IFN- promotes definitive maturation of dendritic cells ... - CiteSeerX

Uncorrected Version. Published on June 12, 2006 as DOI:10.1189/jlb.1005592

IFN-␣ promotes definitive maturation of dendritic cells generated by short-term culture of monocytes with GM-CSF and IL-4 Marc Dauer, Katharina Schad, Jana Junkmann, Christian Bauer, Jan Herten, Rosemarie Kiefl, Max Schnurr, Stefan Endres, and Andreas Eigler1 Section of Gastroenterology and Division of Clinical Pharmacology, Medizinische Klinik Innenstadt, University of Munich, Germany

Abstract: Dendritic cells (DC) generated in vitro have to be viable and phenotypically mature to be capable of inducing T cell-mediated immunity after in vivo administration. To facilitate optimization of DC-based vaccination protocols, we investigated whether the cytokine environment and the mode of activation affect maturation and survival of DC derived from monocytes by a short-term protocol. Monocytes cultured for 24 h with granulocyte macrophage-colony stimulating factor and interleukin-4 were stimulated with proinflammatory mediators for another 36 h to generate mature DC. Additional activation with CD40 ligand and interferon (IFN)-␥ increased viability of DC and promoted definitive maturation as defined by maintenance of a mature phenotype after withdrawal of cytokines. Addition of IFN-␣ to DC cultures prior to stimulation further enhanced definitive maturation: IFN-␣-primed DC expressed high levels of costimulatory molecules and CC chemokine receptor 7 (CCR7) up to 5 days after cytokine withdrawal. Compared with unprimed DC, IFN-␣primed DC displayed equal capacity to migrate upon CCR7 ligation and to prime antigen-specific T helper cell as well as cytolytic T cell responses. In conclusion, we show that optimal maturation and survival of monocyte-derived DC require multiple activation signals. Furthermore, we identified a novel role for IFN-␣ in DC development: IFN-␣ priming of monocytes promotes definitive maturation of DC upon activation. J. Leukoc. Biol. 80: 000 – 000; 2006.

INTRODUCTION

maintain in culture. Thus, for experimental and clinical studies, DC are derived in vitro from CD34⫹ precursor cells or from CD14⫹ blood monocytes [2, 3]. Unless activated by proinflammatory, microbial, or T cell-derived signals [4 – 6], in vitroderived DC remain in an immature state characterized by a high capacity for antigen uptake and responsiveness to inflammatory chemokines [7, 8]. Upon activation, DC decrease antigen uptake, up-regulate costimulatory as well as major histocompatibility complex (MHC) molecules, express maturation markers such as CD83, and secrete large amounts of immunostimulatory cytokines [9, 10]. Moreover, a coordinated switch in chemokine receptor expression renders mature DC susceptible to lymph node-directing chemokines [11, 12]. As a result of the phenotypic and functional changes associated with maturation, DC are equipped with all the functional properties required for the induction of adaptive T cell responses after in vivo administration. Although differentiation and activation have been studied extensively, little is known about the fate of in vitro-derived, mature DC after withdrawal of growth factors and cytokines. Only limited data about DC survival in washout cultures exist [13]. Thus, although it is widely believed that mature DC represent terminally differentiated cells, it is not known whether DC revert to an immature phenotype after cessation of activating signals. Currently, 5–7 days of differentiation with granulocyte macrophage-colony stimulating factor (GM-CSF) and interleukin (IL)-4 followed by 2 days of activation are regarded as the “gold standard” of DC generation from monocytes in vitro [14]. However, we and others have shown that fully functional DC can be derived from GM-CSF-cultured monocytes within only 2–3 days using IL-4 or interferon-␣ (IFN-␣) as differentiation factors [15–19]. These novel, shortterm strategies not only allow effective development of DC in vitro but may also resemble the in vivo conditions of the differentiation process more closely, thus providing a more physiologic model for the identification of factors that influence definitive maturation and survival of DC.

Dendritic cells (DC) are highly specialized antigen-presenting cells with the unique capacity to establish and control T cell-mediated immune responses [1]. Circulating blood DC account for only less than 1% of human peripheral blood mononuclear cells (PBMC) and are difficult to isolate and to

1 Correspondence: Medizinische Klinik Innenstadt, University of Munich, Ziemssenstr.1, 80336 Munich, Germany. E-mail: [email protected] Received October 19, 2005; revised February 27, 2006; accepted April 13, 2006; doi: 10.1189/jlb.1005592.

Key Words: differentiation 䡠 viability 䡠 priming 䡠 T cells 䡠 vaccination 䡠 immunotherapy

0741-5400/06/0080-0001 © Society for Leukocyte Biology

Journal of Leukocyte Biology Volume 80, August 2006

Copyright 2006 by The Society for Leukocyte Biology.

1

Stable expression of maturation markers is required for the migration of antigen-loaded DC to secondary lymphoid tissues after in vivo administration and for the subsequent induction of T cell-mediated immune responses. In the present study, we used a short-term protocol for DC generation described previously [18, 19] to investigate whether the cytokine environment present during development from monocyte precursors and the mode of activation affect viability and definitive maturation of DC, which were derived from GM-CSF/IL-4-cultured monocytes in the presence or absence of IFN-␣ and were matured with proinflammatory mediators alone or in combination with soluble CD40 ligand-trimer (sCD40L) and IFN-␥. Subsequently, DC were cultured for 6 days in the absence of growth factors or cytokines, and viability and immunophenotype were determined daily. Comparative analysis was performed to determine the capacity of the different DC preparations to prime autologous T helper (Th) cells as well as cytotoxic T cells (CTL), to migrate upon CC chemokine receptor 7 (CCR7) ligation, and to secrete immunoregulatory cytokines.

MATERIALS AND METHODS Reagents and enzyme-linked immunosorbent assay (ELISA) kits GM-CSF (Leukine威) was from Immunex (Seattle, WA), IL-4 from Promega (Madison, WI), IL-6 from Amersham International (Little Chalfont, UK), and tumor necrosis factor ␣ (TNF-␣) from R&D Systems (Wiesbaden, Germany); IL-1␤, IL-2, and IL-7 were from Strathmann Biotech (Hannover, Germany). Prostaglandin E2 (PGE2) was from Sigma-Aldrich (St. Louis, MO), Na2[51Cr]O4 from PerkinElmer Life Sciences (Boston, MA), [3H]thymidine from Amersham Buchler (Freiburg, Germany), and tetanus toxoid (TT) from Statens Serum Institute (Copenhagen, Denmark). sCD40L was provided by Amgen (Thousand Oaks, CA). Total IL-12 was determined using an assay detecting IL-12p40 and IL-12p70 (Bender Med Systems, Vienna, Austria). IL-12p70 was measured using a high-sensitivity assay from R&D Systems. IL-4 was quantified using OptEIA sets from BD PharMingen (San Diego, CA).

Peptides The human leukocyte antigen (HLA)-A*0201-restricted peptides ELAGIGILTV (derived from the melanoma-associated differentiation antigen Melan-A/MART-1 and referred to as Melan-A) and GILGFVFTL (derived from the influenza matrix protein and referred to as FLU) were produced by Jerini Peptide Technologies (Berlin, Germany). The HLA-A*0201-restricted peptide ILKEPVHGV [derived from the human immunodeficiency virus (HIV)-pol protein and referred to as HIV-pol] was synthesized on a multiple peptide synthesizer (Peptide Synthesizer 433A, Applied Biosystems, Foster City, CA) at the GSF Research Institute (Munich, Germany).

Media All cultures of human PBMC were maintained in RPMI-1640 medium (Biochrom, Berlin, Germany), supplemented with 2% human AB serum (BioWhittaker, Walkersville, MD), 2 mM L-glutamine (PAA, Linz, Austria), 100 U/ml penicillin, and 100 ␮g/ml streptomycin (PAA). T2 cells were maintained in RPMI 1640 supplemented with 10% fetal calf serum (GibcoTM Invitrogen Corp., Paisley, UK), 2 mM L-glutamine, 100 U/ml penicillin, and 100 ␮g/ml streptomycin.

Isolation and culture of cells PBMC were isolated from peripheral blood of healthy donors by FicollHypaque gradient centrifugation. DC were generated from the adherent fraction of PBMC using a novel, short-term protocol [18]. In brief, adherent cells were cultured in six-well plates (0.5–1.5⫻106 cells/ml) in fresh complete

2


medium supplemented with GM-CSF (1000 U/ml) and IL-4 (500 U/ml) for 24 h, followed by stimulation with proinflammatory mediators (1000 U/ml TNF-␣, 10 ng/ml IL-1␤, 10 ng/ml IL-6, and 1 ␮M PGE2) for 36 h. Alternatively, monocytes were cultured with IL-4 and GM-CSF plus IFN-␣ (500 U/ml) prior to activation (IFN-␣-primed DC). In some experiments, DC were stimulated additionally with CD40L (500 ng/ml) and IFN-␥ (1000 U/ml). CD3⫹ T cells were isolated from the nonadherent fraction of PBMC by negative selection using the Pan T Cell isolation kit from Miltenyi Biotech (BergischGladbach, Germany; purity ⬎95%). To obtain CD45RA⫹ naı¨ve T cells, CD45RO-expressing cells were depleted additionally using CD45RO Micro Beads (Miltenyi Biotech).

Washout culture Mature DC were harvested after completion of the 36-h activation period, washed three times with phosphate-buffered saline (PBS), and resuspended in complete medium without the addition of growth factors or cytokines. Cells were cultured for up to 144 h, and survival and surface marker expression were determined daily.

Flow cytometry and monoclonal antibodies (mAb) The following mAb were used for fluorescein-activated cell sorter (FACS) analysis: L307.4 [anti-CD80, phycoerythrin (PE)-conjugated], HB15e [antiCD83, fluorescein isothiocyante (FITC)-conjugated], M5E2 [anti-CD14, allophycocyanin (APC)-conjugated], L243 [anti-HLA-DR, peridinin chlorophyll protein (PerCP)-conjugated], HIT3A (anti-CD3, FITC-conjugated), RPA-T4 (anti-CD4, PE-conjugated), SK1 (anti-CD8, PerCP-conjugated), RPA-T8 (antiCD8, APC-conjugated), HI 100 (anti-CD45RA, FITC-conjugated), and UCHL1 (anti-CD45RO, PE-conjugated) were all from BD PharMingen. HLAA2⫹ donors were identified by anti-HLA-A2 (Clone BB7.2, FITC-conjugated) from Becton Dickinson (San Diego, CA). CCR7 expression was determined by incubation with rat anti-CCR7 mAb (Clone 3D12; kindly provided by R. Fo¨rster, Technical University of Munich, Germany), followed by incubation with anti-rat immunoglobulin G2a-biotinylated mAb (Clone RG7/1.30, BD PharMingen) and incubation with streptavidin-APC (BD PharMingen). PEcoupled MHC-I/Melan-A streptamers (Streptamer威) were purchased from IBA GmbH (Go¨ttingen, Germany). Prior to incubation with T cells, PE-conjugated Strep-Tactin and MHC-I molecules were coincubated with PBS containing 0.5% bovine serum albumin for 45 min at 4°C. Cells were stained in 50 ␮l streptamer preparation for 45 min. Fluorescently labeled mAb for detection of surface marker expression were added during the last 20 min of the incubation phase. Cells were analyzed on a FACSCalibur flow cytometer (Becton Dickinson, Heidelberg, Germany). Data were analyzed using CellQuest software (Version 3.2.1, Becton Dickinson).

Coculture of DC with autologous T cells To load DC with TT, the protein (5 ␮g/ml) was added to DC cultures on Day 1. To load DC with peptides, cells were pulsed with the indicated peptide (10 ␮M) for the last 4 h of stimulation. Unloaded, TT-loaded, or peptide-pulsed DC were harvested after stimulation, washed extensively, and cocultured with autologous T cells at a ratio of 1:10. Half of the medium was replaced every second day by fresh culture medium containing IL-2 (25 U/ml) and IL-7 (10 ng/ml). The T cell cultures were restimulated weekly with freshly isolated and peptide-pulsed DC.

T cell proliferation T cell proliferation assays were performed in cooperation with Professor Dr. R. Wank (Institute of Immunology, University of Munich). The different DC preparations were harvested and cocultured in complete medium with autologous T cells (2⫻105/200 ␮l) in 96-well round-bottom microtiter plates at ratios ranging from 1:20 to 1:320 in quadruplicates. On Day 5, the cells were pulsed with [3H]-thymidine (1 ␮Ci/well) and harvested after 18 h onto a filtermate. The amount of incorporated [3H]-thymidine was analyzed in a liquid ␤-scintillation counter (Wallac Oy, Turku, Finland).

Enzyme-linked immunospot (ELIspot) IFN-␥-producing T cells were quantified by ELIspot (IFN-␥ Development Module, R&D Systems) according to the manufacturer’s protocol. Nitrocellu-

http://www.jleukbio.org

lose 96-well plates (Millititer, Millipore, Bedford, MA) were coated overnight at 4°C with 100 ␮l/well mouse anti-human IFN-␥ capture antibody. Subsequently, wells were washed three times with wash buffer, and unoccupied sites were blocked with 200 ␮l/well blocking buffer for 2 h at room temperature. T cells and stimulator cells were mixed separately (ratio 10:1) and transferred into the precoated ELIspot plates in triplicate wells at a final concentration of 6.25–50 ⫻ 103 T cells per well. The ELIspot plates were accurately wrapped with a 13 ⫻ 16-cm piece of aluminium foil. After 18 h of incubation at 37°C in 5% CO2, cells were removed from the ELIspot plates by washing four times. Wells were incubated for 24 h at 4°C using 100 ␮l/well anti-IFN-␥-biotinylated detection antibody. After washing three times, 100 ␮l/well streptavidin– alkaline phosphatase (ELIspot Blue Color Module, R&D Systems) was added for 2 h at room temperature. After another washing step, 100 ␮l/well 5-bromo4-chloro-3-indolyl phosphate/nitroblue tetrazolium chromogen was added for 30 min at room temperature under light protection. Development was stopped by washing under running tap water. After drying for 2 h at room temperature, blue spots were determined microscopically using a computer-assisted image analysis system (KS ELIspot, Carl Zeiss, Jena, Germany). T cells stimulated with phytohemagglutinin (5 ␮g/ml) were used as positive controls. ELIspot analysis was performed in cooperation with Professor Dr. Ackenheil (Department of Psychiatry, University of Munich).

Statistical analysis Data are expressed as means ⫾ SEM. Statistical significance was determined by the paired two-tailed Student’s t-test using Stat-View 4.51 software (Abacus Concepts, Calabasas, CA). Differences were considered statistically significant for P ⬍ 0.05 (asterisks in figures).

RESULTS T cell-derived signals are required for definitive maturation of DC

For migration studies, 24-well plates were filled with 600 ␮l RPMI-2% human serum in the absence or presence of 6Ckine (100 ng/ml). Freshly prepared DC (2⫻104) in 100 ␮l RPMI-2% human serum were added into 5 ␮m Transwell inserts (Costar, Corning, NY), placed into the 24-well plates, and incubated for 2 h at 37°C. The medium in the lower chambers was concentrated to 50 ␮l, and cells were counted with a hemocytometer. All conditions were performed as duplicates.

DC were generated from monocytes by 24 h of culture with GM-CSF and IL-4 followed by stimulation with the proinflammatory mediators TNF-␣, IL-1␤, IL-6, and PGE2 for another 36 h. To mimick Th1-type-dependent activation, sCD40L and IFN-␥ were added for the last 24 h of stimulation. Subsequently, cells were washed extensively and cultured in complete medium without growth factors or cytokines for 6 days. Viability and immunophenotype of DC were determined immediately after activation and every 24 h until completion of the washout culture. After stimulation with proinflammatory mediators, 90% of cells were alive, expressing the typical, mature DC immunophenotype: Cells were CD14– CD80⫹CD83⫹CD86highMHC class-IIhigh (data not shown). More than 75% of cells were alive after Day 4 of the washout culture, forming a homogeneous population of viable cells, as determined by manual counting (data not shown) and FACS analysis using forward-scatter (FSC) and side-scatter (SSC) criteria (Fig. 1A). However, CD14 was re-expressed by Day 4 and was up-regulated rapidly until Day 6 (⬃60% CD14⫹ cells). Re-expression of CD14 was associated with complete loss of CD83 and CD80 expression (Fig. 1B). Additional activation of DC with CD40L and IFN-␥ not only increased viability (⬎90% viable cells after Day 4, Fig. 1A) but also enhanced initial maturation and prevented reversion to an immature phenotype. Although CD83 was down-regulated by Day 5, cells remained CD14– and maintained high expression levels of costimulatory molecules, even after 6 days of washout culture (Fig. 1B). Thus, DC matured with proinflammatory mediators revert to a monocytic phenotype unless activated additionally with T cell-derived signals.

Reverse transcriptase-polymerase chain reaction (RT-PCR)

Priming of monocytes with IFN-␣ enhances definitive maturation of DC

Total RNA was isolated from 1 ⫻ 106 DC using the high, pure isolation kit by Roche (Mannheim, Germany). RT of the total RNA (16.4 ␮l) was performed using the first-strand synthesis kit (Roche). The resulting cDNA (2 ␮l) was amplified by PCR for a specific number of cycles depending on the considered gene using a T3 thermocycler (Biometra, Go¨ttingen, Germany). The primer pairs (Applied Biosystems, Norwalk, CT) were: IL-18 (5⬘-GCTTGAATCTAAATTATCAGTC, 3⬘-GAAGATTCAAATTGCATCTTAT), IL-23p19 (5⬘AGCAGCTCAAGGATGGCACTCAG, 3⬘-CCCCAAATTTCCCTTCCCATCTA), IL-12p35, (5⬘-GGTCTTTCTGGAGGCCAGGC, 3⬘-CCTCAGTTTGGCCAGAAACC), ␤-actin (5⬘-TGCCCTGAGGCACTCTTCCA, 3⬘-TTGCGCTCAGGAGGAGCAAT). The durations and temperatures used for annealing were: IL-18 (30 cycles) and ␤-actin (25 cycles), each cycle for 1 min at 95°C, 60°C, and 72°C with a final extension for 5 min at 72°C; IL-12p35 (35 cycles, each cycle for 1 min at 95°C, 62°C, and 72°C); IL-23p19 (30 cycles, each cycle for 1 min at 95°C, 56°C, and 72°C with a final extension for 5 min at 72°C). PCR products were separated on a 1.5% agarose gel containing 0.05 mg ethidium-bromide and photographed under ultraviolet light.

Next, we were interested if modification of the cytokine environment during development from monocyte precursors could facilitate definitive maturation of DC, which were derived from GM-CSF-cultured monocytes with IL-4 or IFN-␣ plus IL-4 (IFN-␣-primed DC) and were subsequently analyzed in the washout cultures. Priming of monocytes with IFN-␣ had no effect on DC yield or survival (data not shown) but promoted definitive maturation of DC upon proinflammatory activation: Down-regulation of maturation markers and CD14 re-expression was delayed. This effect was most pronounced for CD80 expression (P⬍0.01 for IFN-␣-primed vs. unprimed DC after Day 4; Fig. 2). However, additional activation with CD40L and IFN-␥ was optimal for definitive maturation of IFN-␣-primed DC: Cells maintained mature immunophenotype until comple-

Cytotoxicity assay Five days after the second restimulation with DC, specific lysis was determined by a standard 51Cr release assay using peptide-pulsed HLA-A2⫹, transporter associated with antigen processing-negative T2 cells (lymphoblast cell line, ATCC CRL-1992) as target cells (performed in cooperation with Professor Dr. R. Wank). T2 cells pulsed with the cognate or control peptide (Melan-A, FLU, or HIV-pol, 10 ␮M) for 4 h were incubated with 100 ␮Ci Na2[51Cr]O4/106 cells for 1 h at 37°C. Cells were washed four times and used as target cells (3⫻103 cells/well) for effector T cells [effector:target (E:T) ratios ranging from 80:1 to 20:1] in 96-well round-bottom plates. After 4 h of incubation at 37°C, 50 ␮l supernatants of each well were harvested, and radioactivity was measured on a ␥ counter (Wallac Oy). Maximum release was assessed by addition of Triton-X 1% (Sigma Chemical Co., Taufkirchen, Germany). Spontaneous release was determined in wells with labeled targets in the absence of effector cells. Specific lysis was calculated by the formula: specific 51Cr-release ⫽ [(experimental counts–spontaneous counts)/(maximal counts–spontaneous counts)] ⫻ 100%.

Cell migration assay

Dauer et al. Functional analysis of dendritic cell subtypes

3

Fig. 1. T cell-derived signals are required for definitive maturation of DC. Monocytes were cultured with GM-CSF and IL-4 for 24 h and stimulated with TNF-␣, IL-1␤, IL-6, and PGE2 for another 36 h. Where indicated, CD40L and IFN-␥ were added for the last 24 h of stimulation. After stimulation, cells were washed extensively and resuspended in complete medium without addition of growth factors or cytokines. FACS analysis was performed daily to determine viability of DC by FSC/SSC gating (A; life-gate analysis after 96 h of washout culture; results of one representative experiment out of four performed with different donors are shown) and expression of CD14 and DC maturation markers (B; data represent means⫾SEM of four experiments with different donors).

tion of the washout culture (CD80 MFI: P⬍0.01 for IFN-␣primed vs. unprimed DC at Day 4; Fig. 2). It is notable that IFN-␣-primed DC activated with proinflammatory plus Th cell-derived signals also maintained the highest level of CCR7 expression (P⫽0.02 for IFN-␣-primed vs. unprimed DC at Day 4; Fig. 2).

IFN-␣ priming of monocytes does not affect the capacity of DC to prime autologous T cells Phenotypic maturation of DC is required but not sufficient for the activation of adaptive immune responses. To test the ca-

pacity of IFN-␣-primed and unprimed DC to induce antigenspecific Th cell responses, autologous CD3⫹-immunoselected T cells (Fig. 3A) or CD3⫹CD45RA⫹-immunoselected, naı¨ve T cells (Fig. 3B) were cocultured with IFN-␣-primed or unprimed DC, TT-pulsed, or left unpulsed. After 7 days, all cocultures were restimulated in the ELIspot assay with the same DC, TT-pulsed, or unpulsed. Although IFN-␣ priming moderately enhanced the capacity of DC to elicit IFN-␥ production of CD3⫹ T cells in response to TT (Fig. 3A; P⫽0.04 for TT-pulsed, IFN-␣-primed vs. TT-pulsed, unprimed DC), it left the capacity of DC to prime naı¨ve Th cells unaffected (Fig.

Fig. 2. IFN-␣ priming of monocytes enhances definitive maturation of DC. Unprimed or IFN-␣-primed DC were stimulated with proinflammatory mediators for 36 h or additionally stimulated with CD40L and IFN-␥ for the last 24 h of activation. After stimulation, cells were washed extensively and resuspended in complete medium without addition of growth factors or cytokines. FACS analysis was performed daily to determine the expression of CD14, DC maturation markers, and CCR7 (data represent means⫾SEM of four experiments with different donors; *, P⬍0.05). MFI, Mean fluorescence intensity.

4



Fig. 3. IFN-␣ priming of DC precursors does not affect priming of autologous Th cells. Unprimed and IFN-␣-primed DC were loaded with TT or left unloaded, matured with proinflammatory mediators, and cocultured with purified, autologous CD3⫹ T cells (A) or naı¨ve CD45RA⫹ T cells (B), which were harvested after 7 days and restimulated in ELIspot assays with the same DC loaded with TT or left unloaded. The number of IFN-␥-secreting T cells was determined in triplicates for three different T cell numbers (data represent means⫾SEM of four experiments with different donors; *, P⬍0.05). Ag, Antigen.

3B). IL-4 was not detected in any of the cocultures (data not shown), indicating induction of a Th1 response. Next, we tested the capacity of IFN-␣-primed and unprimed DC to prime tumor antigen-specific CTL. CD3⫹-immunoselected T cells from HLA-A2⫹ donors were cocultured with autologous IFN-␣-primed or unprimed DC pulsed with Melan-A peptide after stimulation with proinflammatory mediators. After two rounds of in vitro stimulation with the same Melan-A-pulsed DC, lytic activity of CTL derived from cocultures with IFN-␣-primed or unprimed DC was assessed in a chromium release assay. T2 cells loaded with Melan-A or control peptide (HIV-pol) were used as target cells in the lysis assay. Priming of DC with IFN-␣ left their capacity to induce Melan-A-specific CTL unaffected (Fig. 4A). In parallel exper-

iments, we tested whether IFN-␣ priming of DC could augment their capacity to activate virus-specific CTL responses. To this end, CD3⫹ T cells from HLA-A2⫹ donors were cocultured with autologous IFN-␣-primed or unprimed DC pulsed with FLU peptide and lytic activity of CTL assessed after two rounds of in vitro stimulation as described. As shown in Figure 4B, IFN-␣ priming neither enhanced nor reduced the capacity of DCs to prime FLU-specifc CTL.

IFN-␣-primed DC activated with T cell-derived signals effectively prime tumor-specific CTL The principle aim of this study was to identify culture conditions for the generation of optimally mature and viable DC for the use in antitumoral vaccination trials. Thus, we had to show

Fig. 4. IFN-␣ treatment of DC precursors does not affect priming of antigen-specific CTL. Purified, autologous CD3⫹ T cells were cocultured with Melan-A-pulsed (A) or FLU-pulsed (B), unprimed or IFN-␣-primed DC matured with proinflammatory mediators. T cells were harvested 5 days after the second restimulation with the same DC and cocultured at different ratios with 51Cr-labeled T2 cells pulsed with Melan-A (mel; A) or FLU (B) peptide. T2 cells loaded with irrelevant peptide (HIV-pol) were used as controls. Supernatants were harvested after 4 h for measurement of 51Cr release and determination of specific lysis (data represent means⫾SEM of four experiments with different donors).


5

Fig. 5. T cell-derived stimulation does not affect CTL induction by IFN-␣-primed DC. Purified, autologous CD3⫹ T cells were cocultured with unpulsed or Melan-A-pulsed, unprimed or IFN-␣-primed DC matured with proinflammatory mediators plus CD40L and IFN-␥. Unprimed DC stimulated with proinflammatory mediators only were used as controls. Three days after the second restimulation with the different DCs, the percentage of CD8⫹ T cells binding to MHC-I/Melan-A streptamers was determined by FACS (A; data represent means⫾SEM of four experiments with different donors). In parallel experiments, T cells from the different cocultures were harvested 5 days after the second restimulation and cocultured at different ratios with 51Cr-labeled T2 cells pulsed with Melan-A. Supernatants were harvested after 4 h for measurement of 51Cr release and determination of specific lysis (B; data represent means⫾SEM of four experiments with different donors).

that additional activation of IFN-␣-primed DC with CD40L and IFN-␥, which resulted in optimal phenotypic maturation and survival, leaves their capacity to prime antitumoral CTL responses unaffected. Melan-A-specific CTL were generated as described above. To prime autologous CTL, unprimed or IFN␣-primed DC, each stimulated with proinflammatory mediators plus CD40L and IFN-␥, were used. As shown in Figure 5, unprimed as well as IFN-␣-primed DC stimulated additionally with T cell-derived signals effectively induced Melan-A-specific CTL. Although the different DC preparations induced almost identical frequencies of Melan-A-specific CTL binding to MHC-I/peptide complexes (Fig. 5A), CTL activated by DC stimulated additionally with CD40L and IFN-␥ showed enhanced lytic activity independent from IFN-␣-priming (Fig. 5B). Thus, it can be concluded from this part of the study that IFN-␣-primed DC activated with proinflammatory plus T cell-derived stimuli not only show optimal maturation and survival but are also highly effective in inducing tumor antigen-specific CTL.

IFN-␣-primed DC migrate in response to CCR7 ligation Migration to secondary lymph node organs is required for the induction of antigen-specific T cell responses by DC after in vivo administration. Thus, we compared the capacity of IFN␣-primed and unprimed DC to migrate in response to the CCR7 ligand 6Ckine. The percentage of cells migrating toward a 6Ckine gradient was equal for IFN-␣-primed DC and unprimed DC (⬎50%; Fig. 6, upper). Less than 5% of cells from the two different DC preparations migrated spontaneously (absence of 6Ckine; Fig. 6, Control). Monocytes cultured with GM-CSF and IL-4 for 72 h were used as an additional control: These cells display an immature DC phenotype (as shown previously; ref. [18]) and do not migrate in response to 6Ckine (Fig. 6, upper). In a second set of experiments, we analyzed the effect of additional T cell-derived stimulation on the migratory 6


Fig. 6. IFN-␣-primed DC migrate in response to the CCR7 ligand 6Ckine. Migration of unprimed and IFN-␣-primed DC toward 6Ckine was tested using a transwell system. Lower chambers contained medium plus 6CKine (100 ng/ml) or medium only (Control). Monocytes cultured with GM-CSF and IL-4 for 72 h were used as additional controls (upper). Migration was also tested after additional stimulation of unprimed as well as IFN-␣-primed DC with CD40L and IFN-␥ (lower). IFN-␣-primed DC stimulated with IL-␤, IL-6, and TNF-␣ only (no PGE2) plus CD40L and IFN-␥ were also tested (lower, far right). Data are the mean ⫾ SEM of three experiments with different donors.


Fig. 7. Production of immunoregulatory cytokines by IFN-␣-primed DC. Unprimed and IFN-␣-primed DC were matured with proinflammatory mediators only or additionally stimulated with CD40L and IFN-␥. Supernatants were harvested immediately after stimulation and after 48 and 72 h of washout cultures for measurement of total IL-12 (p40 and p70) by ELISA (A; data represent means⫾SEM of four experiments with different donors). Total RNA was extracted from DC after stimulation, and the expression of IL-12p35, IL-18, and IL-23p19 was analyzed by RT-PCR (B; data from two out of seven experiments performed with different donors are shown).

capacity of DC. Additional activation of unprimed as well as IFN-␣-primed DC with CD40L and IFN-␥ left the capacity to migrate upon CCR7 ligation unaffected (Fig. 6, lower). It is interesting that although additional activation of DC with CD40L and IFN-␥ leads to optimal maturation and viability, it does not circumvent the requirement of PGE2 for development of full migratory capacity by DC (Fig. 6, lower).

IFN-␣-primed DC activate Th1 and CTL responses despite inability to secrete IL-12 Production of immunoregulatory cytokines by DC is a critical factor for T cell activation. In accordance with our own previous findings [18], DC matured with proinflammatory mediators secreted low amounts of IL-12p70, even after additional activation with CD40L and IFN-␥ (data not shown). Priming of DC with IFN-␣ reduced secretion of total IL-12 compared with unprimed DC (Fig. 7A) but did not enhance IL-12p70 production (data not shown). In accordance with the lack of detectable IL-12p70-protein, IL-12p35-mRNA expression could not be detected in any of the two DC preparations (Fig. 7B). We analyzed the expression of other cytokines known to promote Th1 (IL-18) or Th2 (IL-10), CTL (IL-15), or memory T cell (IL-18, IL-23) responses. Despite interindividual variability, no significant differences could be detected in the mRNA expression levels of IL-18 and IL-23p19 by the two DC preparations (Fig. 7B). Moreover, neither IL-10 nor IL-15 protein could be detected in the culture supernatants of IFN-␣-primed or unprimed DC (data not shown).

DISCUSSION A novel, short-term protocol was used here for DC development from monocytes: As described previously, 24 h of culture with GM-CSF and IL-4 followed by another 36 h of activation with

proinflammatory or T cell-derived signals suffice to generate mature DC with full T cell-stimulatory capacity [18, 19]. Others have reported that rapid development of DC-like cells can also be induced by treatment of GM-CSF-cultured monocytes with IFN-␣ [16, 20, 21]. Moreover, it has been suggested that these IFN-␣-derived DC are superior to IL-4-cultured DC in activating tumor- as well as virus-specific CTL responses [22– 24]. Thus, we tested whether our strategy could be improved by the use of IFN-␣. However, in accordance with previous observations in a standard 7-day protocol [25, 26], IFN-␣ treatment did not induce DC development from GM-CSF-cultured monocytes in the absence of IL-4 (data not shown). The observed failure of IFN-␣ to induce DC development may be dependent on the purity of precursor cells in our short-term cultures (⬎95% CD14⫹ cells): Tosi et al. [27] have recently shown that highly purified monocytes treated with IFN-␣ do not express DC maturation markers and lose their ability to prime antitumoral CTLs, potentially as a result of the absence of contaminating natural killer (NK) cells providing IL-15. Upon maturation, DC become less susceptible to apoptotic cell death, whether induced exogenously, e.g., by death receptors and glucocorticoids, or endogenously, by cytokine withdrawal or MHC class-II ligation [28 –31]. However, the effects of cytokine environment and activation signals on definitive maturation and survival of DC are not well understood. The only available data about survival of growth factor-deprived DC have been obtained in a study that focused on optimization of production and storage of monocyte-derived DC for clinical use [13]. Lower survival rates were reported for freshly prepared, standard, monocyte-derived DC compared with DC derived from our short-term cultures (30% vs. 70%-viable DC after 4 days of washout culture). In the same study, maintenance of a mature phenotype could be observed until the end of the analysis at Day 3 of the washout cultures [13]. However, we analyzed the phenotype of DC maintained in the washout Dauer et al. Functional analysis of dendritic cell subtypes

7

cultures for up to 6 days and observed CD14 re-expression by DC starting at Day 4 unless an additional T cell-derived stimulus was provided. These results indicate that monocytederived DC stimulated with proinflammatory mediators only may not be terminally differentiated cells, although they appear to be relatively resistant to growth-factor deprivation in terms of survival. The observed reversion of DC activated with proinflammatory mediators to a monocyte/macrophage-like phenotype indicates that initial activation is not equivalent to definitive maturation, which requires a second, T cell-derived signal. In accordance with previous findings in standard monocyte-derived DC, CD40 signaling also promoted survival of mature, short-term DC [13, 32]. These observations are paralleled by the requirements for IL-12p70 production by DC: Secretion of the cytokine is independent from phenotypical maturation and requires multiple activation signals including IFN-␥ and CD40 ligation [33–35]. Thus, DC may only transiently express maturation markers after proinflammatory or microbial stimulation; full maturation as well as IL-12 production appear to be dependent on an encounter with activated Th cells. Our results also suggest a novel role for type I IFNs in DC development: We were able to show that incubation of monocyte precursors with IFN-␣ promotes definitive maturation of DC upon activation, independent of the combination of stimuli used. Type I IFN receptors are expressed predominantly on immature, monocyte-derived DC, and responsiveness to type I IFNs is lost upon maturation [36]. Thus, production of type I IFNs early after pathogen entry may contribute to a cytokine environment that promotes DC development from blood monocytes. However, maturation is dependent on activation by a second signal, possibly provided by pathogen components [5, 37] or the presence of proinflammatory or NK cell-derived cytokines [4, 27]. Finally, production of immunostimulatory cytokines requires activation by a third signal provided by T cells in the draining lymph node [38, 39]. Comparative analysis of cytokine production revealed that IFN-␣-primed DC not only produced less IL-12p40 compared with unprimed DC but were also completely inable to produce bioactive IL-12p70. This was predictable from previous studies: It has been shown repeatedly that IFN-␣ treatment inhibits IL-12p70 production by DC [25–27]. Moreover, PGE2, which was used for activation of DC in our short-term protocol, has also been shown to prevent secretion of bioactive IL-12 [35, 40 – 42]. Nevertheless, we decided to use PGE2, not only to facilitate comparison with previous “washout” studies [13] and with the proposed gold standard for DC generation from monocytes [14] but also to achieve optimal phenotypic maturation and survival [30]. Moreover, it has been shown previously that monocyte-derived DC require stimulation with PGE2 to develop the capacity to migrate upon CCR7 ligation [39]. These findings are confirmed by our results, showing that DC stimulated without PGE2 do not migrate in response to 6Ckine even after IFN-␣ priming and additional activation with CD40L and IFN-␥. It is important that IFN-␣-primed DC were fully capable of inducing a Th1 response in naı¨ve Th cells and of activating tumor antigen as well as virus-specific CTL despite their inability to produce IL-12. This prompted us to analyze the expression of other cytokines known to activate Th1 im8


mune responses. However, we could not detect any differences in the expression of IL-18, IL-15, or IL-23 between the two DC preparations. Thus, it remains to be shown how IFN-␣-primed DC overcome their defect in IL-12 production to activate antigen-specific Th1 and CTL responses. The identification of culture conditions and activating signals that promote survival and maturation of DC not only provides new insights into DC physiology but may also facilitate optimization of DC-based vaccines. Here, we show that phenotypic maturation of monocyte-derived DC stimulated with proinflammatory mediators only is reversible; optimal maturation and survival require additional activation with T cell-derived signals. Addition of IFN-␣ to our short-term protocol for DC development further enhances definitive maturation of DC but leaves the properties required for an effective, DC-based, antitumoral vaccine unaffected: IFN-␣-primed DC migrate in response to CCR7 ligation and are fully capable of priming antigen-specific Th1 and CTL responses. The use of IFN-␣-primed, irreversibly mature DC may augment the therapeutic efficacy of DC-based tumor immunotherapy.

ACKNOWLEDGMENTS K. S. was supported by the University of Munich (Promotionsstudium Molekulare Medizin). M. D. was supported by grants from the University of Munich (FoeFoLe No. 271 and Gravenhorst-Stiftung) and from the Rudolf Bartling-Stiftung (Hannover, Germany). This work is part of the doctoral thesis of K. S. and J. J. at the University of Munich (Germany). K. S. and J. J. contributed equally to this manuscript.

REFERENCES 1. Banchereau, J., Briere, F., Caux, C., Davoust, J., Lebecque, S., Liu, Y. J., Pulendran, B., Palucka, K. (2000) Immunobiology of dendritic cells. Annu. Rev. Immunol. 18, 767– 811. 2. Caux, C., Dezutter-Dambuyant, C., Schmitt, D., Banchereau, J. (1992) GM-CSF and TNF-␣ cooperate in the generation of dendritic Langerhans cells. Nature 360, 258 –261. 3. Romani, N., Gruner, S., Brang, D., Kampgen, E., Lenz, A., Trockenbacher, B., Konwalinka, G., Fritsch, P. O., Steinman, R. M., Schuler, G. (1994) Proliferating dendritic cell progenitors in human blood. J. Exp. Med. 180, 83–93. 4. Jonuleit, H., Kuhn, U., Muller, G., Steinbrink, K., Paragnik, L., Schmitt, E., Knop, J., Enk, A. H. (1997) Pro-inflammatory cytokines and prostaglandins induce maturation of potent immunostimulatory dendritic cells under fetal calf serum-free conditions. Eur. J. Immunol. 27, 3135–3142. 5. Kalinski, P., Schuitemaker, J. H., Hilkens, C. M., Wierenga, E. A., Kapsenberg, M. L. (1999) Final maturation of dendritic cells is associated with impaired responsiveness to IFN-␥ and to bacterial IL-12 inducers: decreased ability of mature dendritic cells to produce IL-12 during the interaction with Th cells. J. Immunol. 162, 3231–3236. 6. Cella, M., Scheidegger, D., Palmer-Lehmann, K., Lane, P., Lanzavecchia, A., Alber, G. (1996) Ligation of CD40 on dendritic cells triggers production of high levels of interleukin-12 and enhances T cell stimulatory capacity: T-T help via APC activation. J. Exp. Med. 184, 747–752. 7. Sallusto, F., Lanzavecchia, A. (1994) Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/ macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor ␣. J. Exp. Med. 179, 1109 –1118. 8. Dieu, M. C., Vanbervliet, B., Vicari, A., Bridon, J. M., Oldham, E., Ait-Yahia, S., Briere, F., Zlotnik, A., Lebecque, S., Caux, C. (1998) Selective recruitment of immature and mature dendritic cells by distinct


9. 10.

11.

12. 13.

14. 15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

chemokines expressed in different anatomic sites. J. Exp. Med. 188, 373–386. Cella, M., Engering, A., Pinet, V., Pieters, J., Lanzavecchia, A. (1997) Inflammatory stimuli induce accumulation of MHC class II complexes on dendritic cells. Nature 388, 782–787. Mosca, P. J., Hobeika, A. C., Clay, T. M., Nair, S. K., Thomas, E. K., Morse, M. A., Lyerly, H. K. (2000) A subset of human monocyte-derived dendritic cells expresses high levels of interleukin-12 in response to combined CD40 ligand and interferon-␥ treatment. Blood 96, 3499 – 3504. Sozzani, S., Allavena, P., D’Amico, G., Luini, W., Bianchi, G., Kataura, M., Imai, T., Yoshie, O., Bonecchi, R., Mantovani, A. (1998) Differential regulation of chemokine receptors during dendritic cell maturation: a model for their trafficking properties. J. Immunol. 161, 1083–1086. Randolph, G. J. (2001) Dendritic cell migration to lymph nodes: cytokines, chemokines, and lipid mediators. Semin. Immunol. 13, 267–274. Feuerstein, B., Berger, T. G., Maczek, C., Roder, C., Schreiner, D., Hirsch, U., Haendle, I., Leisgang, W., Glaser, A., Kuss, O., Diepgen, T. L., Schuler, G., Schuler-Thurner, B. (2000) A method for the production of cryopreserved aliquots of antigen-preloaded, mature dendritic cells ready for clinical use. J. Immunol. Methods 245, 15–29. Schuler, G., Schuler-Thurner, B., Steinman, R. M. (2003) The use of dendritic cells in cancer immunotherapy. Curr. Opin. Immunol. 15, 138 –147. Czerniecki, B. J., Carter, C., Rivoltini, L., Koski, G. K., Kim, H. I., Weng, D. E., Roros, J. G., Hijazi, Y. M., Xu, S., Rosenberg, S. A., Cohen, P. A. (1997) Calcium ionophore-treated peripheral blood monocytes and dendritic cells rapidly display characteristics of activated dendritic cells. J. Immunol. 159, 3823–3837. Santini, S. M., Lapenta, C., Logozzi, M., Parlato, S., Spada, M., Di Pucchio, T., Belardelli, F. (2000) Type I interferon as a powerful adjuvant for monocyte-derived dendritic cell development and activity in vitro and in Hu-PBL-SCID mice. J. Exp. Med. 191, 1777–1788. Faries, M. B., Bedrosian, I., Xu, S., Koski, G., Roros, J. G., Moise, M. A., Nguyen, H. Q., Engels, F. H., Cohen, P. A., Czerniecki, B. J. (2001) Calcium signaling inhibits interleukin-12 production and activates CD83(⫹) dendritic cells that induce Th2 cell development. Blood 98, 2489 –2497. Dauer, M., Obermaier, B., Herten, J., Haerle, C., Pohl, K., Rothenfusser, S., Schnurr, M., Endres, S., Eigler, A. (2003) Mature dendritic cells derived from human monocytes within 48 hours: a novel strategy for dendritic cell differentiation from blood precursors. J. Immunol. 170, 4069 – 4076. Dauer, M., Schad, K., Herten, J., Junkmann, J., Bauer, C., Kiefl, R., Endres, S., Eigler, A. (2005) FastDC derived from human monocytes within 48 h effectively prime tumor antigen-specific cytotoxic T cells. J. Immunol. Methods 302, 145–155. Parlato, S., Santini, S. M., Lapenta, C., Di Pucchio, T., Logozzi, M., Spada, M., Giammarioli, A. M., Malorni, W., Fais, S., Belardelli, F. (2001) Expression of CCR-7, MIP-3␤, and Th-1 chemokines in type I IFNinduced monocyte-derived dendritic cells: importance for the rapid acquisition of potent migratory and functional activities. Blood 98, 3022– 3029. Della Bella, S., Nicola, S., Riva, A., Biasin, M., Clerici, M., Villa, M. L. (2004) Functional repertoire of dendritic cells generated in granulocyte macrophage-colony stimulating factor and interferon-␣. J. Leukoc. Biol. 75, 106 –116. Gabriele, L., Borghi, P., Rozera, C., Sestili, P., Andreotti, M., Guarini, A., Montefusco, E., Foa, R., Belardelli, F. (2004) IFN-␣ promotes the rapid differentiation of monocytes from patients with chronic myeloid leukemia into activated dendritic cells tuned to undergo full maturation after LPS treatment. Blood 103, 980 –987. Padovan, E., Spagnoli, G. C., Ferrantini, M., Heberer, M. (2002) IFN-␣2a induces IP-10/CXCL10 and MIG/CXCL9 production in monocyte-derived dendritic cells and enhances their capacity to attract and stimulate CD8⫹ effector T cells. J. Leukoc. Biol. 71, 669 – 676. Santodonato, L., D’Agostino, G., Nisini, R., Mariotti, S., Monque, D. M., Spada, M., Lattanzi, L., Perrone, M. P., Andreotti, M., Belardelli, F., Ferrantini, M. (2003) Monocyte-derived dendritic cells generated after a short-term culture with IFN-␣ and granulocyte-macrophage colony-stimulating factor stimulate a potent Epstein-Barr virus-specific CD8⫹ T cell response. J. Immunol. 170, 5195–5202.

25. McRae, B. L., Nagai, T., Semnani, R. T., van Seventer, J. M., van Seventer, G. A. (2000) Interferon-␣ and -␤ inhibit the in vitro differentiation of immunocompetent human dendritic cells from CD14(⫹) precursors. Blood 96, 210 –217. 26. Dauer, M., Pohl, K., Obermaier, B., Meskendahl, T., Robe, J., Schnurr, M., Endres, S., Eigler, A. (2003) Interferon-␣ disables dendritic cell precursors: dendritic cells derived from interferon-␣-treated monocytes are defective in maturation and T-cell stimulation. Immunology 110, 38 – 47. 27. Tosi, D., Valenti, R., Cova, A., Sovena, G., Huber, V., Pilla, L., Arienti, F., Belardelli, F., Parmiani, G., Rivoltini, L. (2004) Role of cross-talk between IFN-␣-induced monocyte-derived dendritic cells and NK cells in priming CD8⫹ T cell responses against human tumor antigens. J. Immunol. 172, 5363–5370. 28. Hoves, S., Krause, S. W., Halbritter, D., Zhang, H. G., Mountz, J. D., Scholmerich, J., Fleck, M. (2003) Mature but not immature Fas ligand (CD95L)-transduced human monocyte-derived dendritic cells are protected from Fas-mediated apoptosis and can be used as killer APC. J. Immunol. 170, 5406 –5413. 29. Kim, K. D., Choe, Y. K., Choe, I. S., Lim, J. S. (2001) Inhibition of glucocorticoid-mediated, caspase-independent dendritic cell death by CD40 activation. J. Leukoc. Biol. 69, 426 – 434. 30. Vassiliou, E., Sharma, V., Jing, H., Sheibanie, F., Ganea, D. (2004) Prostaglandin E2 promotes the survival of bone marrow-derived dendritic cells. J. Immunol. 173, 6955– 6964. 31. Leverkus, M., McLellan, A. D., Heldmann, M., Eggert, A. O., Brocker, E. B., Koch, N., Kampgen, E. (2003) MHC class II-mediated apoptosis in dendritic cells: a role for membrane-associated and mitochondrial signaling pathways. Int. Immunol. 15, 993–1006. 32. Caux, C., Massacrier, C., Vanbervliet, B., Dubois, B., Van Kooten, C., Durand, I., Banchereau, J. (1994) Activation of human dendritic cells through CD40 cross-linking. J. Exp. Med. 180, 1263–1272. 33. Lapointe, R., Toso, J. F., Butts, C., Young, H. A., Hwu, P. (2000) Human dendritic cells require multiple activation signals for the efficient generation of tumor antigen-specific T lymphocytes. Eur. J. Immunol. 30, 3291–3298. 34. Vieira, P. L., de Jong, E. C., Wierenga, E. A., Kapsenberg, M. L., Kalinski, P. (2000) Development of Th1-inducing capacity in myeloid dendritic cells requires environmental instruction. J. Immunol. 164, 4507– 4512. 35. Mailliard, R. B., Wankowicz-Kalinska, A., Cai, Q., Wesa, A., Hilkens, C. M., Kapsenberg, M. L., Kirkwood, J. M., Storkus, W. J., Kalinski, P. (2004) ␣-Type-1 polarized dendritic cells: a novel immunization tool with optimized CTL-inducing activity. Cancer Res. 64, 5934 –5937. 36. Gauzzi, M. C., Canini, I., Eid, P., Belardelli, F., Gessani, S. (2002) Loss of type I IFN receptors and impaired IFN responsiveness during terminal maturation of monocyte-derived human dendritic cells. J. Immunol. 169, 3038 –3045. 37. Cella, M., Salio, M., Sakakibara, Y., Langen, H., Julkunen, I., Lanzavecchia, A. (1999) Maturation, activation, and protection of dendritic cells induced by double-stranded RNA. J. Exp. Med. 189, 821– 829. 38. Langenkamp, A., Messi, M., Lanzavecchia, A., Sallusto, F. (2000) Kinetics of dendritic cell activation: impact on priming of TH1, TH2 and nonpolarized T cells. Nat. Immunol. 1, 311–316. 39. Luft, T., Jefford, M., Luetjens, P., Toy, T., Hochrein, H., Masterman, K. A., Maliszewski, C., Shortman, K., Cebon, J., Maraskovsky, E. (2002) Functionally distinct dendritic cell (DC) populations induced by physiologic stimuli: prostaglandin E(2) regulates the migratory capacity of specific DC subsets. Blood 100, 1362–1372. 40. Kalinski, P., Vieira, P. L., Schuitemaker, J. H., de Jong, E. C., Kapsenberg, M. L. (2001) Prostaglandin E(2) is a selective inducer of interleukin-12 p40 (IL-12p40) production and an inhibitor of bioactive IL-12p70 heterodimer. Blood 97, 3466 –3469. 41. Xu, S., Koski, G. K., Faries, M., Bedrosian, I., Mick, R., Maeurer, M., Cheever, M. A., Cohen, P. A., Czerniecki, B. J. (2003) Rapid high efficiency sensitization of CD8⫹ T cells to tumor antigens by dendritic cells leads to enhanced functional avidity and direct tumor recognition through an IL-12-dependent mechanism. J. Immunol. 171, 2251–2261. 42. Schnurr, M., Toy, T., Shin, A., Wagner, M., Cebon, J., Maraskovsky, E. (2005) Extracellular nucleotide signaling by P2 receptors inhibits IL-12 and enhances IL-23 expression in human dendritic cells: a novel role for the cAMP pathway. Blood 105, 1582–1589.


9