff. 2002. Usual interstitial pneumonia: histologic study of biopsy and explant specimens. Am. J. Surg. Pathol. 26:1567–1577. 4. Non-neoplastic disorders of the lower respiratory tract. Travis, D. W. D., T. V. Colby, M. N. Koss, M. L. Rosado de Chritenson, N. L. Muller, and T. E. King editors. The American Registry of Pathology; Atlas of Nontumor Pathology, First Series, Fascicle 2, 2002. 5. Scott, J., I. Johnston, and J. Britton. 1990. What causes cryptogenic fibrosing alveolitis? A case-control study of environmental exposure to dust. BMJ 301:1015–1017. 6. Iwai, K., T. Mori, N. Yamada, M. Yamaguchi, and Y. Hosoda. 1994. Idiopathic pulmonary fibrosis. Epidemiologic approaches to occupational exposure. Am. J. Respir. Crit. Care Med. 150:670–675. 7. Hubbard, R., S. Lewis, K. Richards, I. Johnston, and J. Britton. 1996. Occupational exposure to metal or wood dust and aetiology of cryptogenic fibrosing alveolitis. Lancet 347:284–289. 8. Tobin, R. W., C. E. Pope, C. A. Pellegrini, M. J. Emond, J. Sillery, and G. Raghu. 1998. Increased prevalence of gastroesophageal reflux in patients with idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 158:1804– 1808. 9. Egan, J. J., A. A. Woodcock, and J. P. Stewart. 1997. Viruses and idiopathic pulmonary fibrosis. Eur. Respir. J. 10:1433–1437. 10. Egan, J. J., J. P. Stewart, P. S. Hasleton, J. R. Arrand, K. B. Carroll, and A. A. Woodcock. 1995. Epstein-Barr virus replication within pulmonary epithelial cells in cryptogenic fibrosing alveolitis. Thorax 50:1234–1239. 11. Kelly, B. G., S. S. Lok, P. S. Hasleton, J. J. Egan, and J. P. Stewart. 2002. A rearranged form of Epstein-Barr virus DNA is associated with idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 166:510–513. 12. Qunn, L., T. Takemura, S. Ikushima, T. Ando, T. Yanagawa, O. Akiyama, M. Oritsu, N. Tanaka, and T. Kuroki. 2002. Hyperplastic epithelial foci in honeycomb lesions in idiopathic pulmonary fibrosis. Virchows Arch. 441:271–278. 13. Honda, T., H. Ota, K. Arai, M. Hayama, K. Fujimoto, Y. Yamazaki, and M. Anuda. 2002. Three-dimensional analysis of alveolar structure in usual interstitial pneumonia. Virchows Arch. 441:47–52. 14. Kuwano, K., R. Kunitake, M. Kawasaki, Y. Nomoto, N. Hagimoto, Y. Nakanishi, and N. Hara. 1996. P21Waf1/Cip1/Sdi1 and p53 expression in association with DNA strand breaks in idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 154:477–483. 15. Uhal, B. D., I. Joshi, C. W. F. Hughes, C. Ramos, A. Pardo, and M. Selman. 1998. Alveolar epithelial cell death adjacent to underlying myofibroblasts in advanced fibrotic human lung. Am. J. Physiol. 275:L1192–L1199.

16. Barbas-Filho, J. V., M. A. Ferreira, A. Sesso, R. A. Kairalla, C. R. Carvalho, and V. L. Capelozzi. 2001. Evidence of type II pneumocyte apoptosis in the pathogenesis of idiopathic pulmonary fibrosis (IFP)/usual interstitial pneumonia (UIP). J. Clin. Pathol. 54:132–138. 17. Maeyama, T., K. Kuwano, M. Kawasaki, R. Kunitake, N. Hagimoto, T. Matsuba, M. Yoshimi, I. Inoshima, K. Yoshida, and N. Hara. 2001. Upregulation of Fas-signalling molecules in lung epithelial cells from patients with idiopathic pulmonary fibrosis. Eur. Respir. J. 17:180–189. 18. Wang, R., C. Ramos, I. Joshi, A. Zagariya, A. Pardo, M. Selman, and B. D. Uhal. 1999. Human lung myofibroblast-derived inducers of alveolar epithelial apoptosis identified as angiotensin peptides. Am. J. Physiol. 277:L1158– L1164. 19. Chilosi, M., V. Poletti, B. Murer, M. Lestani, A. Cancellieri, L. Montagna, P. Piccoli, G. Cangi, G. Semenzato, and C. Doglioni. 2002. Abnormal reepithelialization and lung remodeling in idiopathic pulmonary fibrosis: the role of deltaN-p63. Lab. Invest. 82:1335–1345. 20. Sheppard, D. 2001. Pulmonary fibrosis: a cellular overreaction or a failure of communication? J. Clin. Invest. 107:1501–1502. 21. Adamson, I. Y. R, L. Young, and D. H. Bowden. 1988. Relationship of alveolar epithelial injury and repair to the induction of pulmonary fibrosis. Am. J. Pathol. 130:377–383. 22. Dai, J., B. Gilks, K. Price, and A. Churg. 1998. Mineral dusts directly induce epithelial and interstitial fibrogenic mediators and matrix components in the airway wall. Am. J. Respir. Crit. Care Med. 158:1907–1913. 23. Morishima, Y., A. Nomura, Y. Uchida, Y. Noguchi, T. Sakamoto, Y. Ishii, Y. Goto, K. Masuyama, M. J. Zhang, K. Hirano, M. Mochizuki, M. Ohtsuka, and K. Sekizawa. 2001. Triggering the induction of myofibroblast and fibrogenesis by airway epithelial shedding. Am. J. Respir. Cell Mol. Biol. 24:1–11. 24. Antoniades, H. N., M. A. Bravo, R. E. Avila, T. Galanopoulus, J. Neville, and M. Selman. 1990. Platelet-derived growth factor in idiopathic pulmonary fibrosis. J. Clin. Invest. 86:1055–1064. 25. Kapanci, Y., A. Desmouliere, J. C. Pache, M. Redard, and G. Gabbiani. 1995. Cytoskeletal protein modulation in pulmonary alveolar myofibroblasts during idiopathic pulmonary fibrosis: possible role of transforming growth factor ␤ and tumor necrosis factor ␣. Am. J. Respir. Crit. Care Med. 152:2163–2169. 26. Nash, J. R., P. J. McLaughlin, D. Butcher, and B. Corrin. 1993. Expression of tumour necrosis factor-alpha in cryptogenic fibrosing alveolitis. Histopathology 22:343–347. 27. Khalil, N., R. N. O’Connor, H. W. Unruh, P. W. Warren, K. C. Flanders, A. Kemp, O. H. Bereznay, and A. H. Greenberg. 1991. Increased production and immunohistochemical localization of transforming growth factor-␤ in idiopathic pulmonary fibrosis. Am. J. Respir. Cell Mol. Biol. 5:155–162. 28. Khalil, N., R. N. O’Connor, K. C. Flanders, and H. Unruh. 1996. TGF-␤1, but not TGF-␤2 or TGF-␤3, is differentially present in epithelial cells of advanced pulmonary fibrosis: an immunohistochemical study. Am. J. Respir. Cell Mol. Biol. 14:131–138. 29. Giaid, A., R. P. Michel, D. J. Stewart, M. Sheppard, B. Corrin, and Q. Hamid. 1993. Expression of endothelin-1 in lung of patients with cryptogenic fibrosing alveolitis. Lancet 341:1550–1554. 30. Pan, L. H., K. Yamauchi, M. Uzuki, T. Nakanishi, M. Takigawa, H. Inoue, and T. Sawai. 2001. Type II alveolar epithelial cells and interstitial fibroblasts express connective tissue growth factor in IPF. Eur. Respir. J. 17: 1220–1227. 31. Young, L., and I. Y. R. Adamson. 1993. Epithelial-fibroblast interactions in bleomycin-induced lung injury and repair. Environ. Health Perspect. 101:56–61. 32. Kotani, I., A. Sato, H. Hayakawa, T. Urano, Y. Takada, and A. Takada. 1995. Increased procoagulant and antifibrinolytic activities in the lungs with idiopathic pulmonary fibrosis. Thromb. Res. 77:493–504. 33. Imokawa, S., A. Sato, H. Hayakawa, M. Kotani, T. Urano, and A. Takada. 1997. Tissue factor expression and fibrin deposition in the lungs of patients with idiopathic pulmonary fibrosis and systemic sclerosis. Am. J. Respir. Crit. Care Med. 156:631–636. 34. Fujii, M., H. Hayakawa, T. Urano, A. Sato, K. Chida, H. Nakamura, and A. Takada. 2000. Relevance of tissue factor and tissue factor pathway inhibitor for hypercoagulable state in the lungs of patients with idiopathic pulmonary fibrosis. Thromb. Res. 99:111–117. 35. Murphy, G., H. Stanton, S. Cowell, G. Butler, V. Knauper, S. Atkinson, and J. Gavrilovic. 1999. Mechanisms for pro matrix metalloproteinase activation. APMIS 107:38–44. 36. Legrand, C., M. Polette, J. M. Tournier, S. De Bentzmann, E. Huet, C. Monteau, and P. Birembaut. 2001. uPa/plasmin system-mediated MMP-9 activation is implicated in bronchial epithelial cell migration. Exp. Cell Res. 264:326–336. 37. Howell, D. C., G. J. Laurent, and R. C. Chambers. 2002. Role of thrombin and its major cellular receptor, protease-activated receptor-1, in pulmonary fibrosis. Biochem. Soc. Trans. 30:211–216. 38. Bogatkevich, G. S., E. Tourkina, R. M. Silver, and A. Ludwicka-Bradley. 2001. Thrombin differentiates normal lung fibroblasts to a myofibroblast


39.

40.

41. 42. 43. 44. 45. 46. 47.

48. 49. 50. 51.

phenotype via the proteolytically activated receptor-1 and a protein kinase C-dependent pathway. J. Biol. Chem. 276:45184–45192. Zuo, F., N. Kaminski, E. Eugui, J. Allard, Z. Yakhini, A. Ben-Dor, L. Lollini, D. Morris, Y. Kim, B. DeLustro, D. Sheppard, A. Pardo, M. Selman, and R. A. Heller. 2002. Gene expression analysis reveals matrilysin as a key regulator of pulmonary fibrosis in mice and humans. Proc. Natl. Acad. Sci. USA 99:6292–6297. Selman, M., V. Ruiz, S. Cabrera, L. Segura, R. Ramı´rez, R. Barrios, and A. Pardo. 2000. TIMP-1, -2, -3 and -4 in idiopathic pulmonary fibrosis. A prevailing nondegradative lung microenvironment? Am. J. Physiol. 279: L562–L574. Winkler, M. K., and J. L. Fowlkes. 2002. Metalloproteinase and growth factor interactions: do they play a role in pulmonary fibrosis? Am. J. Physiol. 283:L1–11. Cameron, J. S. 1996. The enigma of focal segmental glomerulosclerosis. Kidney Int.S119–S131. Schwartz, M. M., J. Evans, R. Bain, and S. M. Korbet. 1999. Focal segmental glomerulosclerosis: prognostic implications of the cellular lesion. J. Am. Soc. Nephrol. 10:1900–1907. Korbet, S. M., M. M. Schwartz, and E. J. Lewis. 1988. Recurrent nephrotic syndrome in renal allografts. Am. J. Kidney Dis. 11:270–276. Kinnman, N., and C. Housset. 2002. Peribiliary myofibroblasts in biliary type liver fibrosis. Front. Biosci. 7:d496–d503. Lindblad, A., R. Hultcrantz, and B. Strandvik. 1992. Bile-duct destruction and collagen deposition: a prominent ultrastructural feature of the liver in cystic fibrosis. Hepatology 16:372–381. Kinnman, N., A. Lindblad, C. Housset, E. Buentke, A. Scheynius, B. Strandvik, and R. Hultcrantz. 2000. Expression of cystic fibrosis transmembrane conductance regulator in liver tissue from patients with cystic fibrosis. Hepatology 32:334–340. Chamberlain, C. G., and J. W. McAvoy. 1997. Fiber differentiation and polarity in the mammalian lens: a key role for FGF. Prog. Retin. Eye Res. 16:443–478. Green, W. R., and P. J. McDonnell. 1985. Opacification of the posterior capsule. Trans. Ophthalmol. Soc. U. K. 104:727–739. Hatae, T., T. Ishibashi, F. Yoshitomi, and Y. Shibata. 1993. Immunocytochemistry of types I–IV collagen in human anterior subcapsular cataracts. Graefes Arch. Clin. Exp. Ophthalmol. 231:586–590. Novotny, G. E., H. Pau, and G. Arnold. 1989. Organization of collagen

S97

52. 53.

54.

55.

56.

57. 58.

59.

60.

61.

and other extracellular material in anterior capsular cataract. Anat. Anz. 168:127–133. Srinivasan, Y., F. J. Lovicu, and P. A. Overbeek. 1998. Lens-specific expression of transforming growth factor 1 in transgenic mice causes anterior subcapsular cataracts. J. Clin. Invest. 101:625–634. Lee, E. H., Y. Seomun, K. H. Hwang, J. E. Kim, I. S. Kim, J. H. Kim, and C. K. Joo. 2000. Overexpression of the transforming growth factor␤–inducible gene ␤ig-h3 in anterior polar cataracts. Invest. Ophthalmol. Vis. Sci. 41:1840–1845. Lovicu, F. J., M. W. Schulz, A. M. Hales, L. N. Vincent, P. A. Overbeek, C. G. Chamberlain, and J. W. McAvoy. 2002. TGFbeta induces morphological and molecular changes similar to human anterior subcapsular cataract. Br. J. Ophthalmol. 86:220–226. King, T. E., Jr., M. I. Schwarz, K. Brown, J. A. Tooze, T. V. Colby, J. A. Waldron, A. Flint, W. Thurlbeck, and R. M. Cherniack. 2001. Idiopathic pulmonary fibrosis: relationship between histopathologic features and mortality. Am. J. Respir. Crit. Care Med. 164:1025–1032. Nicholson, A. G., L. G. Fulford, T. V. Colby, R. M. du Bois, D. M. Hansell, and A. U. Wells. 2002. The relationship between individual histologic features and disease progression in idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 166:173–177. Nozaki, Y., T. Liu, K. Hatano, M. Gharaee-Kermani, and S. H. Phan. 2000. Induction of telomerase activity in fibroblasts from bleomycin-injured lungs. Am. J. Respir. Cell Mol. Biol. 23:460–465. Zhang, K., M. D. Rekhter, D. Gordon, and S. H. Phan. 1994. Myofibroblasts and their role in lung collagen gene expression during pulmonary fibrosis: a combined immunohistochemical and in situ hybridization study. Am. J. Pathol. 145:114–125. Zeisberg, M., G. Bonner, Y. Maeshima, P. Colorado, G. A. Mu¨ller, F. Strutz, and R. Kalluri. 2001. Renal fibrosis: collagen composition and assembly regulates epithelial-mesenchymal transdifferentiation. Am. J. Pathol. 159: 1313–1321. Ng, Y. Y., T. P. Huang, W. C. Yang, Z. P. Chen, A. H. Yang, W. Mu, D. J. Nikolic-Paterson, R. C. Atkins, and H. Y. Lan. 1998. Tubular epithelialmyofibroblast transdifferentiation in progressive tubulointerstitial fibrosis in 5/6 nephrectomized rats. Kidney Int. 54:864–876. Iwano, M., D. Plieth, T. M. Danoff, C. Xue, H. Okada, and E. G. Neilson. 2002. Evidence that fibroblasts derive from epithelium during tissue fibrosis. J. Clin. Invest. 110:341–350.

S98


Molecular Targets for Drug Discovery in Idiopathic Pulmonary Fibrosis Work in Progress Idiopathic Pulmonary Fibrosis: Scope of the Problem Idiopathic pulmonary fibrosis (IPF) is a deadly disease, with an estimated incidence of 7–11 cases per 100,000 and an estimated prevalence of 27–29 per 100,000 (1). Currently, the only effective therapeutic option is lung transplantation. Characteristically, fibrotic lesions are found scattered throughout the lung parenchyma at different stages of progression. Some alveolar units are inflamed, others manifest epithelial denudation with fibroblastic foci, and still others are scarred shut with a mature collagenous matrix (2). For reasons that remain to be elucidated, fibrosis begins at the lung bases and periphery, working its way toward the apices and hilum. Attempts to treat inflammation with the goal of interdicting fibrosis have been disappointing. IPF evolves as if it resulted from a cryptic alveolar injury, although direct evidence to support injury as the first step in the process has not been forthcoming. Detailed morphologic studies point to the subepithelial fibroblastic focus as the sentinel morphologic lesion, in a pathologic pattern that is designated usual interstitial pneumonitis (UIP) (Figure 1) (1, 2). In diseased alveolar units, subepithelial fibroblastic foci expand with proliferating myofibroblasts, which persist and deposit their connective tissue products in the alveolar wall. This distorts alveolar architecture and compromises gas exchange. We therefore suggest that therapeutic discovery efforts be directed toward this aberrant, relentless fibroproliferative response. In this section, we present one strategy to explore and exploit molecular targets for drug discovery that regulate apoptosis, with the goal of therapeutically triggering myofibroblast apoptosis in evolving fibroblastic foci. A decade of detailed basic biomedical research directed at elucidating molecular mechanisms governing fibroblast apoptosis has led to the identification of key regulatory molecules that are candidate therapeutic targets for antifibrotic therapy. Here we discuss translational control of apoptosis governed by the ability of an aberrantly activated cap-dependent translation initiation apparatus to selectively recruit transcripts encoding antiapoptotic proteins to ribosomes.

The Cap-Dependent Initiation Apparatus as a Molecular Target for Antifibrotic Drug Discovery Apoptosis is a highly ordered biological process employed by plants and animals to eliminate cells that have completed their function in the life cycle of the organism or have been irreparably damaged. Much of the apoptotic machinery is conserved from worms to primates and among all cells in the body (3). As a result, developing compounds with cell specificity is a major challenge. Based on this, we suggest that a successful molecular targets program to develop antifibrotic compounds hinges on identifying apoptotic regulatory steps

This section was written by Peter B. Bitterman (Department of Medicine, University of Minnesota Medical School, Minneapolis, Minnesota).

that are dysregulated in myofibroblasts from fibrotic lesions, due to intrinsic changes in the IPF myofibroblast and/or pathologic extrinsic signals. In this regard, here we will review the case for developing inhibitors of the cap-dependent translation initiation apparatus (Figure 2A). Initiation, the rate-limiting step of translation, generally occurs in a cap-dependent manner mediated by a trimolecular complex designated eIF4F, consisting of eIF4G (which serves as a large docking protein), eIF4E (which binds the mRNA cap), and eIF4A (an RNA helicase) (Figure 2A). The mRNA– eIF4F complex associates with the 40S ribosomal subunit via adapter protein eIF3 to initiate peptide synthesis. The 4E-BPs are a family of translational repressor proteins that function as competitive inhibitors of eIF4G. The 4E-BPs and eIF4G share an eIF4E-binding motif and compete for binding to eIF4E (Figure 2B). Before our studies of apoptosis regulation, transcriptional and post-translational control mechanisms took center stage (4). We discovered that apoptosis is also subject to translational control, governed by the activity of the mRNA cap binding component of the protein synthesis machinery (5). Our studies showed that pathologic activation of eIF4E function allows fibroblasts to escape from apoptosis (5, 6), and is a common property of cells that are naturally resistant to apoptosis such as cancer cells (8)— and, as our preliminary studies suggest, of lung fibroblasts from patients with IPF. These results led us to design experiments testing whether repression of pathologic translational activation might be a viable antifibrotic strategy. We achieved inhibition of aberrant translation by transferring the gene encoding wild-type human 4E-BP1, and used fibroblasts with activated eIF4E function, deregulated growth control, and resistance to apoptosis by virtue of harboring constitutively active Ras. The results were striking: not only did we trigger apoptosis in vitro and in vivo when aberrant translation was normalized, but we also learned that fibroblasts under normal growth control with physiologically regulated eIF4E remain healthy (9). This large differential in apoptotic susceptibility between normal cells and cells with deregulated growth control suggested that translational repression could be an effective antifibrotic therapeutic strategy; but could translational repression ever be considered as therapy for patients? The answer would be a clear “no” if we were proposing to poison IPF fibroblasts by suppressing translation to the point that critical macromolecules were no longer synthesized, because all cells in the body would be killed by this approach. To the contrary, our published studies indicate that specifically reducing the activity of eIF4E from the aberrantly high levels seen in cancer cells and IPF fibroblasts to physiologic levels is what is needed to trigger apoptosis in vitro and in vivo. In fact, non-specifically inhibiting protein synthesis to a similar degree with cycloheximide actually protects cells from apoptosis. Thus the strategy we are pursuing, the de-


Figure 1. Fibroblastic foci (*) in UIP are characterized by proliferating fibroblasts with active collagen deposition. These foci indicate active and ongoing fibrosis (H&E ⫻50).

S99

administered in concert with ectopically expressed 4E-BP1 (9), indicating that the endogenous levels of the 4E-BP family proteins are insufficient to trigger apoptosis. An alternative approach is to focus therapy on directly downregulating the activity of eIF4F, either by interrupting association of the eIF4F complex proteins with one another, or by antagonizing the interaction between eIF4E and the 7-methyl-guanosine mRNA cap. Currently, the technology to develop small molecules interrupting intracellular protein–protein interactions is incompletely developed. Therefore, our initial drug discovery efforts are focused on the cap-binding pocket of eIF4E, a molecular target of known crystal structure. We are actively pursuing the synthesis of compounds targeting the cap-binding pocket of eIF4E.

Combining Polyribosome Analysis with Gene Expression Microarray to Discover New, IPF-Specific Antifibrotic Targets velopment of compounds allowing us to titrate the activity of eIF4E in vivo, is predicted to selectively trigger apoptosis only in cells with pathologic upregulation of eIF4E activity. There are several approaches to achieving translational repression in fibroblasts. The simplest is to use existing pharmaceuticals. We first examined HMG-CoA reductase inhibitors, which indirectly decrease eIF4E activity by decreasing Ras farnesylation. Although active in vitro and in vivo, the proapoptotic effect was only observed at unacceptably high concentrations (11). We next explored rapamycin, a drug recently introduced as an immunosuppressive agent to prevent allograft rejection after solid organ transplantation. Rapamycin selectively represses cap-dependent translation by blocking the activity of FRAP/mTOR kinase, a critical step in the phosphorylation (i.e., inactivation) of the 4E-BP family of translational repressors (12). However, rapamycin was unable to trigger fibroblast apoptosis unless

The power of contemporary genomic and proteomic difference analyses to discover disease-specific biosignatures has already been realized in a number of studies of human disease, including lymphoma (13) and ovarian cancer (14). However, application of these techniques to search for and exploit disease-specific molecular therapeutic targets is just beginning. Major challenges that emerge in many gene expression microarray analyses include the large number of genes (often several hundred) that are differentially expressed in diseased cells or tissues compared with normal, and preservation of physiologic context. We are currently pursuing a strategy—to discover molecular therapeutic targets—that leverages our knowledge about translational control of apoptosis to identify some of the key gene products in disease pathogenesis. By combining polyribosome preparations with conventional gene expression microarray analysis (8), we can identify transcripts that are translationally

Figure 2. Assembly of the cap-binding complex (17). (A ) In mammals, cap-dependent initiation involves assembly of a trimolecular cap-binding complex, designated eIF4F, which consists of eIF4E, eIF4G, and eIF4A. eIF4G subserves a docking function, with the amino terminal half binding to the 7-methyl guanosine cap-binding protein eIF4E, and the C-terminal half binding to eIF4A. Also shown is the locus of action of the antifibrotic compounds we propose to develop. (B ) Translational repressor 4E-BP1 shares an eIF4E-binding motif with eIF4G, allowing it to compete for eIF4E binding. The 4E-BPs are regulated by phosphorylation. When hypophosphorylated, 4E-BPs repress cap-dependent translation by sequestering eIF4E in a translationally inactive complex. Upon hyperphosphorylation in response to integrin ligation or growth factors, 4E-BPs dissociate from the complex with eIF4E, which can form an active translation initiation complex.

S100


scripts encoding proapoptotic proteins that are translationally silenced in both types of fibroblasts during the stress of collagen gel contraction. This will point us toward targets mediating the interaction of fibroblasts with a pathologic ECM. If the dominant influence is the fibroblast source, then we will identify transcripts encoding antiapoptotic proteins that are translationally activated only in IPF fibroblasts during the proapoptotic stress of collagen gel contraction. We theorize that among these sets of transcripts will be those encoding both known and novel apoptotic regulators responsible for pathologic myofibroblast persistence in IPF—and thus potential antifibrotic molecular targets.

The Challenge of Developing Antifibrotic Pharmaceuticals: A Comprehensive Approach

Figure 3. Combined polyribosome-microarray based molecular targets discovery strategy.

regulated when lung fibroblasts derived from patients with IPF are subjected to the proapoptotic stress of collagen gel contraction, thus simulating the microenvironment of the fibroblastic focus. To achieve our objective of identifying mRNAs encoding apoptotic regulatory proteins subject to translational control, we propose to compare the mRNA in IPF fibroblasts with normal fibroblasts (HLF) in two dimensions: (i ) translation rate (polyribosome preparations), and (ii) time after subjecting cells to the proapoptotic stress of collagen gel contraction (Figure 3). Our goal is to identify the critical antiapoptotic proteins that account for the pathologic persistence of IPF fibroblasts in progressive fibrotic lesions. We are currently carrying out an analysis of biological differences between normal and IPF fibroblasts during collagen gel contraction, in search of molecules that may antagonize apoptosis. Currently it is unknown whether abnormal persistence of myofibroblasts in the IPF lung is due to a durable alteration in their differentiated state making them resistant to apoptosis, or whether extrinsic signals mediated by the ECM or cytokines in the alveolar microenvironment dampen proapoptotic cues, or both. To address this gap in knowledge, we have chosen to simulate the fibrotic microenvironment by examining fibroblasts embedded in type 1 collagen gels. Henke and coworkers have previously shown (16) that fibroblasts cultured in low-concentration contractile collagen gels undergo apoptosis (as a model of normal repair), whereas those in high-concentration minimally contractile gels are resistant to apoptosis (as a model of the IPF lung). Using this system, we can identify those transcripts that are translationally activated or silenced during the proapototic stress of collagen gel contraction in IPF fibroblasts and normal fibroblasts. If the dominant influence is the collagen-rich microenvironment, then important differences between normal and IPF fibroblasts will not emerge, and we will identify tran-

Developing authentic antifibrotic therapeutics is a daunting challenge, and we strongly suspect that no single approach and no one molecular target will be sufficient. We suspect successful efforts will integrate and leverage the skills of an interdisciplinary team of investigators including medicinal chemists and pharmaceutical scientists; cell and matrix biologists; experts in genomics and bioinformatics; and investigators with significant expertise in the biology of IPF. It is our expectation that a comprehensive approach will have the best chance of providing a new therapeutic direction for a lethal disease with few therapeutic options. References 1. American Thoracic Society and European Respiratory Society. 2002. American Thoracic Society/European Respiratory Society international multidisciplinary consensus classification of the idiopathic interstitial pneumonias. Am. J. Respir. Crit. Care Med. 165:277–304. 2. Katzenstein, A. L., and J. L. Myers. 1998. Idiopathic pulmonary fibrosis: clinical relevance of pathologic classification. Am. J. Respir. Crit. Care Med. 157:1301–1315. 3. Zhivotovsky, B. 2002. From the nematode and mammals back to the pine tree: on the diversity and evolution of programmed cell death. Cell Death Differ. 9:867–869. 4. Datta, S. R., H. Dudek, X. Tao, S. Masters, H. Fu, Y. Gotoh, and M. E. Greenberg. 1997. Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell 91:231–241. 5. Polunovsky, V. A., I. B. Rosenwald, A. T. Tan, J. White, L. Chiang, N. Sonenberg, and P. B. Bitterman. 1996. Translational control of programmed cell death: eukaryotic translation initiation factor 4E blocks apoptosis in growth-factor-restricted fibroblasts with physiologically expressed or deregulated Myc. Mol. Cell Biol. 16:6573–6581. 6. Tan, A., P. Bitterman, N. Sonenberg, M. Peterson, and V. Polunovsky. 2000. Inhibition of Myc-dependent apoptosis by eukaryotic translation initiation factor 4E requires cyclin D1. Oncogene 19:1437–1447. 7. Hahn, W. C., and R. A. Weinberg. 2002. Modeling the molecular circuitry of cancer. Nat. Rev. Cancer 2:331–341. 8. Hanahan, D., and R. A. Weinberg. 2000. The hallmarks of cancer. Cell 100:57–70. 9. Li, S., N. Sonenberg, A. C. Gingras, M. Peterson, S. Avdulov, V. A. Polunovsky, and P. B. Bitterman. 2002. Translational control of cell fate: availability of phosphorylation sites on translational repressor 4E–BP1 governs its proapoptotic potency. Mol. Cell. Biol. 22:2853–2861. 10. Polunovsky, V. A., A. C. Gingras, N. Sonenberg, M. Peterson, A. Tan, J. B. Rubins, J. C. Manivel, and P. B. Bitterman. 2000. Translational control of the antiapoptotic function of Ras. J. Biol. Chem. 275:24776–24780. 11. Tan, A., H. Levrey, C. Dahm, V. A. Polunovsky, J. Rubins, and P. B. Bitterman. 1999. Lovastatin induces fibroblast apoptosis in vitro and in vivo. A possible therapy for fibroproliferative disorders. Am. J. Respir. Crit. Care Med. 159:220–227. 12. Gingras, A. C., B. Raught, and N. Sonenberg. 2001. Regulation of translation initiation by FRAP/mTOR. Genes Dev. 15:807–826. 13. Alizadeh, A. A., M. B. Eisen, R. E. Davis, C. Ma, I. S. Lossos, A. Rosenwald, J. C. Boldrick, H. Sabet, T. Tran, X. Yu, J. I. Powell, L. Yang, G. E. Marti, T. Moore, J. Hudson, Jr., L. Lu, D. B. Lewis, R. Tibshirani, G.


Sherlock, W. C. Chan, T. C. Greiner, D. D. Weisenburger, J. O. Armitage, R. Warnke, L. M. Staudt, et al. 2000. Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling. Nature 403:503–511. 14. Ono, K., T. Tanaka, T. Tsunoda, O. Kitahara, C. Kihara, A. Okamoto, K. Ochiai, T. Takagi, and Y. Nakamura. 2000. Identification by cDNA microarray of genes involved in ovarian carcinogenesis. Cancer Res. 60: 5007–5011. 15. Johannes, G., M. S. Carter, M. B. Eisen, P. O. Brown, and P. Sarnow. 1999. Identification of eukaryotic mRNAs that are translated at reduced cap

S101

binding complex eIF4F concentrations using a cDNA microarray. Proc. Natl. Acad. Sci. USA 96:13118–13123. 16. Tian, B., K. Lessan, J. Kahm, J. Kleidon, and C. Henke. 2002. beta 1 integrin regulates fibroblast viability during collagen matrix contraction through a phosphatidylinositol 3-kinase/Akt/protein kinase B signaling pathway. J. Biol. Chem. 277:24667–24675. 17. Gingras, A. C., S. P. Gygi, B. Raught, R. D. Polakiewicz, R. T. Abraham, M. F. Hoekstra, R. Aebersold, and N. Sonenberg. 1999. Regulation of 4E-BP1 phosphorylation: a novel two-step mechanism. Genes Dev. 13: 1422–1437.

S102


Pittsburgh International Lung Conference at Nemacolin Summary I would like to thank Dr. Augustine Choi for organizing an outstanding meeting, and for inviting me as the Conference Summarizer. The presentations and discussions of the pathologic classifications of idiopathic interstitial pneumonitis (IIP) and mechanisms of pulmonary fibrosis at this conference were outstanding. In this summary, if I fail to mention each individuals’ specific work, I hope that these individuals will recognize the limitation of providing an all-inclusive summary of the conference, and forgive me for not adequately acknowledging them. Moreover, it should be mentioned that my summary will reflect my interpretation of the state of idiopathic pulmonary fibrosis (IPF), and may not necessarily represent the views of the other speakers. The focus of this conference was related to IPF. The conference represented a diverse group of presentations. The talks could be generally categorized into topics related to pathologic classification of IIP; treatment and care of patients with IPF; and molecular, cellular, animal models, and human studies to address mechanisms that may contribute to chronic inflammation and fibrosis associated with IPF. The first day of the conference, Drs. Hunninghake, Yousem, and Strollo focused on imaging and pathologic classification of IIP. These presentations were related to the American Thoracic Society/European Respiratory Society International multidisciplinary consensus classification of IIP (1, 2). Moreover, the discussion on high-resolution CT highlighted the importance of this diagnostic technique, and the ability of this strategy to potentially reduce the need for subsequent lung biopsy to provide the diagnosis of IIP. The talks by Drs. Hansen-Flaschen and Dauber focused on the prognosis and care of the patients with IPF. These presentations discussed the predictive studies for prognosis, care, and end-of-life care issues of patients with IPF. The second day of the conference, Drs. Strieter, Noble, Kunkel, Ray, Loyd, and Kaminski focused on the following: CXC chemokines in the regulation of pulmonary vascular remodeling and fibrosis; type 1 and 2 cytokine imbalances that promote pulmonary fibrosis; inducible gene expression of keratinocyte growth factor and protection of the epithelium; familial pulmonary fibrosis with discussion about the recent identification of the relationship of the genetics of surfactant protein C mutation and familial interstitial lung disease; and the use of microarray analysis of gene expression in IIP. The third and fourth days of the conference, Drs. Hunninghake, Bitterman, Mossman, Henson, Feghali-Bostwick, Ortiz, Oury, Gibson, Phan, Schwarz, Selman, and Morse discussed the following: signal transduction pathways relevant in the activation and promotion of proliferation related to epithelial cells and fibroblasts; strategies to enhance fi-

This section was written by Robert M. Strieter (Departments of Medicine and Pathology, Division of Pulmonary and Critical Care Medicine, David Geffen School of Medicine at the University of California, Los Angeles, Los Angeles, California).

broblast apoptosis and the importance of apoptosis and efferocytosis (i.e., removal of apoptotic cells) in the modulation of inflammation and subsequent remodeling of tissue relevant to pulmonary fibrosis; the role of insulin-like growth factor and insulin-like growth factor–binding protein in regulating fibrosis; use of stem cell biology in re-population of the lung for re-establishment of normal lung architecture; regulation of extracellular superoxide dismutase in interstitial lung disease; use of laser capture microscopy for purposes of microarray and proteomic analysis of specific genes and gene products in regions of temporal heterogeneity of IPF; the role of polyclonal myofibroblasts and their importance in promoting fibrosis and their predominance in the fibroblastic foci of usual interstitial pneumonitis (UIP) lesions of IPF; the epithelial cell injury and fibrosis paradigm of IPF; and the role of heme oxygenase-1 in pulmonary fibrosis. These presentations confirmed the following: (i) there are outstanding investigations in the field of pulmonary fibrosis leading to new potential paradigms relevant to IPF; (ii) although these studies have furthered our understanding of the mechanisms related to pulmonary fibrosis, it is clear that we need additional molecular, genetic, cellular, animal models, and human scientific research to improve our knowledge of this complex process; (iii) the most important “missing link” between basic science and clinical research is the lack of information that pertains to the complete natural history of the pathogenesis of IPF. We are left with only descriptive “snap-shots” of the histopathology of each of the IIPs. The more thorough understanding of the natural history of these IIPs will allow investigation of potentially different mechanisms and therapeutic intervention(s) that may be operative at different stages of the disease process; and (iv) based on the devastating prognosis, the lack of understanding of the natural history of the pathogenesis of IPF, and the relative lack of response to current medications for the treatment of IPF, we need additional funding from the NIH and the pharmaceutical industry to support basic and clinical research to facilitate and perpetuate our knowledge about pulmonary fibrosis. Although the former can be achieved through a mechanism of investigator-initiated basic science research, the latter should be achieved through an organizational scheme that would include investigatorinitiated clinical research through a multicenter approach to expedite translational research to the patient. What do we know about the natural history or pathogenesis of IPF? We have classified UIP as the histopathologic hallmark of IPF. UIP consists of temporal heterogeneity with areas of normal lung tissue, “new active fibrosis,” and “old fibrosis” (1–3). Although this is the pathology seen in IPF, it has also been reported in chronic asbestosis, chronic hypersensitivity pneumonitis, and various collagen vascular disorders with associated interstitial lung disease (4, 5). The finding of UIP-like histopathology at the end-stage of the latter disorders suggests that UIP may be the end-stage process of a variety of pathologic processes rather than the


TABLE 1

Multiple hypotheses fit A. Hypothesis I: Chronic inflammation is an important component and contributing event to the pathogenesis of pulmonary fibrosis. B. Hypothesis II: Pulmonary fibrosis results from epithelial injury and abnormal wound repair in the absence of preceding inflammation. C. Hypothesis III: Inflammation is subsequent to “injury,” and with “persistent antigen/recurrent hits” results in type 2/3 polarization with failure of re-epithelialization and promotion of pulmonary fibrosis.

initial manifestation of a specific disease. Therefore, we are missing the characteristics of the early and intermediate pathologic phases that are necessary for the full pathologic development of UIP. Does the ultrastructural nature of the pathology of UIP provide insight into the potential pathogenesis of IPF? Lessons from the past have provided significant knowledge about this process. A number of studies have shown that the ultrastructural analysis of the lung tissue from patients with IPF demonstrates the following features: (i ) endothelial cell and type I pneumocyte injury with damage of the alveolar–capillary basement membrane; (ii) intra-alveolar exudative organization with fibrosis with associated fibroblast/myofibroblast migration through defects in the alveolar wall, formation of intraluminal “buds” that progress to obliteration of the alveoli, and fusion of adjacent alveolar structures; and (iii) development of fibroblastic foci that represent exudative organization and fibrosis within the alveolar airspace/interstitium, which are composed of parallel arranged fibroblasts/myofibroblasts enmeshed in extracellular matrix (6–9). However, it remains to be elucidated whether the fibroblastic foci of UIP is the pathologic source of all subsequent pulmonary fibrosis (i.e., “new and old”), or that the histopathologic feature of fibroblastic foci represents nothing more than the “loss of alveoli” with a fibrotic organizational response, as described above by the ultrastructural studies (6–9). A previous prevailing hypothesis (Table 1, A) for the pathogenesis of UIP was that chronic inflammation is an important component and contributing event to the pathogenesis of pulmonary fibrosis. This postulate was based on the notion that inflammation/injury to the alveolar–capillary wall/basement membrane, leads to a loss of type I epithelial and endothelial cells, proliferation of type II cells, loss of alveolar integrity, recruitment and proliferation of stromal cells, and deposition of extracellular matrix (ECM) and endstage fibrosis (10–12). However, the initial inflammation/ injury, or the mechanisms responsible for the perpetuation of chronic inflammation and ECM deposition, are not known. Continual exposure to environmental “antigens,” microbes, or systemic events may promote exaggerated inflammation/ injury with loss of alveolar–capillary wall/basement membrane integrity and failure of normal re-epithelialization and re-endothelialization leading to dysregulated repair (i.e., fibroblast proliferation and ECM deposition within alveoli and interstitium) and end-stage fibrosis (10–12). A challenge has been made to the hypothesis that chronic

S103

inflammation is important in promoting or contributing to the pathogenesis of pulmonary fibrosis. In fact, it has been postulated that chronic inflammation plays little or no role in the pathogenesis of UIP (13–15). This concept has led a movement to embrace an alternative hypothesis (Table 1, B): pulmonary fibrosis results from epithelial injury and abnormal wound repair in the absence of preceding inflammation (15). The basis for this hypothesis is due to the following: a “snap-shot” view of the histopathology of UIP; superphysiologic and tonic expression of cytokines in animal models; and poor response to conventional anti-inflammatory therapy (15–18). However, the hypothesis fails to take into account mechanism(s) that initiate injury and perpetuate subsequent dysregulated repair. Although there has been no previous published study that has performed temporal biopsies from patients with IIP to determine the natural history of the pathogenesis of these disorders, a recent prospective study has provided insight into this process (19). Flaherty and associates found significant histopathologic variability in surgical lung biopsies from patients with IIP (19). Forty seven percent of the patients with IIP exhibited the histopathology of UIP in all lobes (mean age, 63.3 yr). Interestingly, UIP was found to coexist in 26% of patients with nonspecific interstitial pneumonia (NSIP) (mean age, 57 yr) (19). In the remaining 28%, NSIP was found alone (mean age, 53.1 yr) (19). Moreover, 10% had two or more biopsies obtained from one lobe; 73% of these lobes had coexisting NSIP with UIP (19). These findings demonstrate interlobar and intralobar variability of IIP, and the coexistence of chronic inflammation with fibrosis. Does this mean that we have different “disease” processes within the same patient, or does this support the contention that UIP may represent the endstage of a continuum of the natural history of untreated non-specific interstitial pneumonitis (NSIP) → UIP? The differences in mean age of these patients may reflect that the natural history of UIP may represent the pathogenesis of untreated NSIP and the transformation to UIP that takes place over a decade in time. Furthermore, this supports the notion that chronic inflammation may be a significant initiating event in the pathogenesis of UIP. Although there is no animal model system that recapitulates the pathogenesis of UIP, the majority of animal models of pulmonary fibrosis start with acute inflammation that progresses to chronic inflammation and fibrosis (20, 21). There are exceptions to the association of inflammation and fibrosis. For example, there are animal models in which the profibrotic cytokine, transforming growth factor (TGF)-␤, is superphysiologically and tonically expressed by adenoviral vector in the lung, thereby bypassing inflammation-induced expression of TGF-␤ (22). Although TGF-␤ remains the most potent cytokine for the induction of ECM, the shear presence of TGF-␤ alone does not dictate progression to fibrosis. In fact, the expression of TGF-␤ is necessary during resolution of inflammation, which leads to normal re-epithelialization in the absence of overwhelming fibrosis (23). The expression of physiologically relevant TGF-␤ may be necessary but not sufficient to lead to fibrosis. Therefore, it is in the context in which TGF-␤ is expressed that ultimately leads to pulmonary fibrosis.

S104


Figure 1. Sequential and over-lapping events related to the dysregulated repair in IPF.

Injury to the alveolar–capillary wall leading to loss of basement membrane integrity ultimately leads to failure of re-epithelialization and re-endothelialization, loss of alveoli with alveolar coalescence and fibrosis. In this context, the expression of TGF-␤ contributes to dysregulated repair and fibrosis. In contrast, if inflammation occurs concomitantly with preservation of the alveolar–capillary wall basement membrane, then re-epithelialization and re-endothelialization will proceed with re-establishment of the normal architecture of the alveoli. TGF-␤ expression under these conditions is necessary for normal resolution of inflammation without overt fibrosis. The finding that UIP can coexist with NSIP supports the notion that indeed chronic inflammation may be an integral process in the pathogenesis of UIP. Therefore, a modification of the two previous hypotheses for the pathogenesis of UIP should be considered. This hypothesis suggests that inflammation is subsequent to “injury,” and with “persistent antigen and recurrent hits” results in polarization of the response with failure of re-epithelialization and promotion of pulmonary fibrosis (Table 1, C). As depicted in Figure 1, this hypothesis can be viewed as sequentially overlapping events and subsequent to “antigen/recurrent hits” in the context of a genetic predisposition. Moreover, these events are related to the following mechanisms: (i ) “injury” in the context of genetic predisposition. For example, surfactant protein C mutation may provide a foundation for an aberrant response of alveoli to injury with failure to normally “re-expand” during repair; (ii) inflammation that polarizes from a predominate type 1 to predominate type 2 profibrotic cytokine cascade due to the host response to “persistent antigen/multiple hits”; (iii) altered efferocytosis of apoptotic cells with persistence of inflammation that supports polarization toward a profibrotic environment; (iv) loss of basement membrane integrity, which jeopardizes the reestablishment of the normal architectural nature of alveoli; (v ) aberrant epithelial signaling leading to apoptosis and impaired proliferation in response to injury in the context of the loss of basement membrane (this process contributes to failure of re-epithelialization of the alveolar–capillary wall and re-establishment of the gas exchange unit); (vi) Pulmonary fibrosis is the ultimate final pathway of failed attempts

to architecturally reorganize alveoli. This process is due to multiple events that include: (i ) enhanced recruitment of mesenchymal stem cells that differentiate into myofibroblasts versus differentiation of resident cells to myofibroblasts; (ii) anti-apoptotic and proliferative nature of fibroblasts/myofibroblasts in the microenvironment; and (iii) enhanced production of ECM by these fibroblasts/myofibroblasts. In summary, what are the future directions that we should take to improve our knowledge about pulmonary fibrosis? At a minimum, these future directions should include the following: (i ) better understanding of the natural history of the pathogenesis of pulmonary fibrosis and ultimately UIP; (ii) the use of novel techniques to improve our understanding of specific mechanisms that are operative during the pathogenesis of pulmonary fibrosis; (iii) the use of novel imaging and diagnostic techniques to improve earlier diagnosis of all IIPs; (iv) the education of primary care physicians and pulmonologists that there is increased incidence and prevalence of IIPs, and the need for them to consider referral to an interstitial lung disease specialist; (v ) the development of therapeutic strategies that target specific aberrant pathways during the natural history of the pathogenesis of pulmonary fibrosis; (vi) additional funding opportunities from the NIH and the pharmaceutical industry to support basic and clinical research to facilitate and perpetuate our knowledge about pulmonary fibrosis. Only when these issues are in place will we be able to improve the prognosis of disorders associated with progressive pulmonary fibrosis. Acknowledgments: This section was funded by the National Institutes of Health grant P5OHL67665.

References 1. American Thoracic Society. 2000. American Thoracic Society/European Respiratory Society International Multidisciplinary Consensus Classification of the Idiopathic Interstitial Pneumonias. Am. J. Respir. Crit. Care Med. 161:646–664. 2. American Thoracic Society. 2002. American Thoracic Society/European Respiratory Society International Multidisciplinary Consensus Classification of the Idiopathic Interstitial Pneumonias. This joint statement of the American Thoracic Society (ATS), and the European Respiratory Society (ERS) was adopted by the ATS board of directors, June 2001 and by the ERS Executive Committee, June 2001. Am. J. Respir. Crit. Care Med. 165:277–304. 3. Katzenstein, A. L., and J. L. Myers. 1998. Idiopathic pulmonary fibrosis:


4. 5. 6. 7. 8.

9. 10.

11.

12. 13.

clinical relevance of pathologic classification. Am. J. Respir. Crit. Care Med. 157:1301–1315. Lamblin, C., C. Bergoin, T. Saelens, and B. Wallaert. 2001. Interstitial lung diseases in collagen vascular diseases. Eur. Respir. J. Suppl. 32:69s–80s. Lynch, D. A., J. D. Newell, P. M. Logan, T. E. King, Jr., and N. L. Muller. 1995. Can CT distinguish hypersensitivity pneumonitis from idiopathic pulmonary fibrosis? AJR Am. J. Roentgenol. 165:807–811. Corrin, B., A. Dewar, R. Rodriguez-Roisin, and M. Turner-Warwick. 1985. Fine structural changes in cryptogenic fibrosing alveolitis and asbestosis. J. Pathol. 147:107–119. Basset, F., V. J. Ferrans, P. Soler, T. Takemura, Y. Fukuda, and R. G. Crystal. 1986. Intraluminal fibrosis in interstitial lung disorders. Am. J. Pathol. 122:443–461. Kuhn, C., III, J. Boldt, T. E. King, Jr., E. Crouch, T. Vartio, and J. A. McDonald. 1989. An immunohistochemical study of architectural remodeling and connective tissue synthesis in pulmonary fibrosis. Am. Rev. Respir. Dis. 140:1693–1703. McDonald, J. A. 1991. Idiopathic pulmonary fibrosis: a paradigm for lung injury and repair. Chest 99:87S–93S. Strieter, R. M., M. P. Keane, T. J. Standiford, and S. L. Kunkel. 1998. Cytokine biology and the pathogenesis of interstitial lung disease. In M. I. Schwarz and T. E. King, editors. Interstitial lung disease. B. C. Decker, Inc., Hamilton, Ontario, Canada. 181–205. Keane, M. P., P. M. Henson, and R. M. Strieter. 2000. Inflammation, injury, and repair. In J. F. Murray, J. A. Nadel, R. Mason, and H. Boushey, editors. Textbook of Respiratory Medicine, 3rd ed. W. B. Saunders Co., Philadelphia, PA. 495–538. Gross, T. J., and G. W. Hunninghake. 2001. Idiopathic pulmonary fibrosis. N. Engl. J. Med. 345:517–525. Sheppard, D. 2001. Pulmonary fibrosis: a cellular overreaction or a failure of communication? J. Clin. Invest. 107:1501–1502.

S105

14. Kolb, M., P. J. Margetts, D. C. Anthony, F. Pitossi, and J. Gauldie. 2001. Transient expression of IL-1beta induces acute lung injury and chronic repair leading to pulmonary fibrosis. J. Clin. Invest. 107:1529–1536. 15. Selman, M., T. E. King, and A. Pardo. 2001. Idiopathic pulmonary fibrosis: prevailing and evolving hypotheses about its pathogenesis and implications for therapy. Ann. Intern. Med. 134:136–151. 16. King, T. E., Jr., M. I. Schwarz, K. Brown, J. A. Tooze, T. V. Colby, J. A. Waldron, Jr., A. Flint, W. Thurlbeck, and R. M. Cherniack. 2001. Idiopathic pulmonary fibrosis: relationship between histopathologic features and mortality. Am. J. Respir. Crit. Care Med. 164:1025–1032. 17. Collard, H. R., and T. E. King, Jr. 2001. Treatment of idiopathic pulmonary fibrosis: the rise and fall of corticosteroids. Am. J. Med. 110:326–328. 18. Collard, H. R., and T. E. King, Jr. 2001. Lung biopsy in patients with usual interstitial pneumonia. Eur. Respir. J. 18:895–898. 19. Flaherty, K. R., W. D. Travis, T. V. Colby, G. B. Toews, E. A. Kazerooni, B. H. Gross, A. Jain, R. L. Strawderman, A. Flint, J. P. Lynch, and F. J. Martinez. 2001. Histopathologic variability in usual and nonspecific interstitial pneumonias. Am. J. Respir. Crit. Care Med. 164:1722–1727. 20. Chandler, D. B. 1990. Possible mechanisms of bleomycin-induced fibrosis. Clin. Chest Med. 11:21–30. 21. Christensen, P. J., R. E. Goodman, L. Pastoriza, B. Moore, and G. B. Toews. 1999. Induction of lung fibrosis in the mouse by intratracheal instillation of fluorescein isothiocyanate is not T-cell-dependent. Am. J. Pathol. 155: 1773–1779. 22. Sime, P. J., Z. Xing, F. L. Graham, K. G. Csaky, and J. Gauldie. 1997. Adenovector-mediated gene transfer of active transforming growth factor-beta1 induces prolonged severe fibrosis in rat lung. J. Clin. Invest. 100:768–776. 23. Lawrence, T., D. W. Gilroy, P. R. Colville-Nash, and D. A. Willoughby. 2001. Possible new role for NF-kappaB in the resolution of inflammation. Nat. Med. 7:1291–1297.

NOTES