Improved Agrobacterium tumefaciens-mediated

In Vitro Cellular & Developmental Biology - Plant https://doi.org/10.1007/s11627-018-9944-8

PLANT TISSUE CULTURE

Improved Agrobacterium tumefaciens-mediated transformation of soybean [Glycine max (L.) Merr.] following optimization of culture conditions and mechanical techniques Alkesh Hada 1,2 & Veda Krishnan 1 & M. S. Mohamed Jaabir 2 & Archana Kumari 3 & Monica Jolly 1 & Shelly Praveen 1 & Archana Sachdev 1 Received: 22 August 2017 / Accepted: 26 September 2018 / Editor: John Finer # The Society for In Vitro Biology 2018

Abstract In the present study, Agrobacterium tumefaciens-mediated transformation of Glycine max (L.) Merr. (soybean) cv. DS-9712 using half-seed explants was optimized for eight different parameters, including seed imbibition, medium pH, infection mode (sonication and vacuum infiltration), co-cultivation conditions, concentrations of supplementary compounds, and selection. Using this improved protocol, maximum transformation of 14% and regeneration efficiencies of 45% were achieved by using explants prepared from mature seeds imbibed for 36 h, infected with A. tumefaciens strain EHA105 at an optical density (OD600) of 0.8, suspended in pH 5.4 medium containing 0.2 mM acetosyringone and 450 mg L−1 L-cysteine, followed by sonication for 10 s, vacuum infiltration for 2 min, and co-cultivated for 3 d on 35 mg L−1 kanamycin-containing medium. Independent transgenic lines were confirmed to be transgenic after ß-glucuronidase histochemical assays, polymerase chain reaction, and southern hybridization analysis. The protocol developed in the present study showed high regeneration efficiency within a relatively short time of 76 d. This rapid and efficient protocol might overcome some hurdles associated with the genetic manipulation of soybean. Keywords Agrobacterium tumefaciens . Half-seed explants . Soybean transformation . Regeneration

Introduction Glycine max (L.) Merr. (soybean) is widely used as an important source of protein, oil, and meal for both human and animal consumption, as well as for other industrial uses; there-

Alkesh Hada and Veda Krishnan contributed equally to this research. Electronic supplementary material The online version of this article (https://doi.org/10.1007/s11627-018-9944-8) contains supplementary material, which is available to authorized users. * Archana Sachdev [email protected] 1

Division of Biochemistry, Indian Agricultural Research Institute, New Delhi 110012, India

2

Department of Biotechnology, National College (Autonomous), Tiruchirappalli, Tamil Nadu 620001, India

3

Division of Pathology, Indian Agricultural Research Institute, New Delhi 110012, India

fore, genetic improvement of soybean is a worldwide goal. Significant efforts to add desired traits into elite cultivars have been expended to improve the quality of cultivated soybean varieties by conventional breeding, as well as through biotechnological approaches. Using comparative genomics, information flow about this legume has accelerated exponentially with the discovery of genes responsible for biotic/abiotic resistance and enhanced nutritional value; thus, making soybean serve as a Bmodel plant for functional genomics in legumes,^ in addition to being of great economic relevance. However, the acute obstacle, even after two decades of concentrated effort, lies in the lack of robust transformation and regeneration protocols for large-scale production of elite transgenic cultivars. To realize the potential of biotechnology in developing stable soybean transgenics having novel desirable traits and to study the transgene regulation, efficient methods of gene transfer are required; these include particle bombardment, microinjection, electroporation, direct DNA uptake, and Agrobacterium-mediated transformation. Among these, particle bombardment and Agrobacterium-mediated transformation procedures have been

HADA ET AL.

widely used with relatively good success in soybean (Hinchee et al. 1988; Mccabe et al. 1988). Particle bombardment may be most suitable for the species and genotypes that are less conducive to Agrobacterium infection (Wang and Huang 2002). Especially over the past decade, transgenic soybean plants have been obtained using Agrobacterium-mediated transformation due to its ease, cost effectiveness, high reproducibility, and preferential integration of the transgenes into the plant genome in transcriptionally active regions. Despite various efforts made to improve transformation efficiency using Agrobacterium infection, generally, success has been very low, due to genotype dependency in terms of susceptibility to infection, as well as reduced regeneration of transformants (Liu et al. 2004; Kumari et al. 2016). Moreover, soybean transformation demands considerable technical skill, optimal medium composition, and stringent infection conditions to achieve an improved response with increased transformation efficiency (Zhang et al. 1999). Although the roles of various factors affecting infection and regeneration frequency have been explored in soybean, it still remains less amenable to genetic modifications, because the components have been explored individually, which limit their applicability. A critical point in developing an efficient transformation protocol focuses on the identification of the right combination of factors that act in concert during transformation. A recent study on optimizing various parameters of Agrobacterium-mediated transformation by Li et al. (2017) reported a maximum of 10% transformation efficiency; still too low to meet the existing demand for stable transgenics for high through-put analysis. Hence, it is high time to study the role of various parameters to overcome the constraints to the improvement of soybean transformation. As the overall transformation efficiency is greatly dependent upon the explant, a starting tissue should be easy to produce, available in large quantities year-round, and highly transformable. Over the years, many tissue types, such as immature embryos, cotyledonary nodes, axillary buds, primary leaf nodes, epicotyls, hypocotyls, and stem tips, have been used as explants for soybean transformation (Hinchee et al. 1988; Kim et al. 1990; Sato et al. 1993; Liu et al. 2004; Zhong and Que 2009). Among these, comparatively higher transformation and regeneration efficiency have been reported for cotyledonary nodes, but genotype dependency remains the main constraint (Liu et al. 2004; Kumari et al. 2016). Paz et al. (2006) showed an improvement in transformation efficiency of 1.5 times when Bmature imbibed seeds or halfseeds^ were used. Later studies indicated that in addition to the type of explant, the mode of infection is a critical bottleneck in soybean transformation. To increase the success of Agrobacterium infection, various mechanical wounding techniques, such as multi-needle puncture (Xue et al. 2006), sonication (Trick and Finer 1997), and vacuum infiltration (Bechtold and Pelletier 1995; Hardegger and Sturm 1998; Acereto-Escoffie et al. 2005; Canche-Moo

et al. 2006; Gupta et al. 2006; Tague and Mantis 2006; Shrawat et al. 2007), were incorporated into genetic transformation protocols of various crops. Across the tissue, sonication creates micro-wounds by cavitation and, when combined with vacuum infiltration, it facilitates the efficient entry of bacterial cells into the explants. To improve the plant genetic transformation, sonication and vacuum infiltration have been successfully used in a number of economically important crops, such as Raphanus raphanistrum subsp. sativus (L.) Domin. (radish; Park et al. 2005), Vigna unguiculata (L.) Walp. (cowpea; Bakshi et al. 2011), Musa spp. (banana; Subramanyam et al. 2011), Lens culinaris Medik. (lentil; Chopra and Saini 2012), Saccharum officinarum L. (sugarcane; Mayavan et al. 2013) and G. max L. (soybean; Arun et al. 2014). The optimal concentration of bacteria is a crucial parameter affecting the transformation efficiency (Paz et al. 2006). The highest levels of β-glucuronidase (GUS) expression in protocorm-like bodies of Vanda sp. Orchids were observed at an optical density (OD600) of 0.8 (Gnasekaran et al. 2014), while in Arachis hypogaea L. (peanut), the most suitable concentration for infection was at an OD600 of 1.8 (Tiwari et al. 2015). A similar observation was made in Boehmeria nivea (L.) Gaudich. (ramie), when an OD600 of 0.6 was used (An et al. 2014). While wounding greatly aids the entry of bacteria into the plant tissue, the ensuing enzymatic browning of explant tissues creates another problem, as it negatively affects the regeneration frequency. Amending the co-cultivation medium (CCM) with thiol compounds, such as L-cysteine, has been reported to result in delayed tissue browning through the action of the carbon-bonded sulfhydryl group (Olhoft and Somers 2001). Cysteine, a known inhibitor of polyphenol oxidases (PPOs) and peroxidases (PODs), directly or indirectly delaying enzymatic browning (Mayer and Harel 1979; Richard-Forget et al. 1992; Negishi and Ozawa 2000), which in turn improves the observed transformation efficiency by reducing the wound-pathogen defense responses in sugarcane (Enríquez-Obregón et al. 1998). The role of various antioxidants, for example, dithiothreitol (DTT), glutathione, α-tocopherol, selenite, and ascorbic acid, in mitigating the browning issue has also been reported (Dan 2008). Another pivotal factor is determining the optimum concentration of acetosyringone (AS) supplementation during co-cultivation, which induces the vir genes, resulting in improved transformation efficiency (Kumar et al. 2006; Mohiuddin et al. 2011). Di et al. (1996) deciphered the synergistic role of AS and acidic pH (5.2) in improving the transformation efficiency. However, Hiei et al. (1994) found the contrary, that higher co-cultivation pH increased the efficiency of Oryza sativa L. (rice) transformation. Furthermore, the utilization of tissue culture regimes with the most favorable concentration of selection agent is vital (Bowen 1993). Thus, a series of selectable marker genes, such

SOYBEAN TRANSFORMATION VIA AGROBACTERIUM TUMEFACIENS

as hygromycin phosphotransferase (hptII), neomycin phosphotransferase (nptII), phosphinothricin acetyl transferase (bar), and 5-enolpyruvylshikimate-3-phosphate synthase (epsps) in combination with selection agents hygromycin (Olhoft et al. 2003), kanamycin (Hinchee et al. 1988), glufosinate (Zhang et al. 1999), and glyphosate (Clemente et al. 2000), respectively, have been employed. The overall transformation efficiency depends on the effectiveness of Agrobacterium infection, as well as regeneration success. Induction and elongation of infected explants represent further limiting factors, and better regeneration with fewer selection escapes have been observed when a delay in selection pressure is combined with increased physical contact of explant with the medium (Hada et al. 2016). Supplementing the medium with a cocktail of hormones, such as auxin, kinetin, and gibberellic acid (GA3), has also been shown to improve the regeneration efficiency (Sahoo et al. 2011). Even though significant improvements in soybean transformation have been reported to date, the need remains for further enhancement of transformation efficiency, achieved by refining the available transformation protocols, to meet the increasing demand for genetically modified soybean. The majority of the published protocols to date suffer from various constraints, as among them, low transformation efficiency, low frequency of regeneration, and non-availability of explants throughout the year. Therefore, the main objective of the present study was to establish an efficient Agrobacteriummediated transformation system for soybean, by optimizing eight different parameters of culture conditions in combination with sonication and vacuum infiltration. Different parameters were optimized individually and later combined for this comprehensive protocol to attain maximum transformation Fig. 1 Flow diagram of the Glycine max (L.) Merr. (soybean) half-seed Agrobacterium tumefaciens-mediated transformation process. Experimental variables of culture conditions, mechanical wounding, and selection examined for synergistic effect are provided left and right of the flow chart. The time for fulfilling the essential steps followed in the optimized protocol is given in parentheses

efficiency, which might overcome major hurdles in the genetic manipulation of soybean traits.

Materials and methods Experimental design and parameters The effects of explant type, Agrobacterium tumefaciens concentration, mode of tissue wounding and infiltration, co-cultivation time, pH, medium supplements, and selection regime affecting transformation efficiency were investigated individually. Infection of explants was performed in batches of ~ 70 explants per 50 mL of A. tumefaciens suspension for all the parameters per treatments. For standardization of factors, parameters, and various treatments influencing transient GUS expression in the explants, 50 healthy imbibed half-seeds were infected for each parameter per treatments and the experiments were repeated three times. Out of 50 half-seed explants, 30 were randomly selected from each replicate and assayed for transient GUS activity after (i) 1, 2, 3, 4, and 5 d of co- cultivation for optimization of co-cultivation time and (ii) 3 d of co-cultivation (optimized time period) for other parameters per treatments. Percentage of explants showing GUS expression was determined as the number of half-seeds showing GUS expression (blue spot or coloration) divided by the total number of half-seed explants assayed for GUS expression × 100. Individual parameters were combined with one parameter kept constant and the other factor varied per treatments. The general process is outlined in Fig. 1. To identify the optimum time for seed imbibition, durations of 0, 4, 8, 12, 16, 20, 24, 28, 32, 36, and 40 h were tested. To determine the best concentration for the A. tumefaciens

HADA ET AL.

inoculum, the OD of 0.5, 0.6, 0.8, 1.0, 1.2, and 1.5 at an absorbance of 600 nm was tested. To further accelerate the process of infection, the inoculated half-seed explants were sonicated for 0, 5, 10, 15, or 20 s, followed by vacuum infiltration of 0, 1, 2, 3, 4, or 5 min. The infected explants were then co-cultivated for 1, 2, 3, 4, or 5 d on solid co-culture medium (CCM-S, described below) supplemented with 0.0, 0.1, 0.2, 0.3, or 0.4 mM acetosyringone (AS) and 100, 200, 300, 400, 450, 500, 600, 700, or 800 mg L−1 L-cysteine (L-cys). To determine the optimum pH, infected explants were cocultivated in medium at pH 5.0, 5.2, 5.4, 5.8, 6.0, or 6.2. To determine the minimum inhibitory concentration (MIC) of the selection agent adequate for the selection of transformants with the fewest escapes, 0, 10, 20, 25, 30, 35, 40, 45, or 50 mg L−1 kanamycin was tested in the shoot initiation medium (SIM). Mentioned chemicals were obtained from SigmaAldrich®, St. Louis, MO. To examine the influence of each factor on transformation efficiency, each experiment was repeated three times and the data were analyzed using one-way analysis of variance (ANOVA). Transformation efficiency (%) was determined as: (number of PCR-positive plants ÷ number of infected explants) × 100. Data were represented as means ± standard error, and Duncan’s multiple range test (DMRT) was carried out for mean separations and the significance was determined at the 5% level. The segregation analysis of T1 generation was conducted by chi-square analysis. Fig. 2 Depiction of transformation, selection, and regeneration of half-seed explants of Glycine max (L.) Merr. (soybean) cv. DS-9712 infected with Agrobacterium tumefaciens strain EHA105 harboring pBIAH. (a) Seeds after 36-h imbibition. (b) Half-seed explants. (c) Infected explants on co-cultivation medium. (d) Shoot bud induction on shoot initiation medium. (e) 30 mg L−1 kanamycin selection of regenerated shoots on shoot elongation medium (SEM). (f) Elongated shoot on SEM amended with 35 mg L−1 kanamycin. (g) Rooted shoot on rooting medium containing 35 mg L−1 kanamycin. (h) Putative transformed plantlets in growth chamber. (i) Fertile vputatively transformed soybean plants grown in greenhouse

Plant material and explant preparation Mature soybean seeds of cultivar DS-9712, obtained from Division of Genetics, Indian Agricultural Research Institute, New Delhi, India, were utilized for A. tumefaciens-mediated transformation in the present study. Mature DS-9712 seeds were surface sterilized for 12 h with chlorine gas in a tightly sealed chamber according to the procedure of Hada et al. (2016). Disinfected seeds were soaked in 150-mL Erlenmeyer flask (BOROSIL®, Mumbai, India) containing 50 mL of sterile distilled water (25 seeds per flask) for 0, 4, 8, 12, 16, 20, 24, 28, 32, 36, or 40 h to establish the optimum duration for imbibition (Fig. 2a). After imbibition, seeds were transferred to sterile Petri-plates (100 mm × 15 mm; BOROSIL®) for dissection and the seed coat was removed under aseptic conditions. To obtain the halfseed explant, the hypocotyl and the cotyledon were transected at the embryonic axis. A half-seed with cotyledon, plumule, and radicle was used for the transformation (Fig. 2b). For imbibition length studies, the half-seeds were placed on SIM (described below) with 35 mg L−1 kanamycin and evaluated for survival. For transformation, the plumules were slightly wound at the surface of cotyledonary nodal regions and the edge of the radicles were cut at the bottom end with a number 11 Personna Plus® surgeons’ blade (HI-Media®, Mumbai, India) in order to improve infection. After the half-seed explants were prepared, they were pricked gently ~ 5 times randomly, at the axillary and apical

SOYBEAN TRANSFORMATION VIA AGROBACTERIUM TUMEFACIENS

meristematic areas using a sterile hypodermic needle (27G1/1) (Dispovan, New Delhi, India), before immersion in liquid CCM (CCM-L; described below) for Agrobacterium-mediated transformation. Approximately 100 explants were infected with A. tumefaciens for each treatment in the preliminary experiment for parameter optimization. The standardize parameters from the preliminary experiments were then combined into a single experiment where seven groups of 69 to 75 healthy and viable imbibed seeds were chosen for A. tumefaciens infection for further improvement in transformation efficiency. Ten half-seed explants were cultured per plate. Non-transformed controls (NTC) soybean explants were not inoculated with A. tumefaciens.

5000×g for 10 min at 28°C in Eppendorf® Centrifuge 5810 R (Eppendorf Corp.). The harvested cells were washed and resuspended aseptically in liquid infection medium [CCM-L: 1/10× B5 basal medium (Gamborg et al. 1968), 0.3% (w/v) sucrose, 1.67 mg L−1 6-benzylaminopurine (BAP), 0.2 mM AS, 450 mg L−1 L-cys, at pH 5.4, adjusted with 1 N NaOH before autoclaving)] for 1 h prior to infection. Medium was sterilized for 20 min, at 121°C and 0.1 MPa (SMS, Warszawa, Poland). The supplementary components (AS and L-cys) were added after medium autoclaving and the growth regulators were added before autoclaving. Unless noted otherwise, all mentioned chemicals were obtained from Sigma-Aldrich®.

Agrobacterium tumefaciens strain and binary vector and preparation of culture

Agrobacterium tumefaciens infection The half-seed explants were suspended in the A. tumefacienscontaining infection medium with occasional shaking for 30 min to facilitate infection. For accelerating the process of infection, the inoculated half-seed explants were sonicated for 0, 5, 10, 15, or 20 s using a water bath sonicator having a capacity of 1.9 L with a power setting of 300 W and frequency of 40 kHz (Bransonic® Ultrasonic Cleaner Branson 1510, Kanagawa, Japan), followed by vacuum infiltration (− 33 kPa) for 0, 1, 2, 3, 4, or 5 min using a desiccators (Tarsons®, Kolkata, India) connected to a vacuum pump (Indian High Vacuum Pumps, Bangalore, India). Then, the liquid infection medium was removed, and the infected explants were dried on sterile filter paper. After drying, the infected explants were placed adaxial side down on to autoclaved solid co-cultivation medium (CCM-S: CCM-L solidified with 0.6% (w/v) plant tissue culture (PTC) agar (HI-Media®)) and incubated at 26 ± 2°C for 1–5 d in the dark (Fig. 2c).

The A. tumefaciens strain EHA105, carrying the binary plasmid pBI-AH, was utilized for transformation. A. tumefaciens EHA105 has aC58 chromosomal background and L,Lsuccinamopine-containing pEHA105 as a virulence helper plasmid (Hood et al. 1993). In the binary vector, the transferred DNA (T-DNA) region contained the cauliflower mosaic virus (CaMV) 35S promoter-driven neomycin phosphotransferase (nptII), and β-glucuronidase (gus) genes, as plant selection and reporter markers, respectively (Fig. 3). The A. tumefaciens strain was maintained on agar-solidified Luria-Bertani (LB) medium (HI-Media®; Sambrook et al. 1989), supplemented with 30 mg L−1 rifampicin (SigmaAldrich®) and 50 mg L−1 kanamycin (Sigma-Aldrich®). To prepare the A. tumefaciens infection culture, a single colony of EHA105/pBI-AH was inoculated into 10-mL LB liquid medium (Sambrook et al. 1989) containing 30 mg L−1 rifampicin and 50 mg L−1 kanamycin and incubated at 28°C for 24 h on a New Brunswick™ Innova® 42orbital shaker, (Eppendorf Corp., Hauppauge, NY) at 200 rpm; this established a logarithmic growth-stage starter culture. One day before explant inoculation, 0.2 mL of A. tumefaciens starter culture was transferred to 200-mL Erlenmeyer flask containing 50 mL LB liquid medium, supplemented with 30 mg L−1 rifampicin and 50 mg L−1 kanamycin, grown at 28°C (200 rpm) in a New Brunswick™ Innova® 42 orbital shaker until the OD600 reached 0.8 (approximately 4 × 108 cells mL−1). The bacterial cells were harvested at

The co-cultivated explants were rinsed in liquid shoot initiation medium (SIM-L:B5 basal medium (Gamborg et al. 1968), 3% (w/v) sucrose, 1.2 mg L−1 BAP, 0.2 mg L−1 indole-3-butyric acid (IBA) (Sigma-Aldrich®), at pH 5.7), supplemented with 75 mg L−1 augmentin (GlaxoSmithKline, Brentford, UK), 100 mg L −1 carbenicillin (TOKU-E, Bellingham, WA), and 250 mg L−1 cefotaxime (ALKEM,

Fig. 3 Schematic linear map of the plasmid vector pBI-AH present within the Agrobacterium tumefaciens strain EHA105 that was used for the transformation experiments. The transfer DNA region of pBI-AH shows the assembly of the nopaline synthase (nos) promoter-driven neomycin

phosphotransferase II (nptII) and the cauliflower mosaic virus 35S (CaMV35S) promoter-driven ß-glucuronidase (gus) gene expression cassettes. LB = left border; nos ter = nopaline synthase poly-A terminator; RB = right border

Plant regeneration and selection

HADA ET AL.

Mumbai, India), before culturing on solid shoot initiation medium (SIM I or II; consisting of SIM-L solidified with 0.7% (w/v) PTC agar, containing 25 mg L−1 kanamycin for SIM II). Shoot initiation was carried out at 26 ± 2°C with a 16-h photo period at 50 μmol m−2 s−1 provided by cool-white fluorescent lamps (Daihan Labtech®, New Delhi, India) (Fig. 2d). Shoot initiation occurred in two stages, an initial nonselective step in SIM I for 10 d, followed by kanamycin selection on SIM II. Regeneration efficiency (%) was calculated as: (number of kanamycin-resistant shoots ÷ number of infected explants) × 100. After 10–12 d on SIM II, explants were transferred to shoot elongation medium (SEM) containing MS basal medium (Murashige and Skoog 1962), 3% (w/v) sucrose, 0.75 mg L−1 GA3 (Sigma-Aldrich®), 0.8% (w/v) PTC agar, 75 mg L−1 augmentin, 100 mg L−1 carbenicillin, 250 mg L−1 cefotaxime, and 30 mg L−1 kanamycin at pH 5.7], for 12–14 d (Fig. 2e), and subsequently sub-cultured in SEM containing 35 mg L−1 kanamycin (Fig. 2f), until elongation occurred. Individual shoots were further transferred to rooting medium (RM: half-strength MS basal medium, 2% (w/v) sucrose, 2.0 mg L−1 IBA, 0.6% (w/v) PTC agar, 75 mg L−1 augmentin, 100 mg L−1 carbenicillin, 250 mg L−1 cefotaxime at pH 5.8). After 15–20 d on RM (Fig. 2g), plantlets were transplanted into 4-in. diameter (dm) pots containing sterile fertile loamy soil from a soybean field of IARI (New Delhi, India), vermiculite, and sand in a 2:1:1 ratio (Fig. 2h). The pots were maintained in a growth chamber for acclimatization under 16-h photoperiod at 26 ± 2°C, with light intensity of ~ 500 μmol m−2 s−1, 80–90% relative humidity, for 30 d. Subsequently, healthy growing plants were transferred to larger pots (15.24 cm dm) containing the 2:1:1 mixture of soil, vermiculite, as well as sand, and shifted to a greenhouse for complete acclimatization and maturation (Fig. 2i).

Molecular analysis of putative transformants Isolation of genomic (gDNA) was carried out following the cetyltrimethylammonium bromide (CTAB) method from leaves of putative transformants and NTC plants, according to Doyle and Doyle (1987). Subsequent polymerase chain reaction (PCR) analysis was performed using the gene-specific nptII forward primer (FP) 5′ AGTGGTGTTGCTGTTTCCACC 3′ with the nptII reverse primer (RP) 5′ TCGAGTAAGTCGTCGGAGAG C 3′. Polymerase chain reaction mixture contained 100 ng of gDNA, 10 mM primers in Tris(hydroxymethyl)aminomethaneHCl (pH 8.8), 1.5 mM MgCl2, 1% (v/v) Triton™ X-100, 50 mM KCl, 0.1 mM dNTPs, and 1 U of Taq DNA polymerase (Fermentas, Waltham, MA) for a single reaction volume of 25 μL. The PCR was carried out with denaturation of DNA at 95°C for 4 min, followed by 35 cycles of 94°C for 1 min, 59°C for 1 min, and 72°C for 1 min, then a final extension of 10 min at 72°C. The products of PCR were electrophoresed on 1.0% (w/v) agarose gel (Sigma-Aldrich®) and detected by staining with GelRed® (Biotium, Fremont, CA). Southern hybridization was carried out to determine the integration and copy number of the nptII gene in PCR-positive plants. Genomic DNA (~ 10 μg) and plasmid pBI-AH (~ 5 μg) were digested with restriction enzyme EcoRI from PCRpositive and NTC plants, then size-fractionated by electrophoresis on 0.8% (w/v) agarose gels and subsequently transferred onto a nylon membrane (Biodyne™ Hybond™ N+; Amersham Pharmacia Biotech, Buckinghamshire, UK). The α32P-labeled deoxycytidine triphosphate (dCTP) nptII gene sequence, present in the vector pBI-AH, was used as a probe for hybridization and a random primer DNA labeling kit was used for radio-labeling, according to the manufacturer’s instructions (Amersham Pharmacia Biotech®). Hybridization, washing, and detection were executed according to Sambrook and Russell (2001).

Beta-glucuronidase (GUS) assay Segregation analysis Expression of GUS was assayed in the half-seeds, germinating T0 seeds, leaves, stems, and pods, using the substrate 5-bromo-4chloro-3-indolyl ß-glucuronide (X-Gluc) (Sigma-Aldrich®) described by Jefferson et al. (1987). Plant tissues were first incubated in phosphate buffer (pH 6.7) containing 1% (v/v) Triton™ X-100 at 37°C for 1 h. The buffer was then removed and fresh phosphate buffer containing X-Gluc (1.0 mM) and methanol (Merck®, Darmstadt, Germany) [20% (v/v)] was added. A − 33 kPa vacuum was applied to the putative transformants immersed in X-Gluc for 5 min for vacuum infiltration, before the reaction mixture was kept at 37°C for 8 h. To remove the chlorophyll pigment, the plant tissues were washed with 80% (v/v) methanol for 2 h. The tissues of positive transformants showed blue coloration. Percentage of explants showing GUS expression was determined as: (number of GUS-positively stained plants ÷ total number of infected explants) × 100.

To determine the stability and the segregation pattern of the transgene, progenies of T0 transformed plants were germinated on MS medium containing 150 mg L−1 kanamycin for 24 d. The seedlings that remained green and healthy were considered as resistant and containing the transgene, while non-germinated and weak seedlings were deemed sensitive and non-transformed. From each transgenic line (T1), the kanamycin-resistant plants were transferred to soil mixture in greenhouse conditions and further analyzed by PCR as above, to check for the presence of the transgene in the progeny. The standard error and chi-square analysis test was conducted to determine the segregation ratios, according to standard statistical procedures described in Gomez and Gomez (1984), where significance was determined for those values with a P value less than 0.05.

SOYBEAN TRANSFORMATION VIA AGROBACTERIUM TUMEFACIENS

half-seed explants from 36 h of imbibition were considered to be optimal based on a maximum number of seeds that survived on standardized selection medium (Table S1).

Effect of A. tumefaciens concentration on soybean transformation

Fig. 4 Effect of Agrobacterium tumefaciens inoculum concentration on transformation frequency of soybean half-seed explants. Optical density (OD) of bacterial culture was determined at 600 nm. Transformation frequency was determined as percentage of explants with βglucuronidase (gus) expression of total inoculated explants

Results Optimum imbibition duration for soybean transformation The GUS transient expression in the regenerated plant parts reflected the transformation efficiency achieved through A. tumefaciens-mediated transformation of soybean half-seeds explants. In order to see the effect of imbibition durations, halfseeds were imbibed for different time durations from 0 to 40 h and selected on 35 mg L−1 kanamycin after transformation. The Fig. 5 Depiction of histochemical analysis of β-glucuronidase (gus) gene expression (blue) in transformed soybean tissues at different stages of direct organogenesis. (a) Transformed Glycine max (L.) Merr. seed showing GUS expression in blue. (b) non-transformed control soybean seed. Expression of GUS in (c) induced shoots, (d) elongated shoots, and (e) leaves from regenerated transformed soybean half-seeds. (f) Expression of GUS in stem segments of regenerated transformed plants. (g) Nontransformed plant stem segments showing absence of GUS expression. (h) Seed pods from regenerated transformed soybeans showing GUS expression. (i) Non-transformed soybean pod shows absence of any GUS expression

To determine the optimal concentration of A. tumefaciens for infection, 36-h imbibed seeds were inoculated with bacterial cultures at various OD600 ranging from 0.5 to 1.5 (Fig. 4). After complete regeneration, various tissues were stained for GUS expression analysis (Fig. 5). The highest percentage of GUS-positive transformants was obtained at OD600 of 0.8. An increase in optical density above OD600 of 0.8 had a negative effect on the transformation efficiency. Therefore, it was concluded that the optimal concentration of A. tumefaciens for infection was an OD600 of 0.8 (Fig. 4).

Effects of L-cysteine and acetosyringone on soybean transformation After infection, explants were cultured on CCM-S with various concentrations of L-cys, ranging from 100 to 800 mg L−1 (Fig. 6). At a concentration of 450 mg L−1 L-cys, the maximum increase in transformation, in terms of GUS-positive

HADA ET AL. Fig. 6 Effect of L-cysteine medium concentration on transformation frequency of Glycine max (L.) Merr. half-seed explants. Transformation frequency was determined as percentage of explants with βglucuronidase (gus) expression of total inoculated explants

percentage, was observed (45%), which coincided with increased regeneration (Fig 6). To determine the optimum concentration of AS, CCM-L containing from 0 to 0.4 mM AS was used. The results revealed 0.2 mM acetosyringone as the optimum concentration resulting in maximum GUS expression, while lower or higher concentrations were less effective (Fig. 7). Without AS, the transformation frequency (percentage of half-seeds expressing GUS) was below 10% (Fig. 7). A combinational effect using 0.2 mM AS and 450 mg L−1 L-cys resulted in an approximately 1.4-fold increase in the transformation percentage, compared to AS- and L-cys-free medium (Fig. S2).

Effect of medium pH and co-cultivation time on soybean transformation The effect of infection medium pH (5.0–6.2) on half-seed transformation was evaluated. It was interesting to observe that optimum pH directly affected the transformation efficiency and the highest transformation percentage was observed at pH 5.4, at which 38% regenerated shoots showed GUS activity (Fig. 8). The intensity of GUS expression was inversely proportional with the pH studied. On the optimum pH, the maximum

Fig. 7 Effect of acetosyringone concentration in co-cultivation medium on transformation frequency of Glycine max (L.) Merr. half-seeds. Transformation frequency was determined as percentage of explants with β-glucuronidase (gus) expression of total inoculated explants

transformation efficiency was visually supported by GUS expression, while further increase or decrease in pH was observed with decrease the transformation efficiency (low GUS expression). To determine the optimum co-cultivation time, A. tumefaciens -infected explants were subjected to 1–5 d co-cultivation periods, ranging, and the transformation efficiency was determined. Betaglucuronidase expression positively correlated with increased cocultivation duration until 3 d (Table 1). Maximum percentage of GUS-positive explants (27.8%) was observed at 3 d of co-cultivation. A decrease in GUS-positives to 24.5 and 21.8%, respectively, was observed after 4 and 5 d of co-cultivation, while 12.3% was observed at 2 d of co-cultivation (Table 1). Therefore, it was concluded that the optimal pH of infection medium was 5.4 with a maximum co-cultivation period was 3 d.

Effect of sonication and vacuum infiltration of A. tumefaciens infiltration on soybean transformation The modes of infection of half-seed explants investigated were sonication and vacuum infiltration. Among the

Fig. 8 Influence of the co-cultivation medium pH on Glycine max (L.) Merr. half-seed transformation frequency. Transformation frequency was determined as percentage of explants with β-glucuronidase (gus) expression of total inoculated explants

SOYBEAN TRANSFORMATION VIA AGROBACTERIUM TUMEFACIENS Table 1. Effect of co-cultivation, sonication, and vacuum infiltration period on percentage of β-glucuronidase (GUS) expression in half-seed explants of Glycine max (L.) Merr Experiment number

Co-cultivation period (d)

Sonication period (s)

Vacuum infiltration period (min)

Percentage of explants showing GUS expression

1 2 3 4 5 6 7 8 9

1 2 3 4 5 3 3 3 3

– – – – – 5 10 15 20

– – – – – – – – –

4.1 12.3 27.8 24.5 21.8 27.8 36.2 15.5 12.1

± ± ± ± ± ± ± ± ±

0.09n 0.06l 0.02f 0.08h 0.01ij 0.09fg 0.08b 0.06k 0.02m

10 11 12 13 14

3 3 3 3 3

10 10 10 10 10

1 2 3 4 5

33.3 49.2 33.2 28.4 21.9

± ± ± ± ±

0.01c 0.03a 0.04cd 0.01e 0.03i

The results are expressed as the mean ± standard error. Approximately 100 explants were infected by Agrobacterium tumefaciens for each (or combination of) treatment(s) and the experiments were repeated thrice. Thirty-day-old kanamycin-resistant plants were used for analysis. For each treatment, means followed by the same letter were not significantly different at P ≤ 0.05 levels according to Duncan’s Multiple Range Test (DMRT). Percentage of explants showing GUS expression (%) = (The number of GUS-positively stained explants ÷ the number of infected explants) × 100%. Optimum treatment conditions resulting in the highest percent GUS expression are indicated in italics

sonication time intervals tested, 10-s sonication was found to coincide with maximum transformation efficiency (36.2%; Table 1), whereas either shorter or longer sonication times resulted in fewer GUS-positive explants from (27.8–12.1%, respectively; Table 1). At longer sonication exposures (15 and 20 s), shoot induction was also reduced from 36.2 to 12.1%, which contributed to the overall lowered efficiency of soybean transformation (Table 1). For sonication times up to an optimum of 10 s, the number of regenerated shoots increased as along with the percent GUS-positives. Table 2.

After 10-s sonication, the half-seed explants were subjected to vacuum infiltration in A. tumefaciens suspension culture for different lengths of time from 0 to 5 min. When 10-s sonicated explants were exposed to 2-min vacuum infiltration, maximum transient transformation of 49.2% as measured by percent GUS expression was observed (Table 1). Approximately 33% GUS expression was observed when infiltration time was increased or decreased by 1 min from optimum, to 3 or 1 min, respectively (Table 1). Vacuum infiltration times of 4 and 5 min further

Transformation efficiency of half-seed explants of Glycine max (L.) Merr

Experiment number

Number of explants infected

Number of kanamycinresistant shoots

Number of GUS-positive plants

Number of transformed PCR-positive plants

1 2 3 4 5 6 7

75 76 74 70 72 67 69

29 33 36 29 35 33 31

14 10 17 12 14 10 13 10 15 09 13 9 16 13 Mean transformation efficiency

Final transformation efficiencya (%) 13.3 ± 0.005d 15.7 ± 0.003b 13.5 ± 0.006fg 14.2 ± 0.004e 12.5 ± 0.005c 13.0 ± 0.007f 18.8 ± 0.008a 14.51

The results are expressed as a mean ± standard error. A hundred explants were infected by Agrobacterium tumefaciens for each or combined treatment for parameter optimization and the experiments were repeated thrice. Healthy and viable imbibed seeds were finally chosen for A. tumefaciens infection in seven separate groups of 69 to 75 healthy explants. For each treatment, means followed by the same letter are not significantly different at P ≤ 0.05 levels according to Duncan’s Multiple Range Test (DMRT). Transformation efficiency (%) = (number of PCR-positive plants ÷ the number of infected explants) × 100%

HADA ET AL.

30 mg L−1 for regeneration, and 35 mg L−1 for the rooting stage. At higher kanamycin concentrations, explants exhibited severe tissue necrosis and absence of shoot formation, which also revealed the stringency and lethality associated with kanamycin and the need for an optimum concentration of selection agent. At this optimum concentration, an approximately 93% inhibition of the regenerated explants was observed, effectively eliminating false positives and thus improving the transformation efficiency.

Fig. 9 Kill response curve based on the survival rate of explants in selection medium at different concentrations of kanamycin

Physical and molecular analyses of putative transformants

Refined selection in the present protocol was optimized based on preliminary investigations conducted, where explants were inoculated into growth medium containing from 0 to 50 mg L−1 kanamycin. At a dose of 25 mg L−1, kanamycin entirely inhibited the shoot induction and regeneration, and a 35 mg L−1 dose of kanamycin largely arrested elongated shoots and root development (Fig. 9). Therefore, MIC were assigned as 25 mg L−1 kanamycin throughout shooting,

Positive transgenic plants were confirmed by GUS histochemical staining, PCR amplification of nptII gene, and Southern hybridization. The expression of GUS was observed in the seed (Fig 5a), germinating seedlings (Fig. 5c, d), leaf (Fig. 5e), stem (Fig. 5f), and pods (Fig. 5h). It indicated the integration and expression of the gus gene in the soybean genome. On the other hand, no blue coloration was seen upon GUS staining in NTC counter parts, such as seed (Fig. 5b), germinating T0 seedlings, leaf, stem (Fig. 5g), and pods (Fig. 5i). PCR analysis was carried out initially to confirm nptII gene presence in the putative transformed plants. Amplification of nptII gene product was observed in the positive transformants; conversely, no amplification was seen in the NTC plants (Fig. 10). The presence of nptII gene confirmed plant transformation events of kanamycin-resistant shoots with a mean transformation efficiency of 14.5% (Table 2). To confirm transgene integration and copy number in the soybean genome, DNA from PCR-positive plants was subjected to southern hybridization. In the transformed plants, a distinct hybridizing signal was detected, and no signal was observed in NTC (Fig. 11). The binary vector pBI-AH has only a single EcoRI site between the nptII and the gus genes, thus the other

Fig. 10 Polymerase chain reaction amplification of the neomycin phosphotransferase II (nptII) gene from genomic DNA of putatively transformed Glycine max (L.) Merr. (soybean) plants. Lanes = M DNA ladder; +ve C pBI-AH plasmid as positive control; −ve C non-

transformed soybean genomic DNA as negative control; A2–1 to A27–9 genomic DNA from transformed regenerated soybean plants carrying the nptII gene. Arrow indicates 795-bp band corresponding to nptII gene fragment

reduced transformation efficiency. This observed reduction of genetic transformation effectiveness was significant, and due to negatively affected explant survival was reduced from 49.2 to 21.9%. Therefore, sonication for 10 s followed by vacuum infiltration for 2 min in A. tumefaciens suspension culture was found to be the optimal transformation system to attain transformation efficiencies of 12.5 to 18.8% (Table 2). These results suggested that sonication coupled with vacuum infiltration facilitated a considerable improvement in soybean transformation efficiency.

Selection optimization

SOYBEAN TRANSFORMATION VIA AGROBACTERIUM TUMEFACIENS

Fig. 11 Southern hybridization analysis of total genomic DNA from putative transformed Glycine max (L.) Merr. (soybean) plants. Genomic DNA was extracted, digested with EcoRI, and hybridized with α32P-labeled neomycin phosphotransferase II (nptII) probes to produce unique fragments for each integrated transfer DNA representing the transgene. Lanes = +ve C positive control (pBI-AH plasmid); −ve C negative control (non-transformed soybean plant genomic DNA); A2–1 to A27–9 independent transgenic lines

site must have been located in the soybean genome. Therefore, the obtained band on autoradiogram indicated that the transgene integrated independently at low copy-numbers and the transgene loci varied in independent events (Fig. 11).

Discussion In this present comprehensive study, soybean cv. DS-9712 was used as the genotype to optimize various transformation parameters, owing to its popularity in India due to high yields (125 kg ha−1; Kumar et al. 2014) and to major biotic stress resistances, as well as its very high compatibility to in vitro culture (Mariashibu et al. 2013). Although mature cotyledonary nodes are commonly used as explants for Agrobacterium-mediated genetic transformation of soybean, due to their ready availability and good transformation efficiency, other explant tissues have been employed as T-DNA recipients as well. The half-seed explants used in the present study were obtained from mature seeds after imbibition for 36 h, to differentiate them from cot-node tissue resulting from 5- to 6-d-old seedlings. Half-seeds were preferable to other soybean explants (e.g. immature seed meristems or somatic embryogenic tissue) in terms of better availability throughout the year, short seed-to-seed generation, and absence of long-term culture or parental donor plant maintenance. Using half-seed explants, Paz et al. (2006) showed an improvement in the transformation efficiency of soybean that ranged from 1.4 to 8.7%, which is 1.5fold higher than the cotyledonary node method. Additionally, Li et al. (2017) reported half-seed explants from 1-d imbibition as better candidates in terms of tissue

regeneration potential, when compared to the other three types of explants (germination for 1, 3, and 5 d). The half-seed method of plant transformation does not require deliberate manual wounding for efficient transformation and regeneration, in contrast to the cot-node technique, where precise location and extent of wounding of the explants is critical (Hada et al. 2016). Immature seeds, excised from embryonic axes and cotyledons, and wounded using multi-needle prongs or forceps, have also been used for soybean transformation (Yan et al. 2000; Ko et al. 2003). Wroblewski et al. (2005) reported that a few of these wounding treatments improved transient marker gene expression, but this did not imply the enhanced recovery of stable transgenic plants, a finding that has been corroborated in other plant systems. Additionally, the seasonal availability of immature soybean embryos represents further hurdles that the half-seed method successfully circumvents. Imbibition is a natural process that swells and softens seeds and facilitates the entry of A. tumefaciens to effectively interact with and infect the explant cells. In the experiments reported here, shoot induction ability of half-seed explants was analyzed, based on the total number of shoots among all explants (with or without shoots), from which a mean percentage of shoot formation of 45% was calculated. This shoot induction ability of half-seeds compares favorably with the cot-node system, where low regeneration rates are encountered, Li et al. (2017). Along with genotype, the type and age of explants have been noted as pivotal factors affecting both the rate of transformation and regeneration; hence, results can vary from case to case. Another possible reason for low regeneration efficiency in cot-node explants might be due to the formation of secondary shoots at the wound site (Townsend and Thomas 1993; Meurer et al. 1998). Poor transformation efficiency is directly correlated with bacterial concentration; if it is too low, the infection rate will be insufficient to introduce T-DNA (along with the desired genes) into the plant cells, and if too high, it is difficult to control bacterial overgrowth, resulting in explant necrosis. Additionally, Ko and Korban (2004) as well as Ismael and Antar (2014) have reported that the T-DNA delivery depends upon bacterial culture density and co-cultivation period: to get high numbers of transformants, 1-h infection with bacteria culture (OD600 = 1.0) of soybean tissue was found necessary; and while a shorter period (30 min) or lowering the OD to 0.8 increased the survival of explants, it decreased GUS expression. For Zea mays L. (maize), co-cultivation with A. tumefaciens abruptly lead to cell death and widespread necrosis of explant tissues (Hansen 2000). Leaf-discs of Vitis vinifera L. (grape) exhibited high proportions of tissue necrosis when cocultivated with a higher density of A. tumefaciens for longer infection duration (Das et al. 2002; Kuta and Tripathi 2005). These findings confirmed the previous observations by Kumria et al. (2001), which showed prolonged infection time and high density of bacterial culture during Agrobacterium-mediated

HADA ET AL.

transformation negatively affected the shoot regeneration of Indica rice (O. sativa L.) callus. Likewise, Chakrabarty et al. (2002) have used the undiluted culture of A. tumefaciens (OD600 = 0.5) for hypocotyl explants of Brassica oleracea L. (cauliflower), which resulted in severe tissue necrosis, compared to using diluted bacterial culture. It has been an underlying fact that the necrosis and cell death due to high density of A. tumefaciens have considerably influenced the efficiency of plant transformation. Necrosis and cell death of the tissue might occur after T-DNA transfer has taken place, and the newly transformed cells embedded in such tissues are lost, thus decreasing the recovery of transformed clones (Potrykus 1990). Furthermore, antimicrobial substances accumulate in necrotic tissues, which potentially reduce the ability of A. tumefaciens to colonize plant cells and subsequent T-DNA transfer (Goodman and Novacky 1994). Increased infection efficiency is necessary for improving the soybean transformation efficiency, thus co-cultivation mode and time are vital parameters. In the current report, maximum transformation efficiency was observed at 3 d of co-cultivation and the noted decrease in the transformation efficiency with increased co-cultivation duration might be due to bacterial over growth. The present finding agreed with reports by Di et al. (1996) and Trick and Finer (1997), where maximum transformation efficiency was achieved after co-cultivating for 3 d. Ko and Korban (2004) have reported that cocultivation time of 4 d resulted in better regeneration and transformation efficiency in immature soybean cotyledons. Five days of co-cultivation was optimum with maximum GUS expression in soybean cotyledonary nodes, according to Paz et al. (2006) and Xue et al. (2006), whereas, for somatic embryos, co-cultivation beyond 3 d led to nonsignificant differences in induction and survival, as reported by Yan et al. (2000). The use of sonication in the wounding of explants and subsequent transformation with naked DNA was met with limited success (Joersbo and Brunstedt 1990, 1992). However, the formation of satisfactory numbers of microwounds caused by sonication provides a promising explanation for enhanced A. tumefaciens-mediated transformation of half-seeds, as these tissue injuries help the bacteria to travel to and infect the plant cells. The results reported herein are in line with those by Trick and Finer (1997) and Santarem et al. (1998), who obtained highly transformed soybeans using a mechanical wounding mode called sonication-assisted Agrobacterium-mediated transformation (SAAT). Sonication enhances the T-DNA delivery after A. tumefaciens infection in various plant species, including monocots, dicots, and gymnosperms (Trick and Finer 1997). Meristematic tissue of soybean was subjected to 20 s of sonication with average transformation efficiency for crtB construct was 2.33% by Ye et al. (2008). Chenopodium rubrum L. produced 19.2% of transformants when 75-s sonication was

applied (Solís et al. 2003). Subramanyam et al. (2011) analyzed various sonication durations in banana and found 6 min as optimum duration to get 34.9% of transformation efficiency. L. culinaris Medik. plants were subjected to 60-s sonication by Chopra and Saini (2012) to achieve a 68% transformation rate. In addition, sonication has been effectively applied in cowpea (Bakshi et al. 2011), chickpea (Indurker et al. 2010), and Catharanthus roseus (L.) G. Don plants (Wang et al. 2012). Furthermore, shoot regeneration was also stimulated in Cucurbita pepo L. (squash) and Linum usitatissimum L. (flax) plants after effective sonication (Ananthakrishnan et al. 2007; Beranová et al. 2008). While sonication aids Agrobacterium infection efficiency through cavitation-created micro-wounds across the tissue, there is a further requisite to force the A. tumefaciens to the cells of the meristematic region of the explants. Vacuum infiltration, creating negative atmospheric pressure to draw the A. tumefaciens into the vicinity of meristematic cells, emerged as an efficient technique to improve the transformation rate positively (Bakshi et al. 2011; Mariashibu et al. 2013; Mayavan et al. 2013). In vacuum infiltration transformation systems, explants are submerged in a suspension of Agrobacterium under negative pressure (vacuum), followed by rapid re-pressurization (Bechtold and Pelletier 1995; Tague and Mantis 2006). The exposure to vacuum possibly causes gases to withdraw from the tissue interior, through stomata and probably through wound sites, and when the pressure rapidly increases as the vacuum is released, the bacterial cells might be driven into the explant. Thus, interior plant cells may receive more A. tumefaciens exposure than those on the explant epidermis. To produce A. tumefaciens-mediated transgenic plants, vacuum infiltration has been successfully used in Arabidopsis thaliana (L.) Heyn. (Clough and Bent 1998), as well as in various recalcitrant plant species, for example, wheat (Cheng et al. 1997), Vigna radiata (L.) R. Wilczek (mungbean; Jaiwal et al. 2001), Pinus sabiniana Douglas (gray pine; Charity et al. 2002), Gossypium hirsutum L. (cotton; Leelavathi et al. 2004), Phaseolus vulgaris L. (kidney bean; Liu et al. 2005), Coffea arabica L. (coffee; Canche-Moo et al. 2006), Cicer arietinum L. (chickpea; Indurker et al. 2010), and banana plants (Subramanyam et al. 2011). In soybean, Franklin et al. (2004) reported that maintaining the infected explants under a mild vacuum for 1 h resulted in better regeneration. Contrary to the results obtained here, Paz et al. (2006) reported that vacuum infiltration of soybean halfseed explants in presence of Agrobacterium for 15–45 min showed decreased gus gene expression and the explants failed to regenerate into plantlets on selection medium. The vacuum infiltration method of transformation with A. tumefaciens of cereals, e.g., rice and Triticum aestivum L. (wheat), has been effectively used by Dong et al. (2001) and Amoah et al. (2001). When wounding was followed by vacuum infiltration at − 80 kPa for 5 min, Pinus radiata D. Don cotyledons in Agrobacterium suspension produced a higher number of

SOYBEAN TRANSFORMATION VIA AGROBACTERIUM TUMEFACIENS

GUS-positive plantlets (Charity et al. 2002). Vacuum infiltration has been successfully employed to produce transgenics in various plants, such as Coffea canephora Pierre ex A. Froehner (Canche-Moo et al. 2006), Medicago sativa L. (Gupta et al. 2006), and Daucus carota L. (carrot; Hardegger and Sturm 1998). As reported herein, vacuum infiltration enhanced the soybean transformation efficiency significantly, when applied to half-seed explants in combination with wounding by sonication. It was also noted that determination of optimum duration for vacuum infiltration and sonication was a prerequisite for accomplishing high transformation efficiency, as evidenced in the present findings. Because wounding of half-seed explants was not extensive, it is possible that plant defense responses were elicited to a lesser extent, and in that way, enhanced interactions between A. tumefaciens and the plant tissue. Wounding the explants triggers the production of PPO-like compounds as plant defense mechanisms, which results in tissue browning and decreases the Agrobacterium-mediated transformation success rate (Olhoft et al. 2003). Wojtaszek (1997) suggested the role of reactive oxygen species (ROS), generated during the pathogen-induced oxidative burst in cell toxicity, might be to directly destroy the attacking A. tumefaciens. Hence, it seems necessary to understand plant defense signal transduction properly for developing strategies to improve A. tumefaciens-mediated transformation and for A. tumefaciens-induced defense response suppression. Antioxidant compounds such as L-cys and dithiothreitol (DTT), which scavenge ROS in plants, might suppress the activity of oxidative bursts. Supplementing optimal concentration of L-cys thus contributed to improving the efficiency of A. tumefaciens-mediated transformation in this present study. The amino acid L-cys plays a role in inhibiting copper- and iron-containing enzymes active in plant defense mechanism, such as PODs and PPOs. On this point, the present study was in agreement with Olhoft et al. (2003), who demonstrated the effect of thiol compounds like DTT, L-cys, and sodium thiosulfate in improving transformation and regeneration efficiency of soybean. The present report illustrated the effect of 450 mg L−1 L-cys in increasing the rate of transformation, lending support to multifunctional inhibition of thiol compounds. The concentration of different phenolic compounds derived from the plants has been shown to affect the A. tumefaciens virulence and T-DNA delivery into the explants in a threshold-dependent manner (Bolton et al. 1986; Lee et al. 1995). Sheng and Citovsky (1996) reported that wounding of tissue explants initiates the process of A. tumefaciens-mediated transformation with the desired gene by secreting the phenolic compounds and consequently triggering the vir gene expression in A. tumefaciens cells. The vir promoter responds to phenolic compounds from wounded plants and signals for the expression of the vir operon (Stachel et al. 1985). Thus, to illustrate the effect of optimum

concentration of the phenolic compound AS, CCM containing various concentrations from 0 to 0.4 mM AS were used. The results revealed 0.2 mM acetosyringone as the optimum concentration with maximum GUS expression, while lower concentrations were less effective. Higher AS concentrations were observed to coincide with decreased transformation efficiency; this could be due to the higher concentrations of alcohol in the medium (the solvent used for AS preparation and toxic to explants). To enhance Agrobacterium-mediated transformation efficiency, AS has been reported effective in many crops, such as carrot (Guivarch et al. 1993), Solanum lycopersicum L. (tomato; Joao and Brown 1993), and Malus pumila Mill. (apple; James et al. 1993; Weir et al. 2001). Acetosyringone addition becomes necessary for transformation of non-host plants, such as monocots (rice; Rashid et al. 1996), where AS induces vir gene expression and thus enhances the competence for transformation. The results reported here were similar to those observed by Raj et al. (2005) who reported 200 μM of AS in co-cultivation of tomato cv. Pusa Ruby with Agrobacterium strain LBA4404 as well as in line with Amoah et al. (2001), where 200 μM was reported as the optimum AS concentration in wheat transformation. For successful genetic transformation, further critical steps involve the T-DNA initiated processing and transfer after the bacterial cells attach to explant cells. A. tumefaciens pathogenicity enhances with inoculation conditions that increase explant susceptibility to bacterial infection, which in turn, might enhance the transformation rate. Olhoft et al. (2003) reported that infection medium at acidic pH facilitated T-DNA transfer and improved transformation efficiency. Previous reports by Hiei et al. (1994) supported pH 5.2 as the optimum pH for efficient rice transformation. In contrast, Komatsuda and Ko (1990) showed best somatic embryogenesis induction at pH 7.0 in soybean, which correlated with improved uptake of phytohormones at this pH. Despite the progress in transformation techniques and the availability of super-virulent Agrobacterium strains, inefficient selection protocols have resulted in low rates of transgenic plant regeneration. This has been mainly attributed to the regeneration of escapes and chimeric shoots, concerns that have been addressed in this current protocol by stringent kanamycin selection. Here, the combinations of antibiotics used in SIM efficiently reduced the unwanted bacterial growth, which translated into better regeneration efficiency. Different combinations of antibiotics like timentin, cefotaxime, and vancomycin have been used by Paz et al. 2006 for improved transformation in soybean. Similarly, Tyagi et al. (2007) have reported the use of cefotaxime, carbenicillin, and augmentin for A. tumefaciens-mediated transformation in rice. Öz et al. (2009) have reported a combination of sulbactam, carbenicillin, and cefotaxime for effective inhibition of A. tumefaciens growth in chickpea.

HADA ET AL.

In A. tumefaciens-mediated transformation, chimerism occurs as a serious problem and elimination of chimerism is an essential aspect of transformed plant production. The eradication of chimeric tissues necessitated insertion of appropriate selection genes in the binary vector, which when expressed, effectively selected for and allowed only transformed tissue to proliferate. The selection agent allows regeneration of transformed tissues, while inhibiting the growth of non-transformed tissues. In any transformation protocol, only a minor fraction of the target tissue is transformed, while a majority of the tissue remains non-transformed. Khan et al. (2003) have suggested that an optimized selection agent concentration increases the attainment of transformed plant lines and hinders the development of nontransformed cells. Hence, a refined selection system is all but necessary for the identification of the transformed cells, and as a vital step in efficiently generating transgenics. As reported here, kanamycin was used as a selection agent, which rapidly selected the transgenic shoots and reduced the escape frequency. Minimum inhibitory concentration of 25 mg L−1 kanamycin during shoot induction, 30 mg L−1 for shoot elongation, and 35 mg L−1 at rooting stage were assigned here. At higher kanamycin concentrations, severe tissue necrosis and absence of shoot formation was observed, which also revealed the stringency and lethality associated with, and the need for, an optimum concentration of selection agent. Hinchee et al. (1988) successfully regenerated soybean plants on kanamycin-containing medium after A. tumefaciens-mediated transformation. To obtain transgenic soybean plants Liu et al. (2004) successfully used kanamycin as a selective agent in an embryonic tip regeneration system. Xinping and Deyue (2006) used 75 mg L−1 kanamycin in the selection medium to select for transformed cotyledonary nodes. Higher numbers of somatic embryos per explant were produced in shoot regeneration medium with kanamycin at 20 mg L−1, but GUS expression percentage was reduced as well; while increasing the concentration of kanamycin to 50 mg L −1 improved transformation

Table 3. Segregation analyses for Glycine max (L.) Merr. progenies of five T0 transformants based on inheritance of the neomycin phosphotransferase II (nptII) gene analyzed by PCR

efficiency but lowered the shoot generation and explant response percentages (Zia et al. 2010). It has also been noted that a high kanamycin concentration is toxic for soybean cot-nodes, embryonic tips, and hypocotyl segments in a regeneration system (Cho et al. 2000; Liu et al. 2004). In this study, different methods were used to detect the transgenic plants, including GUS histochemical staining, PCR, and southern hybridization. Histochemical GUS staining was preferred for the optimization of various parameters, as it reduced time and labor, by identifying negative plants, which could then be eliminated. The GUS expression was observed in the seeds, germinating T0 seedlings, leaf, stem, and pods, which indicated that the gus gene integrated into the genome of transformed soybean. The use of the uidA gene as a marker for transformation was effective and is widely applied in many species, including monocots such as Dactylis glomerata L. (orchard grass; Lee et al. 2006), and dicotyledons such as P. vulgaris (Mukeshimana et al. 2013) and Medicago truncatula Gaertn. (Duque et al. 2007). However, the GUS assay involves the destruction of the tested tissues of transgenic explants; therefore, with this limitation, it has to be performed at a later stage of the transformation study. Additionally, GUS staining might miss the detection of some positive plants, which is likely because older tissues were difficult to stain. Hence, GUS-positive transformants were analyzed by PCR to confirm the presence of the nptII gene. Amplification of the nptII gene product was observed in positive soybean transformants and no such amplification was seen in NTC plants. The existence of nptII gene in the independent transformation events conferred kanamycin-resistance at a maximum transformation efficiency of 14.5%. The integration and copy number count of the transgene in the genome of PCR-positive soybean plants was analyzed by Southern hybridization. Further segregation in T1 lines revealed Mendelian inheritance of 3:1 at 0.05% significance level (Table 3). Thus, the protocol developed in the present study has efficiently produced stable transformants of an elite soybean cultivar with relative speed and ease.

Transformants lines

Number of T1 seeds tested

Number of PCR-positive plants

Number of PCR-negative plants

χ2 valuea

P value

A2-1 A6-8 A18-3 A9-7 A27-9

49 65 14 10 8

33 43 11 7 6

16 22 3 3 2

0.0994 0.1327 0.0952 0.1333 0.0000

0.7525 0.7157 0.7576 0.7150 1.0000

a

All χ2 value indicated significance fit the tested ratio (P < 0.05)

SOYBEAN TRANSFORMATION VIA AGROBACTERIUM TUMEFACIENS

Conclusion This comprehensive protocol (summarized in Fig. S1) optimizing culture conditions and mechanical wounding techniques, overcomes the major limitations associated with the A. tumefaciens-mediated genetic manipulation in soybean. Moreover, the protocol used mature seeds as the explant source, which can easily be obtained in quantity throughout the year. Standard culture conditions, along with a combination of sonication and vacuum infiltration used in this study, significantly aided T-DNA transfer into half-seed explants, which improved the transformation efficiency (14.5%). The protocol developed herein is of great relevance; hence, this system could be used in large-scale introduction of exogenous genes into soybean for novel desirable traits. Acknowledgements The authors are very grateful to Dr. Andy Ganapathi (Vice Chancellor, Bharathiar University, Coimbatore, India) for his valuable guidance in improving soybean transformation. Author contributions AS conceived and designed the experiments. AH and VK performed the experiments and compiled and analyzed the data. AK, MJ, and AH generated the pictures. AH, VK, and AS prepared the manuscript. SP and MSMJ helped in manuscript revision. All authors read and approved the final manuscript. Funding This work was supported by National Agriculture Science Fund (NASF) program by the Indian Council of Agricultural Research (ICAR), India.

Compliance with ethical standards Conflict of interest The authors declare that they have no competing interests.

References Acereto-Escoffie POM, Chi-Manzanero BH, Echeverria-Echeverria S, Grijalva R, Kay AJ, González-Estrada T, Castaño E, RodriguezZapata LC (2005) Agrobacterium-mediated transformation of Musa acuminata cv Bgrand nain^ scalps by vacuum infiltration. Sci Hortic 105:359–371 Amoah BK, Wu H, Sparks C, Jones HD (2001) Factors influencing Agrobacterium-mediated transient expression of uidA in wheat inflorescence tissue. J Exp Biol 52:1135–1142 An X, Wang B, Liu L, Jiang H, Chen J, Ye S, Chen L, Guo P, Huang X, Peng D (2014) Agrobacterium-mediated genetic transformation and regeneration of transgenic plants using leaf midribs as explants in ramie [Boehmerianivea (L.) gaud]. Mol Biol Rep 41:3257–3269 Ananthakrishnan G, Xia X, Amutha S, Singer S, Muruganantham M, Yablonsky S, Fischer E, Gaba V (2007) Ultrasonic treatment stimulates multiple shoot regeneration and explant enlargement in recalcitrant squash cotyledon explants in vitro. Plant Cell Rep 26:267– 276 Arun M, Subramanyam K, Theboral J, Ganapathi A, Manickavasagam M (2014) Optimized shoot regeneration for Indian soybean: the influence of exogenous polyamines. Plant Cell Tissue Organ Cult 117: 305–309

Bakshi S, Sadhukhan A, Mishra S, Sahoo L (2011) Improved Agrobacterium-mediated transformation of cowpea via sonication and vacuum infiltration. Plant Cell Rep 30:2281–2292 Bechtold N, Pelletier G (1995) In-planta Agrobacterium-mediated transformation of adult Arabidopsis thaliana plants by vacuum infiltration. Methods Mol Biol 82:259–326 Beranová M, Rakouský S, Vávrová Z, Skalický T (2008) Sonication assisted Agrobacterium- mediated transformation enhances the transformation efficiency in flax (Linum usitatissimum L.). Plant Cell Tissue Organ Cult 94:253–259 Bolton GW, Nester EW, Gordon MP (1986) Plant phenolic compounds induce expression of the Agrobacterium tumefaciens loci needed for virulence. Science 232:983–985 Bowen BA (1993) Markers for gene transfer. In: Kung S, Wu R (eds) Transgenic Plants: Engineering and Utilization, Academic Press, New York pp 89–123 Canche-Moo RLR, Ku-Gonzalez A, Burgeff C, Loyola-Vargas VM, Rodrı’guez-Zapata LC, Castan’o E (2006) Genetic transformation of Coffea canephora by vacuum infiltration. Plant Cell Tissue Organ Cult 84:373–377 Chakrabarty R, Viswakarma N, Bhat SR, Kirti PB, Singh BD, Chopra VL (2002) Agrobacterium-mediated transformation of cauliflower: optimization of protocol and development of Bt-transgenic cauliflower. J Biosci 27:495–502 Charity JA, Holland L, Donaldson SS, Grace L, Walter C (2002) Agrobacterium-mediated transformation of Pinus radiata organogenic tissue using vacuum-infiltration. Plant Cell Tissue Organ Cult 70:51–60 Cheng M, Fry JE, Pang S, Zhou H, Hironaka CM, Duncan DR, Connor TW, Wan Y (1997) Genetic transformation of wheat mediated by Agrobacterium tumefaciens. Plant Physiol 115:971–980 Cho HJ, Farrand SK, Noel GR, Widholm JM (2000) High efficiency induction of soybean hairy roots and propagation of the soybean cyst nematode. Planta 210:195–204 Chopra R, Saini R (2012) Use of sonication and vacuum infiltration for Agrobacterium-mediated transformation of an Indian lentil (Lens culinaris Medik.) cultivar. Sci Hortic 143:127–134 Clemente TE, LaVallee BJ, Howe AR, Conner-Ward D, Rozman RJ, Hunter PE, Broyles DL, Kasten DS, Hinchee MA (2000) Progeny analysis of glyphosate selected transgenic soybean derived from Agrobacterium-mediated transformation. Crop Sci 40:797–803 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16:735–743 Dan Y (2008) Biological functions of antioxidants in plant transformation. In Vitro Cell Dev Biol-Plant 44:149–161 Das DK, Reddy MK, Upadhyaya KC, Sopory SK (2002) An efficient leaf-disk culture method for the regeneration via somatic embryogenesis and transformation of grape (Vitis vinifera L.). Plant Cell Rep 20:999–1005 Di R, Purcell V, Collins GB, Ghabrial SA (1996) Production of transgenic soybean line expressing the bean pod mottle virus coat protein precursor gene. Plant Cell Rep 15:746–750 Dong J, Kharb P, Teng W, Hall TC (2001) Characterization of rice transformed via an Agrobacterium inflorescence approach. Mol Breeding 7:187–194 Doyle JJ, Doyle JL (1987) A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull 19:11–15 Duque AS, Araujo SS, Cordeiro MA, Santos DM, Fevereiro MP (2007) Use of fused gfp and gus reporters for the recovery of transformed Medicago truncatula somatic embryos without selective pressure. Plant Cell Tissue Organ Cult 90:325–330 Enríquez-Obregón GA, Vázquez-Padrón RI, Prieto-Samsonov DL, De la Riva GA, Selman-Housein G (1998) Herbicide-resistant sugarcane (Saccharum officinarum L.) plants by Agrobacterium-mediated transformation. Planta 206:20–27

HADA ET AL. Franklin G, Carpenter L, Davis E, Reddy CS, Al-Abed D, Alaiwi WA, Parani M, Smith B, Sairam RV (2004) Factors influencing regeneration of soybean from mature and immature cotyledons. Plant Growth Regul 43:73–79 Gamborg OL, Miller RA, Ojima K (1968) Nutrient requirements of suspension cultures of soybean root cells. Exp Cell Res 50:151–115 Gnasekaran P, Antony JJJ, Uddain J, Subramaniam S (2014) Agrobacterium-mediated transformation of the recalcitrant Vanda Kasem’s delight orchid with higher efficiency. Sci World J 2014: 583934 Gomez KA, Gomez AA (1984) Statistical procedures for agricultural research, 2nd edn. John Wiley and Sons, New York Goodman RN, Novacky AJ (1994) The hypersensitive reaction in plants to pathogens. A resistant phenomenon. APS PRESS, St. Paul, Minnesota Guivarch A, Caissard J, Brown S, Marie D, Dewitte W, Vanonckelen H, Chriqui D (1993) Localization of target cells and improvement of Agrobacterium-mediated transformation efficiency by direct acetosyringone pretreatment of carrot root disks. Protoplasma 174: 10–18 Gupta S, Gupta S, Bhat V, Gupta MG (2006) Somatic embryogenesis and Agrobacterium-mediated genetic transformation in Indian accessions of Lucerne (Medicago sativa L.). Ind J Biotechnol 5:269–275 Hada A, Krishnan V, Punjabi M, Basak N, Pandey V, Jeevaraj T, Marathe A, Gupta AK, Jolly M, Kumar A, Dahuja A, Manickavasagam M, Ganapathi A, Sachdev A (2016) Refined glufosinate selection and its extent of exposure for improving the Agrobacterium-mediated transformation in Indian soybean (Glycine max) genotype JS-335. Plant Biotechnol 33:341–350 Hansen G (2000) Evidence for Agrobacterium-induced apoptosis in maize cells. Mol Plant-Microbe Interact 13:649–657 Hardegger M, Sturm A (1998) Transformation and regeneration of carrot (Daucus carota L.). Mol Breeding 4:119–127 Hiei Y, Ohta S, Komari T, Kumashiro T (1994) Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J 6:271–282 Hinchee MAW, Conor-Ward DV, Newell CA, McDonnell RE, Sato SJ, Gasser CS, Fischhoff DA, Re DB, Fraley RT, Horsch RB (1988) Production of transgenic soybean plants using Agrobacterium-mediated DNA transfer. Nat Biotechnol 6:915–922 Hood EE, Gelvin SB, Melchers LS, Hoekema A (1993) New Agrobacterium helper plasmids for gene transfer to plants. Transgenic Res 2:208–218 Indurker S, Misra HS, Eapen S (2010) Agrobacterium-mediated transformation in chickpea (Cicer arietinum L.) with an insecticidal protein gene: optimization of different factors. Physiol Mol Biol Plants 16:273–284 Ismael KA, Antar EN (2014) Establishment of high-efficiency Agrobacterium-mediated transformation conditions of soybean callus. Ind J Biotechnol 13:459–463 Jaiwal PK, Kumari R, Ignacimuthu S, Potrykus I, Sautter C (2001) Agrobacterium tumefaciens-mediated transformation of mungbean (Vigna radiata) a recalcitrant grain legume. Plant Sci 161:239–247 James D, Uratsu S, Cheng J, Negri P, Viss P, Dandekar A (1993) Acetosyringone and osmo-protectants like betaine or proline synergically enhance Agrobacterium-mediated transformation of apple. Plant Cell Rep 12:559–563 Jefferson RA, Kavanagh TA, Bevan MW (1987) Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol Biol 5:387–405 Joao L, Brown A (1993) Enhanced transformation of tomato cocultivated with Agrobacterium tumefaciens C58 CIRIF- R PGSFRI161 in the presence of acetosyringone. Plant Cell Rep 12: 422–425 Joersbo M, Brunstedt J (1990) Direct gene transfer to plant protoplast by mild sonication. Plant Cell Rep 9:207–210 Joersbo M, Brunstedt J (1992) Sonication: a new method for gene transfer to plants. Physiol Plant 85:230–234

Khan MR, Rashid H, Ansar M, Chaudury Z (2003) High frequency shoot regeneration and Agrobacterium-mediated DNA transfer in canola (Brassica napus). Plant Cell Tissue Organ Cult 75:223–231 Kim JH, Lamotte CE, Hack E (1990) Plant regeneration in vitro from primary leaf nodes of soybean (Glycine max) seedlings. J Plant Physiol 136:664–669 Ko TS, Korban SS (2004) Enhancing the frequency of somatic embryogenesis following Agrobacterium-mediated transformation of immature cotyledons of soybean [Glycine max (L.) Merrill]. In Vitro Cell Dev Biol-Plant 40:552–558 Ko TS, Lee S, Krasnyanski S, Korban SS (2003) Two critical factors are required for efficient transformation of multiple soybean cultivars: Agrobacterium strain and orientation of immature cotyledonary explant. Theor Appl Genet 107:439–447 Komatsuda T, Ko SW (1990) Screening of soybean (Glycine max (L.) Merrill) genotypes for embryo production form immature embryo. Jpn J Breed 40:249–251 Kumar B, Talukdar A, Verma K, Girmilla V, Bala I, Lal SK, Pal Singh K, Sapra RL (2014) Screening of soybean [Glycine max (L.) Merr.] genotypes for yellow mosaic virus (YMV) disease resistance and their molecular characterization using RGA and SSRs markers. Aust J Crop Sci 8:27–34 Kumar V, Sharma A, Prasad BCN, Gururaj HB, Ravishankar GA (2006) Agrobacterium rhizogenes-mediated genetic transformation resulting in hairy root formation is enhanced by ultrasonication and acetosyringone treatment. Electron J Biotechnol 9:349–357 Kumari S, Krishnan V, Dahuja A, Vinutha T, Jolly M, Sachdev A (2016) A rapid method for optimization of Agrobacterium-mediated transformation of Indian soybean genotypes. Indian J Biochem Biophys 53:218–226 Kumria R, Waie B, Rajam MV (2001) Plant regeneration from transformed embryogenic callus of an elite Indica rice via Agrobacterium. Plant Cell Tissue Organ Cult 67:63–71 Kuta DD, Tripathi L (2005) Agrobacterium-induced hypersensitive necrotic reaction in plant cells: a resistance response against Agrobacteriummediated DNA transfer. Afr J Biotechnol 4:752–757 Lee SH, Lee DG, Woo HS, Lee KW, Kim DH, Kwak SS, Kim JS, Kim H, Ahsan N, Choi MS, Yang JK (2006) Production of transgenic orchard grass via Agrobacterium-mediated transformation of seedderived callus tissues. Plant Sci 171:408–414 Lee YW, Jin S, SimWS NEW (1995) Genetic evidence for direct sensing of phenolic compounds by the VirA protein of Agrobacterium tumefaciens. Proc Natl Acad Sci U S A 92:12245–12249 Leelavathi S, Sunnichan SG, Kumria R, Vijaykanth GP, Bhatnagar RK, Reddy VS (2004) A simple and rapid Agrobacterium-mediated transformation protocol for cotton (Gossypium hirsutum L.): Embryogenic calli as a source to generate large numbers of transgenic plants. Plant Cell Rep 22:465–470 Li S, Cong Y, Liu Y, Wang T, Shuai Q, Chen N, Gai J, Li Y (2017) Optimization of Agrobacterium-mediated transformation in soybean. Front Plant Sci 8:246 Liu HK, Yang C, Wei ZM (2004) Efficient Agrobacterium tumefaciensmediated transformation of soybeans using an embryonic tip regeneration system. Planta 219:1042–1049 Liu Z, Park BJ, Kanno A, Kameya T (2005) The novel use of a combination of sonication and vacuum infiltration in Agrobacterium-mediated transformation of kidney bean (Phaseolus vulgaris L.) with lea gene. Mol Breeding 16:189–197 Mariashibu TS, Subramanyam K, Arun M, Mayavan S, Rajesh M, Theboral J, Manickavasagam M, Ganapathi A (2013) Vacuum infiltration enhances the Agrobacterium-mediated genetic transformation in Indian soybean cultivars. Acta Physiol Plant 35:41–54 Mayavan S, Subramanyam K, Arun M, Rajesh M, Dev GK, Sivanandhan G, Jaganath B, Manickavasagam M, Selvaraj N, Ganapathi A (2013) Agrobacterium tumefaciens-mediated in planta seed transformation strategy in sugarcane. Plant Cell Rep 32:1557–1574

SOYBEAN TRANSFORMATION VIA AGROBACTERIUM TUMEFACIENS Mayer AM, Harel E (1979) Polyphenol oxidases in plants. Phytochemistry 18:193–215 Mccabe DE, Swain WF, Martinell BJ, Christou P (1988) Stable transformation of soybean (Glycine max) by particle acceleration. Nat Biotechnol 6:923–926 Meurer CA, Dinkins RD, Collin GB (1998) Factors affecting soybean cotyledonary node transformation. Plant Cell Rep 18:180–186 Mohiuddin KM, Abdullah C, Harikrishna K, Chowdhury K, Napis S (2011) Enhanced virulence gene activity of Agrobacterium in muskmelon (Cucumis melo L.) cv. ‘Birdie’. Not Sci Biol 3:71–79 Mukeshimana G, Ma Y, Walworth AE, Song GQ, Kelly JD (2013) Facto rs i nfluen cing reg eneratio n and Ag ro bact erium tumefaciens-mediated transformation of common bean Phaseolus vulgaris L. Plant Biotechnol Rep 7:59–70 Murashige T, Skoog F (1962) A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Plant 15:473–497 Negishi O, Ozawa T (2000) Inhibition of enzymatic browning and protection of sulfhydryl enzymes by thiol compounds. Phytochemistry 54:481–487 Olhoft PM, Flagel LE, Donovan CM, Somers DA (2003) Efficient soybean transformation using hygromycin B selection in the cotyledonary node method. Planta 216:723–735 Olhoft PM, Somers DA (2001) L-cysteine increases Agrobacterium-mediated T-DNA delivery into soybean cotyledonary node cells. Plant Cell Rep 20:706–711 Öz MT, Eyidoğan F, Yücel M, Öktem HA (2009) Optimized selection and regeneration conditions for Agrobacterium-mediated transformation of chickpea cotyledonary nodes. Pak J Bot 41:2043–2054 Park BJ, Liu Z, Kanno A, Kameya T (2005) Transformation of radish (Raphanus sativus L.) via sonication and vacuum infiltration of germinated seeds with Agrobacterium harboring a group 3 LEA gene from B. napus. Plant Cell Rep 24:494–500 Paz MM, Martinez JC, Kalvig AB, Fonger TM, Wang K (2006) Improved cotyledonary node method using an alternative explant derived from mature seed for efficient Agrobacterium-mediated soybean transformation. Plant Cell Rep 25:206–213 Potrykus I (1990) Gene transfer to cereals: an assessment. Nat Biotechnol 8:535–542 Raj SK, Singh R, Pandey SK, Singh BP (2005) Agrobacterium-mediated tomato transformation and regeneration of transgenic lines expressing tomato leaf curl virus coat protein gene for resistance against TLCV infection. Curr Sci India 88:1674–1679 Rashid H, Yoki S, Toriyama K, Hinata K (1996) Transgenic plant production mediated by Agrobacterium in Indica rice. Plant Cell Rep 15:727–730 Richard-Forget FC, Goupy PM, Nicolas JJ (1992) Cysteine as an inhibitor of enzymatic browning. 2. Kinetic studies. J Agr Food Chem 40: 2108–2113 Sahoo KK, Tripathi AK, Pareek A, Sopory SK, Singla-Pareek SL (2011) An improved protocol for efficient transformation and regeneration of diverse indica rice cultivars. Plant Methods 7:49–59 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual, 2nd edn. Cold Spring Harbor Laboratory Press, New York Sambrook J, Russel DW (2001) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, New York Santarem ER, Trick HN, Essig JS, Finer JJ (1998) Sonication-assisted Agrobacterium-mediated transformation of soybean immature cotyledons: optimization of transient expression. Plant Cell Rep 17:752–759 Sato S, Newell C, Kolacz K, Tredo L, Finer J, Hinchee M (1993) Stable transformation via particle bombardment in two different soybean regeneration systems. Plant Cell Rep 12:408–413 Sheng J, Citovsky V (1996) Agrobacterium-plant cell DNA transport: have virulence proteins, will travel. Plant Cell 8:1699–1710

Shrawat AK, Becke D, Lorz H (2007) Agrobacterium tumefaciens-mediated genetic transformation of barley (Hordeum vulgare L.). Plant Sci 172:281–290 Solís JIF, Mlejnek P, Studená K, Procházka S (2003) Application of sonication-assisted Agrobacterium-mediated transformation in Chenopodium rubrum L. Plant Soil Environ 49:255–260 Stachel SE, Messens E, Van MM, Zambryski P (1985) Identification of the signal molecules produced by wounded plant cells that activate TDNA transfer in Agrobacterium tumefaciens. Nature 318:624–629 Subramanyam K, Sailaja KV, Srinivasulu M, Lakshmidevi K (2011) Highly efficient Agrobacterium-mediated transformation of banana cv. Rasthali (AAB) via sonication and vacuum infiltration. Plant Cell Rep 30:425–436 Tague BW, Mantis J (2006) In Planta Agrobacterium-mediated transformation by vacuum infiltration. Methods Mol Biol 323:215–223 Tiwari V, Chaturvedi AK, Mishra A, Jha B (2015) An efficient method of Agrobacterium-mediated genetic transformation and regeneration in local Indian cultivar of groundnut (Arachis hypogaea) using grafting. Appl Biochem Biotechnol 175:436–453 Townsend JA, Thomas LA (1993) An improved method of Agrobacterium-mediated transformation of cultured soybean cells. US Patent WO 94:02620 Tr i c k H N , F i n e r J J ( 1 9 9 7 ) S A AT: s o n i c a t i o n - a s s i s t e d Agrobacterium-mediated transformation. Transgenic Res 6:329–336 Tyagi H, Rajsubramaniam S, Dasgupta I (2007) Regeneration and Agrobacterium-mediated transformation of a popular indica rice variety, ADT39. Curr Sci India 93:678–673 Wang G, Huang M (2002) Tissue culture and plant regeneration of Cerasus campanulata. J Nanjing Univ 26:73–76 Wang Q, Xing S, Pan Q, Yuan F, Zhao J, Tian Y, Chen Y, Wang G, Tang K (2012) Development of efficient Catharanthus roseus regeneration and transformation system using Agrobacterium tumefaciens and hypocotyls as explants. BMC Biotechnol 12:34 Weir B, Wang X, Upadhyaya N, Elliot A, Brettell R (2001) Agrobacterium tumefaciens transformation of wheat using suspension cells as a model system and green fluorescent protein as a visual marker. Aust J Plant Physiol 28:807–818 Wojtaszek P (1997) Oxidative burst: an early plant response to pathogen infection. Biochem J 322:681–691 Wroblewski T, Tomczak A, Michelmore R (2005) Optimization of Agrobacterium-mediated transient assays of gene expression in lettuce, tomato and Arabidopsis. Plant Biotech J 3:259–273 Xinping YI, Deyue YU (2006) Transformation of multiple soybean cultivars by infecting cotyledonary-node with Agrobacterium tumefaciens. Afr J Biotechnol 5:1989–1993 Xue RG, Xie HF, Zhang B (2006) A multi-needle assisted transformation of soybean cotyledonary node cells. Biotechnol Lett 28:1551–1557 Yan B, Reddy MSS, Collins GB, Dinkins RD (2000) Agrobacterium tumefaciens-mediated transformation of soybean [Glycine max (L.) Merrill.] using immature zygotic cotyledon explants. Plant Cell Rep 19:1090–1097 Ye X, Williams EJ, Shen J, Esser JA, Nichols AM, Petersen MW, Gilbertson LA (2008) Plant development inhibitory genes in binary vector backbone improve quality event efficiency in soybean transformation. Transgenic Res 17:827–838 Zhang Z, Xing A, Staswick P, Clemente TE (1999) The use of glufosinate as a selective agent in Agrobacterium-mediated transformation of soybean. Plant Cell Tissue Organ Cult 56:37–46 Zhong H, Que Q (2009) Method for transforming soybean (Glycine max). US Patent Number 20090023212 Z i a M , Z a r r i n R F, R e h m a n R U , C h a u d h a r y F M ( 2 0 1 0 ) Agrobacterium-mediated transformation of soybean (Glycine max L.): some conditions standardization. Pak J Bot 42:2269–2279