In Vivo Consumption of Cranberry Exerts ex Vivo ... - ACS Publications

Article pubs.acs.org/JAFC

In Vivo Consumption of Cranberry Exerts ex Vivo Antiadhesive Activity against FimH-Dominated Uropathogenic Escherichia coli: A Combined in Vivo, ex Vivo, and in Vitro Study of an Extract from Vaccinium macrocarpon Nasli Rafsanjany,† Jandirk Senker,† Simone Brandt,† Ulrich Dobrindt,§ and Andreas Hensel*,† †

Institute of Pharmaceutical Biology and Phytochemistry, University of Münster, Corrensstrasse 48, D-48149 Münster, Germany Institute of Hygiene, University Hospital Münster, Mendelstraße 7, D-48149 Münster, Germany

§

S Supporting Information *

ABSTRACT: For investigation of the molecular interaction of cranberry extract with adhesins of uropathogenic Escherichia coli (UPEC), urine from four volunteers consuming standardized cranberry extract (proanthocyanidin content = 1.24%) was analyzed within ex vivo experiments, indicating time-dependent significant inhibition of 40−50% of bacterial adhesion of UPEC strain NU14 to human T24 bladder cells. Under in vitro conditions a dose-dependent increase in bacterial adhesion was observed with proanthocyanidin-enriched cranberry Vaccinium macrocarpon extract (proanthocyanidin content = 21%). Confocal laser scanning microscopy and scanning electron microscopy proved that V.m. extract led to the formation of bacterial clusters on the outer plasma membrane of the host cells without subsequent internalization. This agglomerating activity was not observed when a PAC-depleted extract (V.m. extract≠PAC) was used, which showed significant inhibition of bacterial adhesion in cases where type 1 fimbriae dominated and mannose-sensitive UPEC strain NU14 was used. V.m. extract≠PAC had no inhibitory activity against P- and F1C-fimbriae dominated strain 2980. Quantitative gene expression analysis indicated that PAC-containing as well as PAC-depleted cranberry extracts increased the f imH expression in NU14 as part of a feedback mechanism after blocking FimH. For strain 2980 the PAC-containing extract led to up-regulation of P- and F1C-fimbriae, whereas the PAC-depleted extract had no influence on gene expression. V.m. and V.m. extract≠PAC did not influence biofilm and curli formation in UPEC strains NU14 and 2980. These data lead to the conclusion that also proanthocyanidin-free cranberry extracts exert antiadhesive activity by interaction with mannose-sensitive type 1 fimbriae of UPEC. KEYWORDS: adhesion, bladder cells, cranberry, fimH, gene expression, proanthocyanidins, uropathogenic E. coli, UPEC

■

interfering with fimbriae assembly,3 probiotics,4 or vaccination are still under development. In this context the consumption of herbal materials is widely used in patients with recurrent UTI, and especially the use of cranberry extract (Vaccinium macrocarpon Ait.) is recommended in traditional medicine and functional food products. Cranberry, a fruit from a native North American shrub, has been investigated within a number of preclinical and clinical studies for prevention of UTI. Cranberry extracts are claimed to inhibit UPEC attachment to bladder epithelial cells,5 and also the inhibition of flagellin gene ( f liC) has been described.6 Further investigations by protein assays on the structure−response relationship determined that A-type proanthocyanidin trimers (PAC) inhibit the adhesion of UPEC by binding to P-receptorcoated beads with immobilized [α-D-Gal-(1−4)-β-D-Gal]disaccharide.6,7 Additionally, effects of cranberry extracts on bacterial biofilm formation have been discussed with nonconvincing and contradictory results.8,9 Tapiainen et al.10 observed even

INTRODUCTION Uncomplicated urinary tract infections (UTI) are one of the most common infectious diseases, caused in 90% of all cases by uropathogenic Escherichia coli (UPEC). The infectious process is mediated by a variety of bacterial virulence factors, including adhesins, toxins, host defense evasion system, and a specific iron acquisition system, besides some highly specialized proteins for improved adaption to the host cells; Table 1 reviews the most prominent virulence factors (VF) and their specific functions and features. During infection of the host cell initially specific cell surface-associated proteins, the bacterial adhesins, enable UPEC to recognize complementary antigens of the eukaryotic cell and attach to the surface of the urinary epithelium. This step is followed by bacterial invasion, which leads subsequently to inflammation. Additionally, UPEC-induced exfoliation of the host cells permits UPEC to colonize and persist in the urinary tract.1 This leads to a reduced barrier function and is one of the main reasons for long-term persistence of UPEC within the urinary tract with a high recurrence rate (for a review, see ref 1). Antibiotics are used as standard treatment for UTI,2 but antibacterial resistance and high recurrence rates emphasize the importance of developing alternative preventive therapy strategies. Inhibition of bacterial attachment by FimH inhibitors © 2015 American Chemical Society

Received: Revised: Accepted: Published: 8804

June 19, 2015 September 1, 2015 September 2, 2015 September 2, 2015 DOI: 10.1021/acs.jafc.5b03030 J. Agric. Food Chem. 2015, 63, 8804−8818

adhesion to mucosal epithelium adhesion promotes colonization of perneal area, biofilm formation, adhesion

adhesion adhesion autotransporter that promotes cell aggregation and the formation of biofilms, adhesion to bladder epithelial cells

foc dra

afa nfa csg

bma

F1C fimbrae Dr fimbriae

afimbrial adhesin nonfimbrial adhesin thin aggregative fimbriae (curli) M-adhesin G-adhesin UPEC autotransporter adhesin

8805

aerobactin siderophore enterobactin siderophore hemin uptake system salmochelin siderophore yersiniabactin siderophore

cytotoxicity

growth under iron growth under iron heme transporter growth under iron growth under iron

iutA ent chu iro f yuA restriction restriction

restriction restriction

4. Iron Acquisition System

cytotoxicity

vat

cdt

cytotoxicity

hly cnf

α-hemolysin cytotoxic necrotizing factor secreted autotransporter toxin vacuolating autotransporter toxin cytolethal distending toxin

sat

-

TcpC

endotoxic effects, cytokine induction, serum resistance, immunoadjuvant, leading to inflammation and exfoliation of host cells confers resistance to killing of bacteria by serum (membrane attack system (MAC) of the complement); it can function individually or combined with effects of capsular polysaccharide, O-polysaccharide side chains, and surface proteins TcpC suppresses innate immunity by homology to TIR domain of TLR 3. Toxins cytotoxicity, hemolysis interference with phagocytosis and apoptosis

rfa, rfb, rfc

colV, traT

kps

capsular polysaccharide (K antigen) lipopolysaccharide (LPS; O-antigen) serum resistance

2. Host Defense Evasion antiphagocytic, anticomplement, and involved in serum resistance

adhesion to mucosal and endothelial cells, cytokine induction involved in adhesion and invasion

sfa

S fimbriae

upa

mediates mannose-resistant adhesion, cytokine induction; present in 40−60% of UPEC isolates, identified in 80% of pyelonephritis-causing UPEC adhesion to bladder, kidney mucosal epithelium and to brain endothelium, involved in NMEC

pap

P fimbriae

1. Adhesins

mediates mannose-sensitive adhesion in urinary tract epithelium and tissue matrix, invasion, biofilm formation; present in >90% of patients

functions

f im

gene

type 1 fimbriae

virulence factor

Table 1. Overview on the Main Virulence Factors of Uropathogenic E. coli

hydroxamate type/localization: exported catechol type/localization: exported localization: exported catechol type/localization: exported localization: exported

localization: exported



toxin of Rtx type/localization: exported localization: exported

localization: cell surface, involved proteins: Iss, TraT, Bor

localization: cell surface

localization: cell surface

host receptor specificity mannosylated glycoproteins (e.g., UPIa and CD48), Tamm− Horsfall protein, type I and type IV collagens, laminin, fibronectin GbO3, GbO4, GbO5; P-blood group antigen specific glycosphingolipids (α-D-Gal-(1→4)-β-D-Gal) neuraminic acids/sialic acid residues, plasminogen/β-GalNac(1→4)-β-Gal lactosylceramide containing glycolipids, β-GalNac-(1→4)-β-Gal Dr blood group antigen present on the complement cascade regulator factor, DAF (CD55), CD66e, type IV collagen, α5β1 integrin decay accelerating factor (DAF) glycophorin A matrix and plasma proteins (fibronectin, laminin, plasminogen, H-kininogen) AM determinant of M blood group antigen GlcNac fibronectin, laminin/localization: cell surface

features

Journal of Agricultural and Food Chemistry Article

DOI: 10.1021/acs.jafc.5b03030 J. Agric. Food Chem. 2015, 63, 8804−8818

Article

Journal of Agricultural and Food Chemistry

localization: exported localization: cell surface

motility, fitness, facilitates ascending route receptor and transport function, OmpA is involved in bacterial invasion by facilitating IBC maturation and chronic bacterial persistence urine growth factor autoaggregation phenotype of UPEC during biofilm formation, autotransporter

■

MATERIALS AND METHODS

f liC ireA, iha, ompA/C/T guaA/argC f lu

Materials. If not stated otherwise, solvents, reagents, and consumables were obtained from VWR International (Darmstadt, Germany). All solvents and reagents were of analytical quality. Water was produced by a MilliporeSimplicity 185 system (Schwalbach, Germany). The cranberry dry extract (Extract High PAC Special, batch 903514/ product code HC23174; Frutarom, Londerzeel, Belgium) from the fruits of V. macrocarpon Ait. is certified for use as a food product. A voucher sample (IPBP-281) has been stored in the archives of the Institute of Pharmaceutical Biology and Phytochemistry, University of Münster, Germany. Preparation of V. macrocarpon. (V.m.) Extract. Cranberry dry extract contained excipients to ensure optimal powder technology, which were insoluble in EtOH/water (1:1, v/v). These compounds were removed from 20 g of the dry extract after rotor-stator homogenization by Ultraturrax (Ika, Staufen, Germany) in 200 mL of EtOH/ water (1:1, v/v) three times for 5 min. The suspension was centrifuged for 5 min at 3000g. The remaining residue was re-extracted again three times until the insoluble material was colorless. The combined extracts were lyophilized. The dried extract was stored under an argon atmosphere at −20 °C and is termed in the following as V.m. extract. Proanthocyanidins in V.m. extract were quantified according to the European Pharmacopeia16 and the content of PACs calculated as cyanidine. Quantification was performed with n = 6 independent determinations, using 350 mg of V.m. extract.

flagellum (H-antigen) outer membrane proteins CPA24/CP1 antigen 43

virulence factor

Table 1. continued

gene

functions

5. Others

localization: cell surface ;ocalization: cell surface

features

increased biofilm formation after in vivo intake of cranberry juice for 20% of the UPEC strains. With regard to the clinical efficacy, a recent Cochrane metastudy concluded that cranberry products are not significantly different from standard antibiotic treatment for preventing UTI, but the evidence for a potentially significant benefit seems too small for a clear recommendation for the prevention of UTI.11 One major reason for this nonconvincing outcome of the Cochrane review is the use of nonstandardized cranberry products for clinical investigations and the high drop-out numbers of patients during the long-term studies. The need for the development of quantified and standardized cranberry preparations is therefore obvious.11 During examination of the very complex literature published on cranberry activity against UPEC, we found it astonishing that most of the authors claim PACs to be responsible for the antiadhesive activity.7 On the other hand, recent studies have shown that PACs are absorbed over the intestinal barrier only to a very limited extent and, in principle, are not bioavailable in relevant concentrations.12,13 Interestingly, polyphenols known to be microbial-derived metabolites of PACs such as phenylacetic acid, 3,4-dihydroxyphenylacetic acid, and catechol have recently been identified as antiadhesive compounds against UPEC,14 and also myricetin has been pinpointed as an antiadhesive compound in human urine from volunteers after cranberry uptake.15 From the current state of knowledge it might be assumed that PACs are not dominantly responsible for the antiadhesive effects of cranberry, whereas PAC metabolites, formed during the intestinal passage, or cranberry-associated flavonoids are bioavailable to a significant extent and can be found as potential antiadhesive compounds in the urine. The purpose of this investigation was to initiate studies for systematic evaluation of (i) the influence of PAC-containing and PAC-depleted cranberry extracts on the bacterial adhesion of UPEC to bladder cells in ex vivo studies and (ii) the influence of PAC-containing and PAC-depleted cranberry extracts on UPEC virulence factors.

8806


Article

Journal of Agricultural and Food Chemistry Preparation of V.m. Extract≠PAC. One hundred milligrams of V.m. extract was dissolved in 100 mL of water. One thousand milligrams of Polyclar AT (G.A.F. Corp., USA), a water-insoluble polyvinylpyrrolidone, was added. Polyphenols were precipitated under gentle stirring of the reaction vessel for 30 min. The suspension was centrifuged at 3000g for 5 min. The supernatant was filtered through a paper filter, and clear filtrates were combined, evaporated, and lyophilized to yield 66 mg of V.m. extract≠PAC. Proanthocyanidin depletion was proven by thin layer chromatography, using vanillin−hydrochloric acid reagent for specific PAC detection. LC-MS Dereplication of V.m. Extracts. For the preparation of LC-MS samples, V.m. extract and V.m. extract≠PAC were dissolved in methanol to a concentration of 10 mg/mL. Separation was performed on a Dionex Ultimate 3000 RS liquid chromatography system over a Dionex Acclaim RSLC 120, C18 column (2.1 × 100 mm, 2.2 μm) with a binary gradient (A, water with 0.1% formic acid; B, acetonitrile with 0.1% formic acid) at 0.4 mL/min: 0−5 min, isocratic at 5% B; 5−37 min, linear from 5 to 100% B; 37−47 min, isocratic at 100% B; 47−48 min, linear from 100 to 5% B; 48−55 min, isocratic at 5% B. The injection volume was 2 μL. Eluted compounds were detected using a Dionex Ultimate DAD-3000 RS over a wavelength range of 200−800 nm and a Bruker Daltonics micrOTOF-QII time-of-flight mass spectrometer equipped with an Apollo electrospray ionization source in positive mode at 2 Hz over a mass range of m/z 50−1500 using the following instrument settings: nebulizer gas nitrogen, 4 bar; dry gas nitrogen, 9 L/min, 200 °C; capillary voltage, −4500 V; end plate offset, −500 V; transfer time, 100 μs; prepulse storage, 6 μs; collision energy, 8 eV. MS/MS scans were triggered by AutoMS2 settings within a range of m/z 200−1500, using a collision energy of 40 eV and a collision cell RF of 130 Vpp. Internal data set calibration (HPC mode) was performed for each analysis using the mass spectrum of a 10 mM solution of sodium formate in 50% isopropanol that was infused during LC re-equilibration using a divert valve equipped with a 20 μL sample loop. Manufacture of Cranberry Extract-Containing Capsules. Cranberry dry extract, certified as a food product for use in humans, was used for the ex vivo pilot study. Encapsulation of 150 mg of extract, without addition of further additives, was performed into hard gelatin capsules (size 0/cream colored, batch 13E27-N13; WEPA, Hilscheid, Germany). The uniformity of mass of single-dose preparations was analyzed by a weight variation test according to the requirements of the European Pharmacopoeia.17 Capsules were stored in plastic containers protected from heat and light at room temperature. Study Design. Four male individuals, who gave informed consent, volunteered to consume cranberry capsules over a 7 day period, with urine sampling at days 0, 3, and 7 for ex vivo studies. Exclusion criteria included antibiotic treatment 2 weeks prior to and during the study. Before starting the trial, the volunteers were instructed to abstain from consumption of any other products containing cranberry or phytochemically or botanically similar fruits (especially from the plant family Ericaceae) 2 weeks before and during the study. Each subject was asked to take two cranberry capsules of 150 mg in the morning and in the evening after a meal, equivalent to 600 mg of cranberry extract per day for 7 days. Generally, the first midstream urine of the day was collected and used for functional and analytical investigations. A control urine sample (S0) was collected prior to the consumption of the capsules. The second urine sample (S1) was collected at day 3 of medication, and the third sample (S2) was collected on the last day of cranberry capsule intake. The urine samples were centrifuged at 3000g for 5 min, filtered (0.22 μm pore size), and stored at −20 °C until use. Cell Culture and Microbiology. T24 cells (ATCC HTB-4) represent a human epithelial bladder cell line, derived from the bladder carcinoma of an 82-year-old Swedish female.18 These cells have been already demonstrated to be suitable for adhesion and invasion in vitro assays with UPEC19 and were kindly provided by Prof. Straube (University of Jena, Germany). The influence of test compounds on the viability of T24 cells was monitored by MTT assay.20 T24 cells were seeded in 96-well plates with 2.5 × 104 cells per well (100 μL) and incubated for 24 h at 37 °C with 5% CO2. T24 cells were washed with 200 μL/well PBS. Incubation of the cells with test extracts (100 μL) was performed for 24 h at 37 °C with 5% CO2. After the incubation with

extracts, the supernatant was removed and cells were washed twice with PBS, 200 μL/well. Fifty microliters of MTT reagent was added to each well, and the 96-well plate was incubated for a further 4 h at 37 °C/5% CO2. MTT reagent was tapped off the 96-well plate, and 50 μL of DMSO was added to dissolve the formazan crystals. After the plate had been shaken for 10 min, the absorption of the formazan was determined at λ = 492 nm and a reference wavelength of λ = 690 nm. Bacterial strains included E. coli strain 2980 (DSM 10791), provided by Prof. Straube (University of Jena, Germany); UPEC NU14, a clinical cystitis isolate, provided by Prof. Dobrindt (University of Münster, Germany); and J96 provided by Inga Benz (University of Münster, Germany). Bacteria from passages 2 to 4 were used for all tests and were cultivated from frozen stocks. For adhesion assays agar-grown bacteria were harvested and used for inoculation of Loeb agar supplemented with 0.2% CaCl2, which is supposed to increase the type 1 fimbria expression.21 For liquid culture 1 colony-forming unit (CFU) of agar-grown bacteria was transferred to 10 mL of UPEC broth in 50 mL tubes and incubated under shaking (200 rpm/37 °C) until mid-logarithmic phase. For the agar diffusion assay, agar-grown bacteria were harvested, suspended in sterile PBS, and adjusted to an OD640 nm of 0.2/mL. One hundred microliters of the bacterial suspension was transferred to a Loeb agar plate and spread homogeneously. Subsequently, five sterile BD Sensi-Disks (BD Biosciences, Franklin Lakes, NJ, USA) were distributed circularly in equal intervals on the agar plate with sterile tweezers. Twenty microliters of the respective test solutions (sterile filtered, 0.22 μm) were pipetted on the disks. Norfloxacin (50 μg/mL) (Fluka, Buchs, Switzerland) served as positive control. Plates were incubated for 48 h at 37 °C. To monitor bacterial growth in liquid culture, 1 CFU of agar-grown bacteria was suspended in 10 mL of liquid medium and cultivated overnight in an incubator rotary shaker (200 rpm at 37 °C). Bacteria were adjusted to an OD640 nm of 1.0/mL in liquid medium and pipetted in 100 μL aliquots into a 96-well plate. Additionally, 100 μL of fresh liquid medium was added to the wells plus 50 μL of sterile filtered (0.22 μm) test solution. Liquid medium served as negative control, and gentamicin (100 μg/mL) (PAA, Pasching, Austria) was used as positive control. The plate was incubated at 37 °C, and bacterial growth was monitored by measuring the optical density every 30 min over a 6 h period at λ = 640 nm. Adhesion Assay with Urine Samples by Quantitative Flow Cytometry. In general, FITC labeling of UPEC and flow cytometric adhesion assay was performed as described in refs 22 and 23. T24 cells (2.5 × 105 cells/well) were seeded in 6-well plates and incubated at 37 °C and 5% CO2 until 90% confluence was reached (corresponding to 800,000 cells, after approximately 24 h of incubation). After this incubation, T24 cell culture medium was removed, cells were washed once with PBS, and 2 mL of DMEM was added to each well. All further steps with FITC-labeled E. coli (OD640 nm 0.4/1000 μL (corresponding to 8 × 107 CFU/mL) were carried out under light protection. For adhesion experiments a bacterial cell ratio (BCR) of 100:1 was used. After addition of UPEC to T24 cells, the interaction was accelerated by short centrifugation (200g, 1 min) of the 6-well plate, followed by 2 h of incubation at 37 °C. Subsequently, unattached UPEC were removed by gently washing the T24 cells three times with 1 mL of PBS/well. T24 cells were detached by the addition of 600 μL trypsin/EDTA for 3 min at 37 °C. Trypsination was stopped by the addition of 2 mL of DMEM. The content of each well was transferred to tubes and centrifuged for 5 min at 400g. The supernatant was discarded and the cell pellet suspended, dependent on the visually observable size of the pellet, in 500−1000 μL of PBS. Finally, the fluorescence of the cell suspension was measured by flow cytometer. For data evaluation 10000 counts for each sample were used. For quantitative in vitro flow cytometric adhesion assay with urine samples the adhesion assay was performed similarly to the assay described above with the following changes to the described protocol: 10 mL of sterile urine, containing 5% of UPEC liquid medium, was inoculated with 1 CFU of agar-grown bacteria and incubated in a rotary shaker (200 rpm at 37 °C) until mid-logarithmic growth phase was reached. In pre-experiments the growth rate of E. coli in urine, supplemented with 5% broth, had been monitored, revealing 8807


Article


eluted RNA were determined by measuring the samples at λ = 260 nm and λ = 280 nm by using a BioPhotometer plus and a μCuvette G1.0 (both Eppendorf, Germany). Potential coeluted DNA was digested by treatment of the isolated RNA with DNase I (Life Technologies, USA) for 15 min at room temperature followed by an inactivation of the enzyme by the addition of EDTA and heating to 65 °C for 10 min. After DNA digestion, samples were controlled again by measuring the OD260 nm and OD280 nm. For each RNA sample, 0.5 μg of RNA was transcribed into cDNA by using the Masterscript Kit (5 Prime, Germany) and a random hexamer primer (Thermo Scientific, USA) following the manufacturer’s instructions. Here, minus-room temperature controls were also performed, which did not comprise the reverse transcriptase during cDNA synthesis. Quantitative Real-Time PCR (qRT-PCR). qRT-PCR was performed with an equivalent of 25 ng of total RNA by using the iTaq Universal SYBR Green supermix (BioRad, Germany) according to the protocol recommended by the manufacturer and the CFX96 Real-Time System C1000 Touch (BioRad, Germany). The qPCR parameters were as follows: polymerase activation and initial denaturation for 15 s at 95 °C followed by 39 cycles of 5 s at 95 °C and 30 s at 60 °C. Afterward, an additional melt curve analysis was performed (65−95 °C, ramp 0.5 °C pro cycle, 1 cycle = 5 s, 60 cycles in total). Data were evaluated with the BioRad CFX Manager 3.0 software based on the comparative CT method (2−ΔΔCT method) and were normalized to the endogenous reference gene16S rRNA. Primers for the qPCR were designed with the Universal ProbeLibrary Assay design Center (Roche, Switzerland), and the oligonucleotides were obtained from Eurofins MWG Operon, Luxembourg. Primer sequences used for the differential gene expression analysis are listed in Table 2. Statistical Analysis. Statistical results were obtained by use of SPSS statistics (version 20) (IBM, Armonk, NY, USA). Results are expressed as the mean value (MV) ± standard deviation (±SD). Data (n ≥ 3) were processed by analysis of variance (one-way ANOVA). A subsequent post hoc test was conducted using Dunnett’s test (two-sided) to determine the statistical significance of differences between mean values of two with each other compared groups. P values 80% of non-cranberry excipients to ensure

sequence: 5′→3′

afaE1-f afaE1-r

433882

CCAAGACGGCGGTGTATATTA TCGTACGATGAACACCATCTG

afaE2-f afaE2-r

299929324

GGAACCTCAAGGGCACAA ACTGGAATGAAGCTCGTTTTG

afaE3-f afaE3-r

55670384

ACGACCGACAATGGTGTCTT CTACGTAGATCCCGATAGTTCCA

agn 43-f agn 43-r

386261151

TGGCACCATCAGCCTGCGTG CGTACCACTGTTGCCGGCGT

csgA-f csgA-r

190907313

GTAGCAGCAATTGCAGCAATCG TTAGATGCAGTCTGGTCAACAG

f imH-f f imH-r

3286745

CAATGGTACCGCAATCCCTA GCAGGCGCAAGGTTTACA

f liC-f f liC-r

26108594

ACAGCCTCTCGCTGATCACTCAAA GCGCTGTTAATACGCAAGCCAGAA

focG-f focG-r

239708

TGGCCACCGGTCTTATTAAC CCCTCCCTGTAACAGTAATCGT

hlyA-f hlyA-r

146377

TTGCTTCTGTTGTGACACT CTCTATTTTATTGGCACGTTTA

nfa-f nfa-r

7239822

TGAATCTCGTTACCCCGAAC GTGATTTCGCGGTTTGCTA

papGI-f papGI-r

42290

GTCAGGCGGTAATGATGCTT TCGTTAAAAGCATAAAACATGACATT

papGII-f papGII-r

147093

GAAATTTTCGGTTGGTCTGG TCCACCCCGTTAACTGAAAC

papGIII-f papGIII-r

7407206

AGCAATTTTCGGTTGGTCTG TCCACGCCATTAATCGAAAT

prsGIII-f prsGIII-r

42529

CAATTTTCGGTTGGTCTGG CGATGGTCAGGTTTTGTG

sfaS-f sfaS-r

S53210

CCCGTCACAGTAATCGTCGT CCCGTCACAGTAATCGTCGT

16S rRNA-f 16S rRNA-r

85674274

GGCGCATACAAAGAGAAG ATGGAGTCGAGTTGCAGA

f, forward primer; r, reverse primer; ref, reference.

inhibition of bacterial adhesion was obvious for S1 (−39%) and S2 (−48%) compared to the control samples S0. These data clearly indicate in vivo antiadhesive activity of the cranberry extract and confirmed a similar study on antiadhesive properties of urine obtained after the ingestion of cranberry preparations.32 Molecular Characterization of UPEC Strains. For detailed in vitro investigations on these antiadhesive effects three different UPEC strains were investigated and characterized. Strain J96, isolated from a human patient with pyelonephritis and frequently used in UTI research, has been described to carry the genes coding for type 1 fimbriae ( f imH), P fimbriae (papGI/III), and 8809


Article


Figure 1. HPLC-UV chromatograms of V.m. extract (upper plot) and V.m. extract≠PAC (lower plot) (λ = 280 nm). Peak assignment by MS. See Table 3.

optimized free floating powder technology, EtOH/water (1:1, v/v) soluble compounds were extracted. The resulting lyophilized product, V.m. extract, had a PAC content of 21.1 ± 1.9%, HPLC fingerprint as displayed in Figure 1, and compound dereplication as displayed in Table 3.V.m. extract was investigated for potential cytotoxic effects against E. coli 2980 by agar diffusion test over 24 h. Up to 1000 μg/mL, no inhibition of bacterial growth was observed (data not shown). V.m. extract up to concentrations of 250 μg/mL did not influence viability of eukaryotic T24 bladder cells over 24 h of incubation time as analyzed by MTT assay (data not shown). Treatment of E. coli 2980 and NU14 with V.m. extract (10− 100 μg/mL), addition of the suspension to T24 cells, and evaluation of bacterial adhesion to the host cells by flow cytometry resulted in a concentration-dependent increase in bacterial adhesion, due to the aggregation and clustering of the bacteria. Comparable results were also obtained in the case of a 2 h preincubation of E. coli 2980 with V.m. extract, followed by removal of extract components by successive washing steps prior to the addition of the V.m. extract-pretreated bacteria to the T24 cells (Figure 4). Semiquantitative evaluation of these data obtained by fluorescence microscopy confirmed these findings and clearly indicated a huge bacterial burden attached to the bladder cells (Figure 5). Laser scanning microscopy was performed for investigating the localization of UPEC within the T24 cells. A top view of the cells indicated strongly individualized UPEC on the cell surface in the untreated control group, whereas bacterial clusters were

visible for the V.m. extract (25 μg/mL) treated groups (Supplementary Data Figure S2). Systematic section scanning of the monolayer preparations (30 steps, 0.2 μm) demonstrated the occurrence of mainly intracellular bacteria for the untreated control (Figure 6, series A) with most bacteria found within the cytoplasm (1−3 μm). In contrast, most of the bacteria in the V.m. extract-treated groups were detected as clusters on the cell surface (4−5 μm), whereas nearly no bacterial internalization was observed (Figure 6, series B). To prove that V.m. extract leads to increased formation of UPEC clusters on the surface of the bladder cells, a third methodology, scanning electron microscopy (SEM), was performed. As expected, untreated control cells showed individualized bacteria on the cell surface (Figure 6A), whereas V.m. extracttreated UPEC formed clusters (Figure 7B). Increased magnification proved the presence of agglomerates (Figure 7C), and also the integration of the bacteria within a thin meshed film network was observed (Figure 7D). From these data it was concluded that V.m. extract at low concentrations under in vitro condition has the ability to agglomerate UPEC, which are strongly fixed to the T24 cell surface, and cannot be removed by repeated washing steps. From these data a strong tendency of agglomeration of bacteria by cranberry extract was obvious. This phenomenon was also reproduced using different cranberry extracts from different suppliers and also by cranberry extract prepared directly from fresh fruits. 8810


Article


Table 3. LC-qTOF-MS Peak Characteristics As Obtained by Integrating a UV Chromatogram of V. m. Extract (λ = 280 nm)a peak

tR (min)

m/z (ion)

ion

1 2 3

1.29 1.94 2.51

na 149.0207 339.1021

na base peak M + Na

4 5 6 7 8 9 10 11 12 13

3.49 5.97 6.63 7.27 8.49 9.28 9.63 10.46 10.83 11.00

349.0912 365.0860 355.1043 349.0906 307.0802 439.1237 379.1012 463.1263 545.1964 433.1157 865.2033

M + Na M + Na M+H M + Na M + Na M + Na base peak M+ M + Na M+ M+H

14

11.13

373.1151

M+H

15 16 17 18 19 20 21 22 23 24 25

11.30 11.62 11.72 11.84 12.03 12.28 12.37 12.56 12.73 12.79 12.92

1153.2661 481.1035 457.1166 865.2031 177.0593 451.0919 451.0904 465.1089 545.2085 577.1380 561.1641

26

13.02

27 28 29 30

13.16 13.24 13.34 13.55

31 32 33 34 35 36 37 38 39 40 41

M+H M+H base peak M+H base peak M+H M+H M+H base peak M+H M+Na

435.0951 561.1602

λmax (nm)

fragment m/z

217, 273 284 137 205, 216, 260, 295 165 287 181 298sh, 316 163 298sh, 319 165 na 163, 123, 105 234, 278 295, 285, 163, 133, 123, 105 234, 278 195 290, 328sh 301b 280, 516 165, 147 310 301b na 713, 695, 533, 413, 301, 287, 271, 280 259, 139b 197, 177 na

area fraction (%) 0.9 19.9 4.3 2.6 2.8 1.2 5.7 1.3 0.0 1.6 3.5 6.5 2.3

coumaroyl-hexose caffeoyl glucose chlorogenic acid coumaroyl-hexose benzoyl hexose benzoyl pentosylhexose not identified peonidin-3-galactoside coumaroyl derivative peonidin-3-arabinoside procyandin A-type trimer

0.8

dihydroferulic acid 4-O-β-Dglucuronide procyanidin A-type tetramer myricetin-3-β-galactoside not identified procyandin A-type trimer not identified myricetin-3-α-xylopyranoside myricetin-3-α-arabinofuranoside quercetin-3-β-galactoside not identified procyanidin A-type dimer 10-p-trans-coumaroyl-1Sdihydromonotropein quercetin-3-α-xylopyranoside 10-p-cis-coumaroyl-1Sdihydromonotropein quercetin-3-α-arabinopyranoside not identified quercetin-3-α-arabinofuranoside quercetin-3-rhamnopyranoside 3′-methylquercetin-3-β-galactoside dimethylmyricetin-hexoside myricetin methylquercetin-pentoside biochanin-A-7-O-glucoside prodelphinidin B4 myricetin-benzoylhexoside quercetin not identified quercetin-benzoylhexoside quercetin-3-O-(6″-benzoyl)-βgalactoside methylquercetin

287b, 425 377, 359, 147

280 258, 306sh, 355 265, 298 280 232, 299, 325 na 263. 355 257, 302sh, 354 230 280 na

0.7 2.8 0.6 0.8 0.5 0.7 0.9 5.3 3.3 5.6 1.5

M+H M + Na

303 377, 359, 341, 147

na 229. 314

3.7

M+H base peak M+H M+H M+H M+H M+H M+H M + Na M+H M+H M+H M+H M+H M+H

303

256, 304sh, 354 221, 275, 293 258, 306sh, 355 256, 306sh, 350 256, 306sh, 350 260, 357 255, 374 na 232, 298sh, 316 na 264, 360 257, 370 252, 372 n.a. 256, 355

0.7 0.8 1.8 1.5

13.63 14.02 14.32 15.10 15.18 15.47 15.47 15.89 16.07 16.35

435.0930 169.0515 435.0934 449.1062 479.1162 509.1305 319.0469 449.1066 469.1131 611.1416 585.1253 303.0510 333.0610 569.1288 569.1264

0.6 1.7 0.4 1.0 0.4 0.4 7.2 0.5 1.7 1.1

17.72

317.0657

M+H

255, 367

0.5

319 577 319 319 303

303 303 317 347 217, 153 317 267, 249, 163 319, 105b 257, 229, 201, 153, 137b 303 303, 105b

name

ref

not identified not identified not identified 31 31 31 31

27, 30 27, 30 27 31 27 28, 30, 31

28,30 28,30,31 28,30,31 27,31 29 28,30,31 29 28,30,31 28 28,30,31 28,31 28 30,31 28 31 31 30,31

28

a

Peaks were assigned to known constituents of V. macrocarpon as denominated in the refs27−31. Assignment of stereoisomers is based on published RP18 elution order and relative peak areas.27−31 Assignments without reference are based on the interpretation of MS, MS2, and UV spectra. Peaks 13, 26, and 30 are constituted of two compounds, respectively. Chemical structures are displayed in the cited literature. na, not accessible. bPreceding fragment m/z values were obtained from MS2-CID experiments (collision energy = 40 eV) or from peak background-corrected full MS spectra (ISCID 0 eV, collision energy = 8 eV).

cells; unattached bacteria were removed and cells fixed and stained with Giemsa. Bacterial adhesion was calculated throughout the literature by using light microscopy and determining the average number of bacteria attached to a certain number of human cells.36−40

At this point of the investigation this phenomenon seemed confusing in relation to already published data. Most publications on antiadhesive cranberry preparations used similar in vitro protocols: Bacteria were pre-incubated with extracts or test compounds (e.g., PACs), followed by incubation with bladder 8811


Article


but many areas, if not most, of the cell surface are free of bacteria or clusters. In cases when only these cluster-free parts of a cell are evaluated, a strongly reduced number of bacteria might be counted, compared to the untreated control groups where the bacterial load is distributed very regularly over the host cell surface. For these different reasons published data on antiadhesive cranberry activity should be reviewed very carefully concerning the respective quantitative evaluation protocols. On the other hand, it seems not very astonishing that PACenriched extracts should agglomerate bacteria by an unspecific, astringent, tannin-like effect. Another essential aspect is the limited absorption of PACs after oral intake: recent publications have shown that oligomeric PACs have a very limited bioavailability from the gut, which implies that these polyphenolic compounds will not appear in the lower urinary tract to a higher extent. To investigate the influence of PACs within the V.m. extract on bacterial adhesion, tannins were precipitated quantitatively from the extract by polyvinylpyrrolidone. From 100 mg of V.m. extract 66 mg of a PAC-free extract was obtained, designated in the following as V.m. extract≠PAC. TLC studies of this PAC-depleted extract indicated the absence of vanillin−HCl-positive spots, typically for flavan-3ols and PACs. Also, comparative HPLC-MS (Figure 1) studies against V.m. extract demonstrated the disappearance of PACs in V.m. extract≠PAC: PVP treatment removed the majority of polyphenolic substances from the extract, with anthocyanidins and flavonol aglyca depleted by 100% (below the limit of detection), anthocyans and flavonoid glycosides by 97%, phenylpropane glycosides by 56%, iridoid glycosides by 42%, and benzoyl glycosides by 5% (averaged values). Evaluation of the bacterial adhesion assay with V.m. extract≠PAC indicated that the agglomerating effects against UPEC on the T24 cell surface did not occur (Figure 4): strain 2980, treated with the PAC-depleted extract, did not show any differences compared to the untreated control groups (Figure 4A), whereas strain NU14, treated with V.m. extract≠PAC, showed significantly decreased adhesion to the host cells, which was similar to the inhibiting effect of the positive control, 10 mmol of mannose. From these experiments it can be deduced that PAC-free cranberry extracts can interact significantly and in a dose-dependent manner with the adhesion of UPEC to T24 cells, which should be due to a more or less specific effect against FimH adhesin. In contrast, P-fimbriae-mediated adhesion is not influenced by cranberry extracts. The finding that PACs are not responsible for the antiadhesive effects is also in accordance with recently published data indicating that after oral cranberry intake, myricetin derivatives have been identified in the urine, which again seem to exert significant antiadhesive effects against UPEC.41 On the other hand, V.m. extract≠PAC used in our study was also strongly depleted from myricetin, which again might indicate that other extract compounds are responsible for the antiadhesive activity of this extract. Influence of Cranberry Extracts of Gene Expression of Bacterial Adhesins. To investigate the influence of PACcontaining and PAC-depleted cranberry extracts on the gene expression of relevant bacterial adhesins, both E. coli strains 2980 and NU14 were treated with either V.m. or V.m. extract≠PAC (100 μg/mL) for 1.5 h in the presence or absence of T24 cells; gene expression was monitored by qRT-PCR. In the case of incubation of E. coli 2980 with V.m. extract in the absence of T24 cells papGII and focG, transcript levels were slightly up-regulated, whereas the transcript levels of papGIII remained unchanged (Figure 8A). In contrast, treatment of strain

Figure 2. Relative adhesion of UPEC, strain NU14, to T24 bladder cells after 3.5 h of cultivation of bacteria in urine obtained from cranberry extract treated volunteers (n = 4, 600 mg extract for 7 days). S0, control urine, prior to cranberry consumption; S1, urine obtained at day 3 during cranberry extract application; S2, urine obtained at day 7 during cranberry extract application. Data are related to the initial adhesion values determined for S0 (=100%). (∗∗) p < 0.01. Values represent the mean ± SD.

Figure 3. Relative gene expression of selected virulence factors from E. coli strain 2980 (A) and strain NU14 (B) as determined by qRT-PCR: comparison of relative expressions of focG, papGII, and papGIII (strain 2980) as well as f imH and papGIII (NU14) in UPEC incubated for 1.5 h in medium (alone) with bacteria incubated for 1.5 h in the presence of T24 cells. The relative expression of genes from bacteria in the absence of T24 cells (alone) has been set to 1. Expression levels have been normalized to the expression of the endogenous control gene 16S rRNA. (∗∗) p < 0.01. Values represent the mean ± SD of six independent assays with two technical replicates for each experiment.

We speculate that during this evaluation bacterial agglomerates or clusters were not taken in account as they appear typically as dark, undefinable, spots in the microscope. Additionally, when bacteria are agglomerated and clustered, this could also imply a lower number of individual bacteria for counting. Another bias could occur during microscopy: as shown by SEM (Figure 6) the cluster-bearing host cells have typically some areas where the bacteria are strongly agglomerated in a three-dimensional mash, 8812


Article


Figure 4. Influence of different concentrations of V.m. extract and V.m. extract≠PAC on the adhesion of FITC-labeled E. coli, strain 2980 (A) and strain NU14 (B) to T24 cells after 2 h of pre-incubation of bacteria with the extracts. Data indicate the adhesion related to the untreated control (UC = 100%). For strain NU14 (B) mannose (10 mmol) served as positive control (PC). (∗) p < 0.05 and (∗∗) p < 0.01. Values represent the mean ± SD of six independent assays.

Figure 5. Influence of different concentrations of V.m. extract (25−250 μg/mL) on the bacterial adhesion of FITC-labeled E. coli, strain 2980, against T24 bladder cells (BCR 115:1) after 2 h of pretreatment of E. coli as determined by fluorescence microscopy. Magnification: 10×. UC, untreated control.

2980 with V.m. extract≠PAC did not have any influence (Figure 8B). Similar experiments, but in the presence of T24 cells, indicated down-regulation of papGII and focG by V.m. extract (Figure 8A), whereas V.m. extract≠PAC in the presence of T24 cells did not influence gene expression (Figure 8B).

Incubation of E. coli NU14 with V.m. extract had almost no impact on the gene expression level of adhesins (Figure 8C). Only the expression of f imH was slightly increased when bacteria were incubated in the absence of T24 cells. In contrast, V.m. extract≠PAC induced transcription of f imH, whereas papGIII 8813


Article


Figure 6. Sectional confocal laser scanning microscopic analysis of adhesion of UPEC to T24 bladder cells. T24 cells were incubated for 2 h with FITClabeled E. coli, strain 2980. Staining of cell nuclei with DAPI is indicated by blue color, that of F-actin with Texas Red by orange color, and that of bacteria with FITC by yellow-green color. Scale bars = 47.6 μm. The images represent four 1.5 μm steps (a−d) in horizontal (z) and one image (e) side view (y) of a 30-step−0.2 μm (z-position) sectional scanning of the preparation. Scale bars = 10 μm. Series A: untreated UPEC, buffer only. Series B, UPEC pretreated with V. m. extract, 25 μg/mL.

constituents block type 1 fimbriae, PAC seems additionally to inhibit P-fimbriae, which again will lead to up-regulation of F1Cfimbriae. In total, reduced bacterial inhibition is observed onlyin cases where the feedback regulation toward increased adhesins expression is not balanced by the adhesion-blocking effects of the cranberry extracts against f imH. From the literature,5 it is known that cranberry trimeric PACs interact with papGII. By using V. m. extract this leads to an upregulation of this adhesin as shown in Figure 8. Additionally V.m. extract stimulates a further bacterial adhesin f FocG (Figure 8). This means that incubation of E. coli 2980 with V. m extract increases the density of different adhesins on the bacterial surface. In the case when T24 bladder cells are present in combination with V. m. extract, we observe a different gene expression profile, where the stimulation of the adhesins is much lower (Figure 8), probably due to the fact that the bacteria attach to the cells and do not need the additional adhesins anymore. This strong adhesion is also monitored in the adhesion assay (Figure 4), where V. m. extract leads to a strong and dose-dependent increase in adhesion to the T24 cells. From the gene expression data for V.m. extract≠PAC, no influence on the expression of the adhesins is observed. This indicates that PACs are responsible for induction of the bacterial adhesins. This again is in good correlation with the data from the adhesion assay (Figure 4) where no influence of V.m. extract≠PAC on the amount of adhering E. coli 2980 is observed. For UPEC NU14 it is interesting that a decreased adhesion takes place, which indicates the presence of compounds in the extract with inhibitory effects against f imH (Figure 4). On the other hand, NU14 up-regulates f imH and papGII expression after treatment with V.m. extract≠PAC, which means the bacteria recognize the blocking of FimH by extract compounds and counter-regulate by increasing the gene expression of this and a second adhesin. Cranberry Extract Does Not Influence Curli and Biofilm Formation. V.m. extract and V.m. extract≠PAC (50 and 100 μg/mL)

transcript levels remained on a comparable level to the untreated control in the absence of T24 cells (Figure 8D). In cases when T24 cells were present, the expression of both adhesin genes, f imH as well as papGIII, was up-regulated (Figure 8D). The specific up-regulation of f imH transcription by both extracts, V.m. extract as well as V.m. extract≠PAC, is in good agreement with the inhibitory activity of the extracts against FimH: blocking of this adhesin will lead to a controlled feedback mechanism of NU14 toward a higher expression rate to ensure interaction with the host cell. The findings concerning the reactivity of E. coli 2980 are more complicated and must be related to a central study in cranberry research, which is related to the finding that the papGII protein should be inhibited by the cranberry-specific trimeric A-type PAC.5 In this study PAC-pretreated bacteria have been investigated concerning their interaction with an immobilized synthetic P-receptor analogue and agglutination of human red blood cells; the authors found significant lower agglutination of beads or blood cells between PAC-treated E. coli compared to untreated controls. Compared to our findings, we assume that the reduced agglutination of beads or blood cells might be due to inactivation of UPEC by formation of tannin-induced clustering and interaction leading to a decreased ability for bacterial adhesion. On the other hand, our finding indicates that the extract also induces up-regulation of papGII and focG, but also of f imH transcription. The increased expression of focG in E. coli 2980 could then be a feedback consequence of inhibition of P-fimbriae. On the basis of these results it can be assumed that bacteria which are already agglomerated by tannins exhibit additionally an enhanced density of adhesins (papGII and FocG) on their surface. Therefore, although papGII is inhibited, the bacterial clusters are still able to interact with host cells because of the availability of the second up-regulated adhesin (FocG). Thus, we conclude that the impact of cranberry extracts on UPEC adhesion is much more complicated than is described in the recent literature, where mostly UPEC strains have been used with multifunctional adhesins. Whereas non-PAC cranberry 8814


Article


Figure 7. Scanning electron microscopy of T24 bladder cells incubated for 2 h with E. coli strain 2980 after pretreatment of the bacteria with V.m. extract (25 μg/mL) (B, C, D at different magnifications) versus untreated bacteria (A). (A) Untreated E. coli, buffer only; (B) E. coli pretreated with V.m. extract, 25 μg/mL; (C) E. coli pretreated with V.m. extract, 25 μg/mL; (D) E. coli pretreated with V.m. extract, 25 μg/mL.

produced by E. coli 2980 after incubation with V.m. extract was slightly, but not significantly, increased. V.m. extract≠PAC had no influence on biofilm formation of strain 2980 (Supplementary Data, Figure S4A). Incubation of E. coli NU14 with both extracts led to biofilm masses that were comparable to the biofilm mass determined for the untreated control (Supplementary Data, Figure S4B). Summarizing this study, the data indicate that PAC-depleted cranberry extracts inhibit the FimH-mediated adhesion of UPEC to bladder cells, which again implies that further studies are needed to evaluate the clinical relevance of this finding, as well as the phytochemical search for the active compounds in cranberry extracts.

were investigated concerning their ability to inhibit adhesion by interaction with bacterial curli formation by using the Congo Red assay.21 On the basis of the information on gene expression analysis, E. coli strain NU14 should exhibit curli as it expresses csgA. The quantitative Congo Red binding assay confirmed this finding. The assay indicated that neither V.m. extract nor V.m. extract≠PAC interacted with the formation of curli (Supplementary Data, Figure S3). By gene expression analysis, both strains, 2980 and NU14, have been shown to express Agn43, an autotransporter protein involved in biofilm formation. Therefore, a biofilm assay21 was performed with V.m. extract and V.m. extract≠PAC in a concentration range of 25−200 μg/mL. The biofilm mass 8815


Article


Figure 8. Influence of PAC-containing cranberry extract (V.m. extract, 100 μg/mL) and PAC-depleted cranberry extract (V.m. extract≠PAC, 100 μg/mL) on the relative gene expression of E. coli strains 2980 (A) and NU14 (B) in the presence or absence of T24 bladder cells. Relative expression levels of focG, papGII, and papGIII were determined for strain 2980 and f imH and papGIII for strain NU14 after incubation for 1.5 h with the respective extracts in absence or presence of T24 bladder cells. Respective expression levels are normalized to the endogenous control 16S rRNA; relative gene expression of untreated control groups = 1. Data are the mean ± SD from three independent assays with two technical replicates.

■

Author Contributions

ASSOCIATED CONTENT

N.R. performed the experiments, S.B. provided assistance to gene expression experiments, J.S. performed the LC-MS studies, U.D. provided UPEC strains and advised microbiological investigations, and A.H. designed and mentored the study and wrote the manuscript.

S Supporting Information *

The Supporting Information is available free of charge on the ACS Publications website at DOI: 10.1021/jf5b03030 Supplementary Figures S1−S4 (PDF)

■

Funding

The study has been completely financed by intramural grants of the University of Münster, Germany. The cranberry extract has been supplied free of charge by Frutarom, Londerzeel, Belgium; the company did not have any influence on the study design, the experiments performed, or the evaluation of the data.

AUTHOR INFORMATION

Corresponding Author

*(A.H.) Phone: +49 251 8333380. Fax: +49 838341. E-mail: [email protected]. 8816


Article

Journal of Agricultural and Food Chemistry Notes

(14) de Llano, D. G.; Esteban-Fernandez, A.; Sanchez-Patan, F.; Martin-Alvarez, P. J.; Moreno-Arribas, V.; Bartolome, B. Anti-adhesive activity of cranberry phenolic compounds and their microbial-derived metabolites against uropathogenic Escherichia coli in bladder epithelial cell cultures. Int. J. Mol. Sci. 2015, 16, 12119−12310. (15) Kimble, L. L.; Mathison, B. D.; Kaspar, K. L.; Koo, C.; Chew, B. P. Development of a fluorimetric microplate antiadhesion assay using uropathogenic Escherichia coli and human uroepithelial cells. J. Nat. Prod. 2014, 77, 1102−1110. (16) European Pharmacopoeia. 7.0/1220, Monograph Weißdornfrüchte Crataegi fructus; Deutscher Apothekerverlag: Stuttgart, Germany, 2011; Vol. 1, pp 1934−1935. (17) European Pharmacopoeia 7.0/1220, General Methodology, Prüfung auf Gleichförmigkeit der Masse einzeldosierter Arzneiformen; Govi-Verlag: Eschborn, Germany, 2011; Vol. 1, Chapter 2.9.5; p 374. (18) Bubenik, J.; Baresova, M.; Viklicky, V.; Jakoubkova, J.; Sainerova, H.; Donner, J. Established cell line of urinary bladder carcinoma (T24) containing tumour-spcific amtigen. Int. J. Cancer 1973, 11, 765−773. (19) Miyazaki, J.; Ba-Thein, W.; Kumato, T.; Obata Yasuoka, M.; Akaza, H.; Hayshi, H. Type 1, P and S fimbriae, and afimrial adhesion I are not essential for uropathogenic Escherichia coli FEMS. FEMS Immunol. Med. Microbiol. 2002, 33, 23−26. (20) Mosmann, M. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J. Immunol. Methods 1983, 65, 55−63. (21) Connell, I.; Agace, W.; Klemm, P.; Schembri, M.; Marild, S.; Svanborg, C. Type 1 fimbrial expression enhances Escherichia coli virulence for the urinary tract. Proc. Natl. Acad. Sci. U. S. A. 1996, 93, 9827−9832. (22) Rafsanjany, N.; Lechtenberg, M.; Petereit, F.; Hensel, A. Antiadhesion as a functional concept for protection against uropathogenic E. coli: in vitro studies with traditionally used herbal extracts as antiadhesive entities against uncomplicated urinary tract infections. J. Ethnopharmacol. 2013, 145, 591−597. (23) Messing, J.; Thöle, C.; Niehues, M.; Shevtsova, A.; Borén, T.; Hensel, A. Antiadhesive properties from Abelmoschus esculentus (Okra) immature fruit extract against Helicobacter pylori adhesion. PLoS One 2014, 9, e84836. (24) Bozzola, J. J.; Rusell, L. D. In Electron Microscopy: Principles and Techniques for Biologists, 2nd ed.; Jones & Bartlett Learning: Burlington, MA, USA, 1999; pp 658−690. (25) O’Toole, G. A.; Kolter, R. Initiation of biofilm formation in Pseudomonas f luorescens WCS365 proceeds via multiple, convergent signalling pathways: a genetic analysis. Mol. Microbiol. 1998, 28, 449− 461. (26) Klunk, W. E.; Jacob, R. F.; Mason, R. P. Quantifying amyloid by congo red spectral shift assay. Methods Enzymol. 1999, 309, 285−305. (27) Prior, R. L.; Lazarus, S. A.; Cao, G.; Muccitelli, H.; Hammerstone, J. F. Identification of procyanidins and anthocyanins in blueberries and cranberries (Vaccinium spp.) using high-performance liquid chromatography/mass spectrometry. J. Agric. Food Chem. 2001, 49, 1270−1276. (28) Vvedenskaya, I. O.; Rosen, R. T.; Guido, J. E.; Russell, D. J.; Mills, K. A.; Vorsa, N. Characterization of flavonols in cranberry (Vaccinium macrocarpon) powder. J. Agric. Food Chem. 2004, 52, 188−195. (29) Turner, A.; Chen, S. N.; Nikolic, D.; van Breemen, R.; Farnsworth, N. R.; Pauli, G. F. Coumaroyl iridoids and a depside from cranberry (Vaccinium macrocarpon). J. Nat. Prod. 2007, 70, 253− 258. (30) Lin, L. Z.; Harnly, J. M. A screening method for the identification of glycosylated flavonoids and other phenolic compounds using a standard analytical approach for all plant materials. J. Agric. Food Chem. 2007, 55, 1084−1096. (31) Iswaldi, I.; Gómez-Caravaca, A. M.; Arráez-Román, D.; Uberos, J.; Lardón, M.; Segura-Carretero, A.; Fernández-Gutiérrez, A. Characterization by high-performance liquid chromatography with diode-array detection coupled to time-of-flight mass spectrometry of the phenolic fraction in a cranberry syrup used to prevent urinary tract diseases, together with a study of its antibacterial activity. J. Pharm. Biomed. Anal. 2012, 58, 34−41.

The authors declare no competing financial interest.

■ ■

ACKNOWLEDGMENTS We thank Richard Klöpsch and Katharina Schäper for their support concerning SEM. ABBREVIATIONS USED BCR, bacteria/cell ratio; CLSM, confocal laser scanning microscopy; DMEM, Dubelco’s minimum essential medium; PAC, proanthocyanidins; qRTPCR, quantitative real-time polymerase chain reaction; SEM, scanning electron microscopy; UPEC, uropathogenic E. coli; UTI, uncomplicated urinary tract infections; VF, virulence factor; V.m., Vaccinium macrocarpon; V.m. extract, proanthocyanidin-enriched cranberry extract; V.m. extract≠PAC, proanthocyanidin-depleted cranberry extract

■

REFERENCES

(1) Dhakal, B. K.; Kulesus, R. R.; Mulvey, M. A. Mechanisms and consequences of bladder cell invasion by uropathogenic Escherichia coli. Eur. J. Clin. Invest. 2008, 38, 2−11. (2) Cusumano, C. K.; Pinkner, J. S.; Han, Z.; Greene, S. E.; Ford, B. A.; Crowley, J. R.; Henderson, J. P.; Janetka, J. W.; Hultgren, S. J. Treatment and prevention of urinary tract infection with orally active FimH inhibitors. Sci. Transl. Med. 2011, 3, 109ra115. (3) Chorell, E.; Pinkner, J. S.; Bengtsson, C.; Banchelin, T. S.; Edvinsson, S.; Linusson, A.; Hultgren, S. J.; Almqvist, F. Mapping pilicide anti-virulence effect in Escherichia coli, a comprehensive structure−activity study. Bioorg. Med. Chem. 2012, 20, 3128−3142. (4) Stapleton, A. E.; Au-Yeung, M.; Hooton, T. M.; Fredricks, D. N.; Roberts, P. L.; Czaja, C. A.; Yarova-Yarovaya, Y.; Fiedler, T.; Cox, M.; Stamm, W. E. Randomized, placebo-controlled phase 2 trial of a Lactobacillus crispatus probiotic given intravaginally for prevention of recurrent urinary tract infection. Clin. Infect. Dis. 2011, 52, 1212−1217. (5) Foo, L.; Lu, Y.; Howell, A. B.; Vorsa, N. A-type proanthocyanidin trimers from cranberry that inhibit adherence of uropathogenic Pfimbriated Escherichia coli. J. Nat. Prod. 2000, 63, 1225. (6) Hidalgo, G.; Chan, M.; Tufenkji, N. Inhibition of Escherichia coli CFT073 fliC expression and motiluity by cranberry materials. Appl. Environ. Microbiol. 2011, 77, 6852−6857. (7) Zafriri, D.; Ofek, I.; Adar, R.; Pocino, M.; Sharon, N. Inhibitory activity of cranberry juice on adherence of type 1 and type P fimbriated Escherichia coli to eucaryotic cells. Antimicrob. Agents Chemother. 1989, 33, 92. (8) DiMartino, P.; Agniel, R.; Gaillard, J. L.; Denys, P. Effects of cranberry juice on uropathogenic Escherichia coli in vitro biofilm formation. J. Chemother. 2005, 17, 563−565. (9) Valentova, K.; Stejskal, D.; Bednar, P.; Vostalova, J.; Cihalik, C.; Vecerova, R.; Koukalova, D.; Kolar, M.; Reichenbach, R.; Sknouril, L.; Ulrichova, J.; Simanek, V. Biosafety, antioxidant status, and metabolites in urine after consumption of dried cranberry juice in healthy women: a pilot double-blind placebo-controlled trial. J. Agric. Food Chem. 2007, 55, 3217−3224. (10) Tapiainen, T.; Jauhiainen, H.; Jaakola, L.; Salo, J.; Sevander, J.; Ikäheimo, I.; Pirttilä, A. M.; Hohtola, A.; Uhari, M. Biofilm formation and virulence of uropathogenic Escherichia coli in urine after consumption of cranberry-lingoberry juice. Eur. J. Clin. Microbiol. Infect. Dis. 2012, 31, 655−662. (11) Jepson, R. G.; Williams, G.; Craig, J. C. Cranberries for preventing urinary tract infections. Cochrane Database Syst. Rev. 2012, 10, CD001321. (12) Rzeppa, S.; Bittner, K.; Döll, S.; Dänicke, S.; Humpf, H. U. Urinary excretion and metabolism of procyanidins in pigs. Mol. Nutr. Food Res. 2012, 56, 653−665. (13) Zumdick, S.; Deters, A.; Hensel, A. In vitro transport of oligomeric procyanidins (DP2 to 4) across monolayers of Caco-2 cells. Fitoterapia 2012, 83, 1210−1217. 8817


Article

Journal of Agricultural and Food Chemistry (32) Sobota, A. E. Inhibition of bacterial adherence by cranberry juice: potential use for the treatment of urinary tract infections. J. Urol. 1984, 131, 1013−1016. (33) Johnson, J. R.; Stell, A. L. Extended virulence genotypes of Escherichia coli strains from patients with urosepsis in relation to phylogeny and host compromise. J. Infect. Dis. 2000, 181, 261−272. (34) Dobrindt, U.; Blum-Oehler, G.; Hartsch, T.; Gottschalk, G.; Ron, E. Z.; Funfstuck, R.; Hacker, J. S-Fimbria-encoding determinant sfa(I) is located on pathogenicity island III(536) of uropathogenic Escherichia coli strain 536. Infect. Immun. 2001, 69, 4248−4256. (35) Johnson, J. R.; Weissman, S. J.; Stell, A. L.; Trintchina, E.; Dykhuizen, D. E.; Sokurenko, E. V. Clonal and pathotypic analysis of archetypal Escherichia coli cystitis isolate NU14. J. Infect. Dis. 2001, 184, 1556−1565. (36) Di Martino, P.; Agniel, R.; David, K.; Templer, C.; Gaillard, J.; Denys, P.; Botto, H. Reduction of Escherichia coli adherence to uroepithelial bladder cells after consumption of cranberry juice: a double-blind randomized placebo-controlled cross-over trial. World J. Urol. 2006, 24, 21−27. (37) Gupta, K.; Chou, M.; Howell, A.; Wobbe, C.; Grady, R.; Stapleton, A. Cranberry products inhibit adherence of P-fimbriated Escherichia coli to primary cultured bladder and vaginal epithelial cells. J. Urol. 2007, 177, 2357−2360. (38) Howell, A. B.; Foxman, B. Cranberry juice and adhesion of antibiotic-resistant uropathogens. JAMA, J. Am. Med. Assoc. 2002, 287, 3082−3083. (39) Howell, A. B.; Reed, J. D.; Krueger, C. G.; Winterbottom, R.; Cunningham, D. G.; Leahy, M. A-type cranberry proanthocyanidins and uropathogenic bacterial anti-adhesion activity. Phytochemistry 2005, 66, 2281−2291. (40) Lavigne, J.; Bourg, G.; Combescure, C.; Botto, H.; Sotto, A. In vitro and in vivo evidence of dose−dependent decrease of uropathogenic Escherichia coli virulence after consumption of commercial Vaccinium macrocarpon (cranberry) capsules. Clin. Microbiol. Infect. 2008, 14, 350− 355. (41) Kimble, L. L.; Mathison, B. D.; Kaspar, K. L.; Khoo, C.; Chew, B. P. J. Nat. Prod. 2014, 77, 1102−1110.

8818
