B. E. H. COUPAR, M. E. ANDREW, D. B. BOYLE, AND R. V. BLANDEN. Department of Microbiology, John Curtin School of Medical Research, Australian ...
Proc. Nati. Acad. Sci. USA Vol. 83, pp. 7879-7882, October 1986
Immunology
Immune responses to H-2Kd antigen expressed by recombinant vaccinia virus (major histocompatibility complex antigen/cytotoxic T lymphocytes/H-2 restriction/eukaryotic virus vector)
B. E. H. COUPAR, M. E. ANDREW, D. B. BOYLE, AND R. V. BLANDEN Department of Microbiology, John Curtin School of Medical Research, Australian National University, Canberra, A.C.T. 2601, Australia
Communicated by Frank Fenner, June 27, 1986
ABSTRACT A recombinant vaccinia virus (VV-H2Kd-6) containing the coding sequence for the murine major histocompatibility complex class I antigen H-2Kd has been constructed and used to express H-2Kd on the surface of infected cells. Vaccinia expressed H-2Kd has been shown to generate an H-2Kd-specific primary cytotoxic T-cell response in mice infected with the recombinant virus and to stimulate an H-2Kd_ specific cytotoxic T-cell response in vitro. Cells infected with the recombinant virus acted as targets for specific lysis by appropriate alloreactive cytotoxic T cells, albeit relatively inefficiently when compared with alloreactive recognition and specific lysis of H-2Kdcontaining P815 cells. However, H-2Kd expressed by the recombinant virus was recognized efficiently as a restricting element in association with vaccinia virus antigens, while lysis of VV-H2Kd-6-infected L929 (H-2k) cells by CBA/H (H-2k) anti-C3H.OH (H-2KdDk) cytotoxic T cells was comparatively weak. These data suggest that there are quantitative or qualitative differences, or both, between H-2Kd expressed by vaccinia virus and cells of the H-2d haplotype. Qualitative differences have not been demonstrated but cannot be exclud-
MATERIALS AND METHODS
Cell Line. Human 143B cells, a TK- variant of R-970-5 (20) were obtained from K. Huebner (Wistar Institute, Philadelphia) and maintained as described (8).
Plasmids and Recombinant Vaccinia Virus Construction.
pH-2d-33, which contains the H-2Kd cDNA coding sequence (21), was generously provided by J.-L. Lalanne (Institut Pasteur, Paris). pBCB06, which contains a vaccinia virus promoter, P7.5, has been described (8). Recombinant virus construction was as described (8) using an L929 cell-adapted WR strain of vaccinia virus maintained in this laboratory. A TK- vaccinia virus WR strain was provided by B. Moss (National Institutes of Health, Bethesda, MD). Mice. CBA/H (H-2k), BALB/c (H-2d), and C3H.OH (H2KdDk) specific pathogen-free mice were bred at the John Curtin School of Medical Research, Australian National University. In Vitro Generation of Cytotoxic T Cells and Cytotoxic Assays. Generation of cytotoxic T cells in vitro and assays for cytotoxicity were carried out as described (22, 23).
ed.
The ability of vaccinia virus to act as a live viral vector for expression of foreign genes (1-3), particularly those of unrelated viruses (4-8), has been demonstrated. In addition, parasite antigens (9) and bacterial enzymes (3) have been expressed from vaccinia virus recombinants. A human factor IX cDNA clone has been inserted into vaccinia virus (10), and active factor IX, which requires extensive posttranslational modification, was produced in cells infected with the recombinant virus. Here we report the construction of a vaccinia virus recombinant containing a cDNA copy of the coding sequence of the murine class I major histocompatibility complex antigen H-2Kd. Recombinant vaccinia viruses expressing single viral antigens have not been shown to stimulate primary cell-mediated immune responses to the inserted viral antigen either in vivo or in vitro (11, 12). Most viruses stimulate a relatively weak primary cytotoxic T-cell response in vivo and in vitro (13), whereas class I antigens can stimulate a strong response by unprimed allogeneic T cells in vitro in mixed lymphocyte reactions and in vivo (14). Secondary anti-viral cytotoxic T-cell responses in vitro are roughly comparable in potency to primary mixed lymphocyte reactions, as indicated by similar frequencies of precursors of cytotoxic T cells in lymphoid tissues (15-19). The vaccinia H-2Kd recombinant virus has been used to express H-2Kd on the surface of infected cells, to examine the ability of that H-2Kd to stimulate a primary cytotoxic T-cell response, and to act as a target for recognition by alloreactive and H-2Kd_ restricted vaccinia virus-specific cytotoxic T cells.
RESULTS AND DISCUSSION Construction of a Recombinant Vaccinia Virus Expressing H-2Kd Antigen. The H-2Kd cDNA coding sequence from pH-2d-33 (21) was subcloned into pUC8 with the addition of an oligonucleotide adaptor at the 5' end of the coding sequence as shown in Fig. 1. Further subcloning into the plasmid vector pBCB06 (8) resulted in a recombinant plasmid with the H-2Kd coding sequence immediately downstream from a vaccinia virus promoter, P7.5. The recombinant plasmid pBCB06-H2 was used to transfect 143B cells (TK-) infected with vaccinia virus WR strain. Homologous recombination between vaccinia virus flanking sequences in the plasmid and the thymidine kinase (TK) gene of the infecting virus resulted in a TK- recombinant virus (VV-H2Kd-6) with the chimeric promoter H-2Kd sequence interrupting the vaccinia virus TK gene. Recombinants were selected in the presence of BrdUrd. The genome of VV-H2Kd-6 was shown to be in the appropriate configuration by restriction analysis with HindIIl and EcoRI and Southern blotting, in comparison with vaccinia virus WR DNA (data not shown). Expression of H-2Kd protein on the surface of L929 cells infected with VV-H2Kd-6 was demonstrated by indirect immunofluorescence with a monoclonal antibody against H-2Kd, 34-1-2S (24), and fluorescein isothiocyanate (FITC)-labeled goat anti-mouse antibody (data not shown). Uninfected or vaccinia virus-infected L929 cells did not bind labeled antibody. The protein expressed was shown to be the appropriate size (44 kDa) by immunoprecipitation and NaDodSO4/polyacrylamide gel electrophoresis (data not shown). Generation of a Primary Cytotoxic T-Cell Response by Infection of Mice with VV-H2Kd-6. The ability of H-2Kd
The publication costs of this article were defrayed in part by page charge
payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
7879
7880
Immunology: Coupar et al.
Proc. Natl. Acad. Sci. USA 83 (1986) BstXI ,
Tth11I 11 H
|
pH-2d-33
H-2Kd
BstXI Tth1111 adaptor
I
GATCCAGIATG GCA CCG TAC CGT GGC
GTQACGC
---
DNA
TGA
-ACT
pol.1
AGACAGCTGCCTGGAGTGGACTTGGTGACAGAC
TCTGACGACGGACCTCACCTGAACCACTGTCTGTT
pUC8
BamHI Smal
pUC-H2 pBCB06
pBCB06-H2 BamHI\ EcoRI
FIG. 1. Construction of a recombinant plasmid for insertion of H-2Kd cDNA into the thymidine kinase gene of vaccinia virus. A partial restriction enzyme map of the cDNA insert in pH-2d-33 (21) is shown with the open reading frame coding for H-2Kd indicated by an open box. The translational initiation codon is indicated by a bar above the DNA sequence. An oligonucleotide adaptor was ligated to the 5' end of the excised DNA while the 3' end was repaired using DNA polymerase I Klenow fragment. pBCB06, which contains a vaccinia virus promoter, P7.5 (hatched), and a multiple cloning site (MCS) has been described (8). E, EcoRJ; P, Pst I; H, HindIII; B, BamHI.
expressed from VV-H2Kd-6 to be recognized by T cells was assayed by the generation of H-2Kd-specific cytotoxic T cells in a combined in vivo and in vitro regimen. CBA/H (H-2k) mice were infected with VV-H2Kd-6 or a control vaccinia virus (VV-WR-TK-), and after 5 days their spleens were removed. Activated cytotoxic T cells were cultured for 3 days more in the presence of interleukin 2 but without further antigenic stimulation. The ability of these cells to lyse
macrophage targets was tested, and the results are shown in Table 1. Target cells carrying the H-2Kd antigen (C3H.OH) were lysed, while those with H-2k (CBA/H) were not. Cytotoxic T cells generated by infection with vaccinia virus WR-TK- (or WR, data not shown) failed significantly to lyse either type of macrophage target. In a separate experiment cytotoxic T cells generated in a similar manner by infection of CBA/H (H-2k) mice with VV-H2Kd-6 were capable of
Table 1. H-2Kd-reactive cytotoxic T-cell activity generated by infection of CBA/H (H-2k) mice with VV-H2Kd-6 Yield % of Cells per from culture % lysis of macrophages Virus Mouse culture* spleen, no. C3H.OH (Kd, Dk) assayedt CBA (Kk, Dk) E/T 1 5.3 x 107 VV-H2Kd-6 31% 6 49:1 31 2 2 16:1 9 0 2 6.0 x 107 31% 6 56:1 36 0 2 19:1 12 0 29% 3 5.75 x 107 6 50:1 33 4 2 17:1 7 3 4 6.3 x 107 34% 6 64:1 48 3 2 21:1 13 0 VV-WR-TK1 4.6 x 107 60% 6 83:1 2 0 2 28:1 0 0 2 5.3 x 107 30% 6 48:1 0 0 2 16:1 0 0 3 3.6 x 107 76% 6 82:1 0 0 2 27:1 3 0 4 3.4 x 107 31% 6 32:1 16 5 2 11:1 2 3 Female CBA/H mice 7-8 wk old were infected i.v. with 5 x 107 plaque-forming units of virus. After 5 days, spleens were removed, and viable cells were counted. *Cells from each spleen (107 cells) were cultured at 370C for 3 days at 5 x 105 cells per ml in Eagle's minimal essential medium (GIBCO) with 10-4 M 2-mercaptoethanol, 10%6 (vol/vol) fetal calf serum and 0.2% supernatant from Con A-stimulated mouse splenocytes. The yield of viable cells from each culture was expressed as a percentage of the original viable count at the start of the culture. tAliquots representing 6% and 2% (vol/vol) of the culture were assayed in triplicate for cytotoxicity using 51Cr release from macrophage target cells as described (23), and results were expressed as mean percent specific lysis. SE of the mean were generally
