EMBRYONIC STEM CELLS/INDUCED PLURIPOTENT STEM CELLS Critical Components of the Pluripotency Network Are Targets for the p300/CBP Interacting Protein (p/CIP) in Embryonic Stem Cells J.M. CHITILIAN,a,b G. THILLAINADESAN,a,b J.L. MANIAS,c,d W.Y. CHANG,c E. WALKER,e M. ISOVIC,a W.L. STANFORD,c,d J. TORCHIAa,b Key Words. Embryonic stem cells • Coactivator • Gene expression • Pluripotent stem cells Transcription factors
a
Department of Oncology, The London Regional Cancer Program and the Lawson Health Research Institute and b Department of Biochemistry, The University of Western Ontario, London, Ontario, Canada; cSprott Centre for Stem Cell Research, Regenerative Medicine Program, Ottawa Hospital Research Institute, Ottawa, Ontario, Canada; d Department of Cellular and Molecular Medicine, Faculty of Medicine, University of Ottawa, Ottawa, Ontario, Canada; eCentre for the Commercialization of Regenerative Medicine, Toronto, Ontario, Canada Correspondence: Joe Torchia, Ph.D., Cancer Research Laboratories, London Regional Cancer Program, London, Ontario, Canada N6A 4L6. Telephone: 519-685-8692; Fax: 519-685-8646; e-mail:
[email protected] Received October 24, 2012; accepted for publication August 23, 2013; first published online in STEM CELLS EXPRESS October 1, 2013. C AlphaMed Press V
1066-5099/2013/$30.00/0 http://dx.doi.org/ 10.1002/stem.1564
•
ABSTRACT p/CIP, also known as steroid receptor coactivator 3 (SRC-3)/Nuclear Receptor Coactivator 3 (NCoA3), is a transcriptional coactivator that binds liganded nuclear hormone receptors, as well as other transcription factors, and facilitates transcription through direct recruitment of accessory factors. We have found that p/CIP is highly expressed in undifferentiated mouse embryonic stem cells (mESCs) and is downregulated during differentiation. siRNA-mediated knockdown of p/CIP decreased transcript levels of Nanog, but not Oct4 or Sox2. Microarray expression analysis showed that Klf4, Tbx3, and Dax-1 are significantly downregulated in mESCs when p/CIP is knocked down. Subsequent chromatin immunoprecipitation (ChIP) analysis demonstrated that Tbx3, Klf4, and Dax-1 are direct transcriptional targets of p/CIP. Using the piggyBac transposition system, a mouse ESC line that expresses Flag-p/CIP in a doxycycline-dependent manner was generated. p/CIP overexpression increased the level of target genes and promoted the formation of undifferentiated colonies. Collectively, these results indicate that p/CIP contributes to the maintenance of ESC pluripotency through direct regulation of essential pluripotency genes. To better understand the mechanism by which p/ CIP functions in ESC pluripotency, we integrated our ChIP and transcriptome data with published protein-protein interaction and promoter occupancy data to draft a p/CIP gene regulatory network. The p/CIP gene regulatory network identifies various feed-forward modules including one in which p/CIP activates members of the extended pluripotency network, demonstrating that p/CIP is a component of this extended network. STEM CELLS 2014;32:204–215
INTRODUCTION Embryonic stem cells (ESCs) are pluripotent cells isolated from the inner cell mass of the preimplantation embryo that have the capacity to give rise to any cell type derived from the three primary germ layers [1, 2]. A key hallmark of ESCs is their ability to self-renew, or continuously divide without undergoing differentiation [3]. The self-renewal and pluripotency of ESCs are governed by complex transcriptional regulatory networks involving various transcription factors, coregulators, and epigenetic modifiers, which integrate key signaling pathways activated by extrinsic factors, such as leukemia inhibitory factor (LIF) and BMP [4, 5]. Oct4, Sox2, and Nanog represent the core transcription factors that are essential for the maintenance of ESC self-renewal and pluripotency [6–11]. They regulate their own as well as each other’s expression, and function in a cooperative manner to activate the expression of genes involved in self-renewal
STEM CELLS 2014;32:204–215 www.StemCells.com
and pluripotency, and repress the expression of developmental and differentiation genes [12]. High-throughput, genome-wide studies have identified additional factors that intimately associate with the core factors to promote pluripotency and suppress differentiation such as Tbx3, Klf4, Dax-1 (Nr0b1), c-Myc, Esrrb, Sall4, Tcf3, and Zfx [13–17] forming an extended pluripotency network. p/CIP, also known as steroid receptor coactivator 3 (SRC-3), is a member of the p160 SRC family of nuclear receptor coactivators [18]. p/CIP is a 160 kDa protein comprised of three structural domains which are highly conserved among its family members, SRC-1 and SRC-2, and facilitate its adapter function [19]. p/CIP binds ligand-activated nuclear hormone receptors such as the estrogen receptor, progesterone receptor, and retinoic acid (RA) receptor, as well as other classes of transcription factors such as NF-jB[20], E2F1 [21], and STATs [22]. In addition, p/CIP recruits additional coregulators, such as CARM1 [23] and C AlphaMed Press 2013 V
Chitilian, Thillainadesan, Manias et al. p300 [24], to remodel nearby chromatin thereby promoting assembly of the general transcription machinery at target gene promoters for activation of transcription. Studies have shown that p/CIP is required for normal somatic growth as knockout mice demonstrate retarded growth, delayed puberty, reduced female reproductive function, blunted mammary gland development, and impaired IGF-1 signaling [25, 26]. Furthermore, p/CIP has been identified as an oncogene based on its ability to initiate tumor formation in mice when overexpressed [27]. Amplification and overexpression of p/CIP are found in various cancers, including breast and ovarian, and its overexpression is generally associated with larger tumor size, higher tumor grade, and poor disease-free survival [28]. Through efforts aimed at uncovering novel regulators of self-renewal and pluripotency, p/CIP has been more recently identified as a candidate self-renewal gene in mouse ESCs. Microarray expression analyses have demonstrated that p/CIP is highly expressed in embryonic tissues and its expression is downregulated during differentiation [29, 30]. Interestingly, global chromatin immunoprecipitation (ChIP) analysis has shown that the promoters of p/CIP and SRC-1 are targeted by Nanog and Oct4/Sox2, respectively [14, 17, 30]. Furthermore, a genome-wide RNAi screen demonstrated that depletion of p/CIP resulted in differentiation of mESCs [29]. These results suggest that p/CIP may play a role in the regulation of ESC identity. In this study, we examine the role of p/CIP in mouse ESC self-renewal. We show that p/CIP is highly expressed in undifferentiated mouse ESCs and that it is downregulated during ESC differentiation induced by both RA-treatment and LIF withdrawal. Microarray expression analysis identified 46 genes that demonstrated significant changes in expression following p/CIP knockdown. These genes include the essential selfrenewal genes Klf4, Tbx3, and Dax-1. ChIP analysis revealed p/ CIP occupancy within the 1 kb proximal promoter regions of each of these genes, suggesting they are direct transcriptional targets of p/CIP. Conditional overexpression of p/CIP using the piggyBac transposition system resulted in increased expression of Klf4, Tbx3, and Dax1. Importantly, in a clonogenic assay, ESCs overexpressing p/CIP demonstrated increased efficiency in the formation of undifferentiated colonies. These results suggest that p/CIP contributes to the maintenance of self-renewal and pluripotency in mouse ESCs by facilitating the transcriptional activation of essential genes.
MATERIALS
AND
METHODS
ESC Culture and Reagents R1 and E14 ESCs were cultured on a layer of mitomycin C-inactivated mouse embryonic fibroblasts in Dulbecco’s modified Eagle’s medium (Wisent), supplemented with 15% fetal bovine serum (ESC qualified, Wisent St-Bruno, Quebec, http:// www.wisent.ca), 100 mM b-mercaptoethanol (Sigma), 2 mM Lglutamine, 100 mM nonessential amino acids, 1 mM sodium pyruvate, penicillin/streptomycin (all from Gibco Burlington, Canada, http://www.lifetechnologies.com), and 1,000 units/ml of LIF (ESGRO, from Millipore, Billerica, Massachusetts, USA, www.millipore.com). ESCs were maintained at 37 C and 5% CO2, and passaged every second day at a ratio of 1:5 by washing with PBS (Wisent), dissociating with 0.05% trypsin (Wisent) for 5 minutes at 37 C, and resuspending in ESC media. To
www.StemCells.com
205
induce differentiation, cells were cultured in LIF-deficient ESC media, or ESC media supplemented with 1 mM all-trans RA (Sigma-Aldrich, Oakville, Canada, http://www.sigmaaldrich. com). For doxycycline-induction, cells were cultures in ESC media containing 2 mg/ml doxycycline (Sigma-Aldrich).
siRNA Transfections R1 ESCs were plated on six-well tissue culture-treated dishes coated with 0.1% gelatin at a density of 0.5 3 106 cells per well. After 6–8 hours, cells were transfected with 50 pmol siRNA using Transfectin (BioRad Mississauga, Canada, www.bio-rad.com) according to manufacturer’s recommendations. Media were changed after 24 hours and cells were harvested 48 hours post-transfection for RNA extraction and Western Blotting. Two individual siRNAs targeting distinct regions of the p/CIP transcript were purchased from Dharmacon: p/CIP siRNA1, 50 CCGGAAAGGUUGUCAAUAU; p/CIP siRNA2, 50 GGAACAAGGUCCUCACGGG. ON-TARGET Control pool siRNA was purchased from Dharmacon Waltham, Massachusetts, http://www.thermoscientificbio.com.
Generation of Doxycycline-Inducible Flag-p/CIP-IRES-bgeo Clones Doxycycline-inducible Flag-p/CIP clones were generated using the piggyBac transposition assay as previously described [31]. Following PCR amplification of Flag-p/CIP using attBmodified primer pairs, the product was cloned into pDONR221 using BP clonase (Invitrogen) according to manufacturer’s instructions. The resulting entry vector was then used to deliver Flag-p/CIP into the doxycycline-inducible vector PB-TET (Addgene) using LR clonase (Invitrogen). PB-TETFlag-p/CIP, PB-CA-rtTA (Addgene), and PBase pCyL43 (Sanger) were then cotransfected into E14 mouse ESCs by electroporation and selected with blasticidin.
Protein Extraction and Western Blot Analysis Protein extracts were obtained using RIPA lysis buffer consisting of 20 mM Tris (pH 5 7.9), 300 mM KCl, 0.1% Nonidet P40, 10% glycerol, 0.1 mM dithiothreitol, 0.5 mM EDTA, 0.5 mM EGTA, and protease inhibitor cocktail. Lysates were cleared by centrifugation at 15,000 rpm for 10 minutes at 4 C and protein concentrations were determined using the Bradford reagent assay (Bio-Rad). Protein samples were separated by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis, transferred to polyvinylidene fluoride membrane, and blocked overnight in PBS containing 0.1% Tween 20 and 5% nonfat dried milk. Membranes were probed with specific primary antibodies for 2 hours at room temperature and incubated with appropriate horseradish peroxidase-conjugated secondary antibodies for 1 hour. Signals were detected using enhanced chemiluminescence according to the manufacturer’s recommendations (Amersham). Affinity purified anti-p/CIP antibody was generated as previously described [32]. Antibodies against Flag (M2) and aTubulin were purchased from Sigma. Other antibodies purchased are as follows: Oct4 (611202; BD Transduction Laboratories), Sox2 (L1D6A2; Cell Signaling Technologies Danvers, Massachusetts, www.cellsignal.com), and Nanog (560259; BD Pharmingen).
RNA Isolation and Quantitative Real-Time PCR Total cellular RNA was isolated using the RNeasy Mini kit (Qiagen Toronto, Ontario, www.qiagen.com) according to the C AlphaMed Press 2013 V
NCoA3 and Stem Cell Pluripotency
206
manufacturer’s instructions. For quantitative real-time PCR (qRT-PCR) analysis, 2 mg of RNA was reverse transcribed to cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems Foster City, California, www.appliedbiosystems.com). Amplification was detected using predesigned and quality tested 50 nuclease Taqman probes (Applied Biosystems). Reactions were performed in duplicate in a 96-well format according to manufacturer’s recommendations (Applied Biosystems) using an Mx3000P real-time instrument (Stratagene Mississauga, Canada, http://www.genomics.agilent.com). Gene expression levels were determined based on the cycle threshold (Ct) value for each reaction and normalized to GAPDH or 18S.
Chromatin Immunoprecipitation ESCs were cross-linked with 1% formaldehyde for 10 minutes at room temperature and immediately washed twice with ice-cold PBS (containing 0.5 mM phenylmethanesulfonylfluoride) to terminate cross-linking. Cell pellets were resuspended in lysis buffer (50 mM Tris-HCl mM [pH 8.1], 10 mM EDTA, 1% SDS, and protease inhibitors) and incubated on ice for 10 minutes. Lysates were sonicated to yield chromatin fragments approximately 1 kb in length, and ChIP experiments were performed as previously described [33], using p/CIP or rabbit IgG antibodies. Immunoprecipitated DNA was purified using PCR purification spin columns (Qiagen). qRT-PCR was also performed as previously described [33], using Brilliant Sybr green master mix (Applied Biosystems) on an Mx3000P real-time instrument (Stratagene). The signal obtained using rabbit anti-IgG antibody was negligible and for each experiment this value was subtracted from the signal obtained using the specific antibody. The following primer pairs were used: Klf4, forward-50 GCCGCTCTCTTTCATAGCAG, reverse-50 ATTATCCGCGTGA CTCATCC; Tbx3, forward-50 ACGTCTGCCACGATAAGTCC, reverse-50 GGGGTGTGGGTGTAGAGAGA; Dax-1, forward-50 GGCATTTATTTCTGCCTCCA, reverse-50 GGCTCTGTTCCAAC TCTTGC; Chr3, forward-50 ATAGGTACACCAAGGACAGTTAG GA, reverse-50 AGTTATCACATTTTCAGAGCCCA.
b-Galactosidase Staining Inducible, Flag-p/CIP overexpressing cells grown in the presence or absence of doxycycline for 48 hours were rinsed once in 0.1 M phosphate buffer pH 7.3 at room temperature. Cells were then fixed in fix solution consisting of 0.2% glutaraldehyde, 5 mM EGTA pH 7.3, 20 mM magnesium chloride, 0.1 M sodium phosphate pH 7.3 for 5 minutes at room temperature and then washed with wash buffer (20 mM magnesium chloride, 0.01% deoxycholate, 0.02% Nonidet P40, 0.1 M sodium phosphate pH 7.3) three times for 5 minutes at room temperature. X-gal stain (1 mg/ml X-gal in dimethylformamide, 5 mM potassium ferrocyanide, 5 mM potassium ferricyanide in wash buffer) was added to cells and plates were incubated overnight at 37 C. Stain was removed, plates were washed once with wash solution, and then stored in wash buffer at 4 C. Cells were viewed on an Olympus IX70 inverted microscope and images were obtained using Image-Pro Plus 6.2 (Media Cybernetics Inc., Bethesda, MD).
Colony-Forming Assay and Alkaline Phosphatase Staining Inducible ESCs were seeded in a single-cell suspension at a density of 500 cells/plate onto 10 cm gelatin-coated tissue C AlphaMed Press 2013 V
culture plates in ESC media containing LIF as previously described [30, 34, 35]. Colonies were allowed to form over 7 days at 37 C. Plates were washed once with ice-cold phosphate buffered saline and fixed in 10% cold neutral formalin buffer (NFB: 10 ml formalin in 100 ml PBS) for 45 minutes at room temperature. NFB was removed and cells were washed three times with cold PBS. Alkaline phosphatase (ALP) stain was made by dissolving 0.01 g Naphthol AS MX-PO4 (N4875, Sigma) in 400 ml of N,N-dimethylformamide (Sigma), 25 ml 0.2 M Tris-HCl (pH 5 8.3) and 0.06 g red violet lysogeny broth salt in 25 ml ddH2O and filtered through Whatman’s No. 1 filter paper. ALP stain was added to the fixed ESCs and incubated for 45 minutes at room temperature. Stained cells were washed three times with PBS and imaged with the microscope and software described above. ESC colonies were categorized as undifferentiated if the colony stained positive for ALP expression and had the rounded, smoothedged morphology of undifferentiated ESCs, partially undifferentiated if the colony was stained positive for ALP expression in the center with flattened edges of differentiated ESCs, and fully differentiated if the colony was large and flattened with little or no ALP expression.
Microarray Hybridization and Analysis Total RNA was isolated from R1 ESCs transfected with p/CIP siRNA1 or 2, or nonspecific RNA as a control, as described above. Duplicate experiments were performed. All sample labeling and GeneChip processing were performed at the London Regional Genomic Centre (Robarts Research Institute, London, ON, Canada; http://www.lrgc.ca). RNA quality was assessed using the Agilent 2100 Bioanalyzer (Agilent Technologies Inc., Palo Alto, CA) and the RNA 6000 Nano kit (Caliper Life Sciences, Mountain View, CA). cDNA was synthesized from each sample, end labeled, and hybridized to Mouse Gene 1.0 ST arrays. GeneChips were scanned with the GeneChip Scanner 3000 7G (Affymetrix, Santa Clara, CA). Probe level (.CEL file) data were generated using Affymetrix Comman Console v1.1 and summarized to gene level data in Partek Genomics Suite v6.5 (Partek, St. Louis, MO) using the Robust Multi-Array algorithm adjusted for GC content [36]. Partek was used to determine gene level ANOVA p-values and fold changes using a v2 test. A list of genes exhibiting a greater than 1.5-fold change in expression with a p-value 1.5-fold, p < .05) in both replicates for each siRNA. From this preliminary list, those genes that were common to both siRNAs were identified. By this approach, 42 downregulated genes and 5 upregulated genes were identified (Fig. 3B) and are listed in Table 1. Ingenuity functional analysis was used to analyze the nature of the genes identified from the microarray screen (Fig. 3C). This analysis identified genes involved in various aspects of cancer including cellular growth and proliferation, cell cycle, and cell death. Additionally, genes related to tissue development and morphology, embryonic development, and gene expression were also identified. Consistent with the qRT-PCR data, we observed no significant changes in Oct4 or Sox2 levels following p/CIP knockdown. However, although it did not make the final list of genes due to the stringency used in analysis, there was an approximate 1.25fold downregulation of Nanog expression that was statistically significant (p < .05) for both siRNAs (data not shown). Interestingly, the list of downregulated genes contained a number of genes encoding transcription factors that have been STEM CELLS
Chitilian, Thillainadesan, Manias et al.
209
Figure 2. Effects of p/CIP knockdown on expression of core pluripotency factors. (A): Expression of p/CIP, Oct4, Nanog, and Sox2 in R1 mouse embryonic stem cells following 48-hour p/CIP knockdown. Two individual siRNAs targeting distinct regions of the p/CIP transcript were used. Data are expressed relative to the values for cells transfected with nonspecific control siRNA, and are presented as the mean 6 SD of three independent experiments. *, p < .05; ***, p < .005. (B): Western blot analysis of p/CIP, Oct4, Nanog, and Sox2 protein expression levels following 48-hour p/CIP knockdown using two individual siRNAs specific for p/CIP. Cells transfected with nonspecific siRNA were used as a control. aTubulin was used as a loading control. Quantification of protein expression in cells transfected with specific siRNA relative to cells transfected with nonspecific control siRNA, after correction for aTubulin expression, is shown below each blot. (C): Chromatin immunoprecipitation (ChIP) analysis of the promoter regions of Oct4, Sox2, and Nanog. ChIP-enriched DNA was analyzed by quantitative PCR using specific primers flanking the 1kb promoter regions of Oct4, Sox2, and Nanog. For quantitative PCR analysis, IgG ChIP values were negligible and have been subtracted from specific IP values. The resulting value is presented as a percentage of input DNA. The results shown are representative of two independent experiments.
identified as essential regulators of self-renewal and pluripotency, including Klf4, Tbx3, and Dax-1(Nr0b1) [11, 40, 41].
p/CIP Directly Regulates Klf4, Tbx3, and Dax1 in mESCs Kruppel-like factor 4 (Klf4), an essential transcription factor for somatic cell reprogramming [42], co-operates with Oct4 and Sox2 in ESCs to activate a particular set of target genes [43], and has been shown to function upstream of Nanog in ESC selfrenewal and in preventing differentiation [44]. Meanwhile, transcription factor box 3 (Tbx3) plays an essential role in the maintenance of pluripotency by blocking differentiation into epiblastderived lineages [40]. Similar to Klf4, Tbx3 is a fast responding mediator of LIF signaling that sustains the core pluripotency network through the direct activation of Nanog [11]. The orphan nuclear receptor Dax-1, which has been shown to be directly regulated by Nanog, Oct4, and Stat3 [31, 45], functions as part of the extended core gene regulatory network that governs ESC fate where it interacts with other essential transcription factors to regulate a common set of genes involved in self-renewal and pluripotency [17, 45, 46]. Dax-1 has also demonstrated independent repressor function at differentiation genes [41]. Due to the requirement of these critical factors for the maintenance of
www.StemCells.com
ESC self-renewal and pluripotency, of the genes identified as being downregulated following p/CIP depletion, Klf4, Tbx3, and Dax1 were selected for further analysis to provide insight into p/ CIP function in ESCs. To validate the results of the microarray, qRT-PCR analysis was performed to assess changes in mRNA expression levels of Klf4, Tbx3, and Dax1, following p/CIP knockdown. In accordance with the expression data, the expression levels of each of these genes in p/CIP knockdown cells were significantly downregulated by approximately 50%, 60%, and 65%, respectively, compared to control cells (Fig. 4A). In order to determine whether p/CIP regulates these genes directly, ChIP experiments were conducted using an antibody specific to p/CIP. qPCR analysis of immunoprecipitated DNA using specific primers flanking the promoter regions of selected pluripotency genes within 1 kb upstream of their transcriptional start sites (TSS) demonstrates that p/CIP binds to each of these gene promoters (Fig. 4B). Together, these results suggest that p/CIP directly regulates transcription of Klf4, Tbx3, and Dax-1 in a positive manner. Given the requirement of these genes for the maintenance of pluripotency in mESCs, p/ CIP may contribute to the maintenance of pluripotency through the direct activation of these essential transcription factors that function cooperatively with the core pluripotency network. C AlphaMed Press 2013 V
210
NCoA3 and Stem Cell Pluripotency
Figure 3. Microarray expression analysis of global changes in gene expression following p/CIP knockdown in embryonic stem cells. (A): Western blot confirming successful knockdown of p/CIP using two individual siRNAs (siRNA1 and siRNA2) targeting distinct regions of the p/ CIP transcript. Nonspecific siRNA was used as a control. (B): Venn diagrams depicting the overlap in genes significantly downregulated or upregulated from cells transfected with either siRNA1 or siRNA2. RNA was isolated after 48 hours and reverse transcribed to cDNA, which was then labeled and hybridized to Mouse 1.0 ST Affymetrix arrays. Genes considered to be significantly altered were those demonstrating greater than 1.5-fold change with p-values
