induced SGT1 of Arachis diogoi induces cell ... - Wiley Online Library

Plant Biotechnology Journal (2015) 13, pp. 73–84

doi: 10.1111/pbi.12237

Pathogen-induced SGT1 of Arachis diogoi induces cell death and enhanced disease resistance in tobacco and peanut Dilip Kumar and Pulugurtha Bharadwaja Kirti* Department of Plant Sciences, University of Hyderabad, Hyderabad, India

Received 24 February 2014; revised 1 July 2014; accepted 2 July 2014. *Correspondence (Tel: +91 402 313 4545; fax +91 402 301 0120; email [email protected])

Keywords: AdSGT1, transgenic peanut, late leaf spot, tobacco, hypersensitive-like cell death.

Summary We have identified a transcript derived fragment (TDF) corresponding to SGT1 in a study of differential gene expression on the resistant wild peanut, Arachis diogoi, upon challenge from the late leaf spot pathogen, Phaeoisariopsis personata, and cloned its full-length cDNA followed by subsequent validation through q-PCR. Sodium nitroprusside, salicylic acid, ethephon and methyl jasmonate induced the expression of AdSGT1, while the treatment with abscisic acid did not elicit its up-regulation. AdSGT1 is localized to both nucleus and cytoplasm. Its overexpression induced hypersensitive-like cell death in tobacco under transient conditional expression using the estradiol system, and this conditional expression of AdSGT1 was also associated with the upregulation of NtHSR203J, HMGR and HIN1, which have been shown to be associated with hypersensitive response in tobacco in earlier studies. Expression of the cDNA in a susceptible cultivated peanut variety enhanced its resistance against the late leaf spot pathogen, Phaeoisariopsis personata, while the heterologous expression in tobacco enhanced its resistance against Phytophthora parasitica var. nicotianae, Alternaria alternata var. nicotianae and Rhizoctonia solani. Constitutive expression in peanut was associated with the co-expression of resistance-related genes, CC-NB-LRR and some protein kinases.

Introduction Plants are regularly challenged by the invading pathogens like viruses, bacteria, fungi, nematodes and insects in their natural surroundings. To cope up with the attack, they have evolved an innate resistance mechanism involving the expression of resistance-gene encoded proteins that recognize, directly or indirectly, these invaders and trigger immune responses (Belkhadir et al., 2004; Dangl and Jones, 2001). Plants defend themselves in two ways: first, by inducing basal defence against the pathogens, known as primary immune response in which the pathogenassociated molecular patterns (PAMPs) are recognized by the plant pattern recognition receptors (PRRs) resulting in PAMPtriggered immunity (PTI) and systemic acquired resistance (SAR) against secondary pathogen attack. Secondly, the species-specific or effector-triggered immunity is induced when a specific protein of the pathogen origin interacts directly or indirectly with a plant R protein (Chisholm et al., 2006; Dangl and Jones, 2001). SGT1 (suppressor of G2 allele of SKP1), RAR1 (required for Mla12mediated resistance) and HSP90 are the downstream components of effector-triggered immunity, physically interacting with each other making a complex that modulates the stability of the components of signalling leading to pathogen resistance recruited by R proteins (Azevedo et al., 2002; Bieri et al., 2004; Hubert et al., 2003; Shirasu and Schulze-Lefert, 2003; Takahashi et al., 2003). SGT1 is an essential signalling component in R-gene mediated resistance response against various plant pathogens (Austin et al., 2002; Azevedo et al., 2002; Liu et al., 2004). SGT1 is a protein widely conserved in all eukaryotes and is crucial for resisting pathogens by plants and humans as well

(Mayor et al., 2007; Muskett and Parker, 2003). SGT1 contains three conserved domains: a tetratricopeptide repeat (TPR) domain, a CS (CHORD SGT1) motif and the SGT1-specific sequence (SGS). The TPR domain is essential for cell cycle regulation, RNA biogenesis and heat shock response (Goebl and Yanagida, 1991; Lamb et al., 1995), while CS motif of barley SGT1 binds to ATPase domain of HSP90 (Takahashi et al., 2003) and also interacts with CHORD-II domain of RAR1 and HSP90. Noel et al. (2007) reported that SGT1 interacts with HSP70 through SGS domain regulating immune responses in Arabidopsis. The SGS motif of yeast SGT1 mediates binding with LRR domains (Dubacq et al., 2002). Similarly, Bieri et al. (2004) showed that barley SGT1 interacts with LRR domain of Mla1 via its SGS domain in the yeast two-hybrid assays. Nucleotide-binding leucine-rich repeat (NB-LRR) proteins are a type of resistance (R) proteins, which are involved in pathogen recognition in plants that are stabilized and mediated by SGT1 (Boter et al., 2007; Lu et al., 2003; Zhang et al., 2010). SGT1 is an essential component of cell cycle progression at G1/S and G2/M transitions in yeast, and it binds to SKP1, a component of SCF (Skp1-Cullin-F-box) ubiquitin ligase complex, and mediates the regulation of plant disease resistance responses in both yeast and plants (Azevedo et al., 2002; Kitagawa et al., 1999). Shapiro et al. (2012) established that HSP90, a co-chaperone of SGT1, regulates C. albicans morphogenesis and drug resistance, providing new therapeutic target for the treatment of life-threatening fungal infections. More recently, Hoser et al. (2013) suggested that phosphorylation of SGT1 by plant MAPK machinery regulates the nucleocytoplasmic distribution of N-receptor, which is necessary for effective plant resistance response to TMV infection.

ª 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd

73

74 Dilip Kumar and Pulugurtha Bharadwaja Kirti Hypersensitive cell death phenomenon is commonly associated with effector-triggered immunity, a form of plant immune response that prevents the spread of pathogen infection in the resistant host plant (Greenberg and Yao, 2004). Several plant resistance genes and corresponding avirulence genes in the pathogens have been identified, and their interaction has been shown to lead to HR, which confines the spread of the pathogen at the site of infection (Martin et al., 2003). Studies specify that SGT1 plays an important role in plant cell death. SGT1 has also been shown in cell death against a necrotrophic pathogen, Botrytis cinerea, and hemibiotrophic pathogen, Fusarium culmorum (Cuzick et al., 2009; El Oirdi and Bouarab, 2007). Moreover, Wang et al. (2010) reported that SGT1 is an essential component, which regulates the process of cell death positively during both compatible and incompatible plant–pathogen interactions. Fu et al. (2009) found that both RAR1 and SGT1 are required for basal R-gene mediated and systemic acquired resistance in soybean. Cultivated peanut is susceptible to the biotrophic fungal pathogen, Phaeoisariopsis personata, that causes devastating late leaf spot disease, which could lead to yield losses up to 70% under favourable conditions (Grichar et al., 1998). Several attempts have been made to overcome leaf spot disease of peanut through transgenic approach using defence-related genes (Anuradha et al., 2008; Rohini and Sankara Rao, 2001; Sundaresha et al., 2010). Rhizoctonia solani is a broad host-range soilborne pathogen (Anderson, 1982) that causes root rot disease, including damping off and blights in ornamental and vegetable crops (Daughtrey and Benson, 2005; Tu et al., 1996; Wu et al., 2006). Phytophthora parasitica is an important oomycete plant pathogen that causes black shank disease in Nicotiana tabacum (Erwin and Ribeiro, 1996; Kamoun et al., 1999). Since decades, transgenic approaches have been utilized effectively to control the plant pathogens in several crop plants. For controlling Rhizoctonia solani and Phytophthora parasitica, several genes were characterized separately and transformed into plants (Mene-Saffrane et al., 2003; Nguyen et al., 2011; Park et al., 2002; Punja, 2001; Vijayan and Kirti, 2012; Zhang et al., 2008). In this study, AdSGT1 was observed to be strongly induced within 24 h of pathogen inoculation in the resistant wild peanut, while no such up-regulation was found in the susceptible peanut variety indicating its importance in defence response system in the resistant wild peanut. Previous research into plant SGT1 has mostly focused on its role in R-gene regulation and its interaction with other proteins. Its modulation of resistance against various phytopathogenic fungi has not been demonstrated previously. Here, we report on the regulation of SGT1 under various hormone treatments, its involvement in chemically induced hypersensitive cell death and its protective role against challenge from pathogens in the heterologous system, tobacco and the closely related system, peanut.

Results Isolation of full-length AdSGT1 SGT1 was up-regulated in the cDNA-AFLP analysis of the resistant host responses in Arachis diogoi upon challenge from the late leaf spot pathogen, P. personata (Figure 1a), and the qPCR analysis confirmed the observation in a time course analysis (Figure 1b). The cultivated peanut variety that is susceptible to the fungal infection did not evidence such up-regulation. We have extended

the partial SGT1 obtained in the preliminary differential expression analysis by 50 RACE to obtain the full-length cDNA sequence (Figure S1). The ORF was 1077 bp long potentially encoding a protein of 358 amino acids. Based on its high homology with others dicot plant gene sequences, the cDNA was designated as AdSGT1 and submitted to the GenBank under NCBI accession number GQ922057.

Multiple sequence alignment and phylogenetic analysis The alignment of the predicted amino acid sequence of AdSGT1 was carried out with the SGT1 sequences from other plant species. The amino acid sequence of AdSGT1 exhibited 82% sequence identity with GmSGT1 from Glycine max, 79% with CaSGT1 of Cicer arietinum, 73% with FvSGT1 from Fragaria vesca, 71% with SlSGT1 from Solanum lycopersicum and 70% with NbSGT1 from Nicotiana benthamiana. Conserved amino acids among different species are indicated, which showed close similarity of AdSGT1 with the sequences from soybean and Cicer arietinum (Figure S2). Sequence analysis of SGT1 proteins from yeast, human, barley, rice and Arabidopsis showed three conserved domains: the TPR, CS and SGS domain (Azevedo et al., 2002). We have evaluated the molecular evolutionary relationship of AdSGT1 against other SGT1 sequences available in the protein data bank by constructing a phylogenetic tree. AdSGT1 exhibited the closest relationship with GmSGT1 and CaSGT1 (Figure S3). The predicted protein of AdSGT1 comprises 358 amino acids, while the predicted protein of GmSGT1 consisted of 359 amino acid residues.

Conditional expression of AdSGT1 in tobacco resulted in HR-like cell death We transiently overexpressed AdSGT1 in tobacco leaves under the constitutive promoter 35S and observed hypersensitive response-like cell death in the infiltrated areas within 4–5 days postinfiltration (Figure S4). Further, we cloned AdSGT1 under an estradiol-inducible promoter (XVE) and transiently expressed it in tobacco leaves using agroinfiltration. The treatment with estradiol induced AdSGT1 gene expression 48 hpi (Figure 2c). After chemical induction, the infiltrated area expressing the AdSGT1 showed cell death, but not the empty vector infiltrated region (Figure 2a). Cell death was quantified using Evans blue dye, and AdSGT1-pER8-induced cell death was found to be significantly high in the infiltrated region compared with the corresponding region from the control leaf (Figure 2d). The induced expression of AdSGT1 resulted in a significant up-regulation of defencerelated genes such as pathogenesis-related proteins (NtPR1a and NtPR1b) along with the HR marker genes HMGR, HSR203J and HIN1 (Figure 2b). Increased expression of AdSGT1 after estradiol application with increased expression of HR marker genes and defence response genes suggests its association with observed cell death phenotype and resistance responses.

Expression analysis of AdSGT1 in response to various signalling molecules We carried out a study on the expression pattern of AdSGT1 in response to various treatments of the signal molecules through quantitative RT-PCR using RNA samples harvested at various time points. The results indicated that a basal level of AdSGT1 is maintained in wild peanut leaves, which got up-regulated upon treatment with salicylic acid (SA) and methyl jasmonate (MeJA), ethephon (ET) and sodium nitroprusside (SNP), which are important signalling molecules in systemic acquired resistance (SAR)

ª 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal, 13, 73–84

78 Dilip Kumar and Pulugurtha Bharadwaja Kirti a few spots even after 21 dpi. All the transgenic lines showed increased resistance to P. personata as measured by the average number of lesions (Figure 6a,b). We have carried out whole plant assay to further confirm our observations in detached leaf assay in the green house. Late leaf spot symptoms started appearing after 12–15 dpi. Transgenic lines showed increased resistance to P. personata as measured by the average number of lesions in comparison with wild type (Figure 6c). Cell death was quantified using Evans blue dye in the infected leaves of AdSGT1 transgenic plants and untransformed control plant after 21 dpi. We observed increased cell death in WT plants compared with transgenic plants (Figure 6d).

(a)

(b)

Expression of defence genes associated with SGT1 transcripts A quantitative RT-PCR analysis was performed on WT and transgenic AdSGT1 plants to examine the associated gene expression. Some of the resistance-related genes identified in the differential expression analysis in the wild peanut upon pathogen challenge were revalidated in the transgenic plants of the cultivated peanut variety expressing AdSGT1 as they displayed enhanced resistance against P. personata. The transcript levels of various defence-related genes were analysed using quantitative RT-PCR, and the AdSGT1-expressing peanut transgenic plants exhibited higher transcript levels of R-gene CC-NB-LRR, leucinerich repeat receptor-like kinase, serine–threonine protein kinase, protein kinase-6 and chaperone protein HSP70. However, the transcript level for defensin was similar in both WT and transgenic plants (Figure 7).

Figure 4 (a) AdSGT1 transgenic tobacco of T2 generation plant leaves of low-expression line 6 and high-expression line 18 showed enhanced resistance to infection with Phytophthora parasitica var. nicotianae (Ppn) compared with WT plants. (b) Bar diagram represents disease infection of low (6) and high (18) expression lines in comparison with wild-type plant. Disease lesions expressed as percentage of the infected area after 7 days postinoculation. Data represent the means of lesion sizes from three different leaves of each lines, and experiment was repeated three times.

using a conidial spray, and disease symptoms started appearing on the control and transgenic plants after 10–12 days as small specks, which later developed into full sized lesions in WT nontransformed plants. At 17 and 21 dpi, the number of spots was high on WT plants, while the transgenic plants displayed only

(a)

(c)

Discussion We identified SGT1 as one of the differentially expressed genes in cDNA-AFLP analysis in host responses in a wild peanut that is asymptomatic to the late leaf spot pathogen. A quantitative real-

(b)

(d)

Figure 5 (a) Rhizoctonia solani whole plant assay with T2 transgenic seedlings of L-6 (low expression) and L-18 (high expression) lines. (b) Transgenic lines showed enhanced resistance compared with wild-type plants 15 days postinoculation. Arrow indicates infection site of Rhizoctonia solani at shoot–root junction in the wild-type plants. One-month-old plantlets were used in the bioassay. Bar diagram represents comparative analysis of enhanced resistance of AdSGT1-T2 transgenic tobacco seedlings against Rhizoctonia solani, (c) root length and (d) shoot length of the transgenic and wild-type plant after 15 days postinoculation, and the experiment was repeated thrice. ª 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd, Plant Biotechnology Journal, 13, 73–84

76 Dilip Kumar and Pulugurtha Bharadwaja Kirti (a)

(b)

(c)

(d)

Figure 2 AdSGT1 induced cell death in tobacco leaf upon conditional expression, (a) tobacco leaf areas were infiltrated with the Agrobacterium strain carrying the empty vector pER8 and the AdSGT1-pER8. Transgene expression was induced by the application of 30 lM estradiol after 48 hpi in one set, and no induction has been given to other. Photographs were taken 72–96 hpi. (b) Transcriptional changes of defence response genes in leaves transiently transformed with empty vector pER8 and pER8:AdSGT1 postestradiol application at 0, 12 and 24 h. Semi-quantitative RT-PCR analysis was performed using total RNA from samples collected at various intervals. Gene-specific primers were used for amplification of different genes with actin serving as internal control. The primer sequences used in the study were given in Table S1. (c) Semi-quantitative RT-PCR analysis of conditional expression of AdSGT1. RNA was extracted from the agroinfiltrated areas with empty and pER8:AdSGT1 vectors, 24 h post-treatment with estradiol and used for cDNA synthesis. Gene-specific primers were used for the amplification of AdSGT1 with actin serving as an internal control. Transcript accumulation of AdSGT1 was found to be high in estradiol-treated sample in comparison with untreated sample. (d) AdSGT1-induced cell death in comparison with control (pER8) was quantified using Evans blue. The uptake of Evans blue 72 h postestradiol was quantified using spectrophotometry. Data from three independent experiments with mean SD were plotted.

Enhanced resistance to fungal pathogens in transgenic tobacco plants overexpressing AdSGT1

In planta genetic transformation and molecular analysis of peanut transgenic plants

The transgenic plants of T1 and T2 generation, L-6 (low expression) and L-18 (high expression) were used in resistance response analysis. They exhibited enhanced resistance against black shank disease causing pathogen Phytophthora parasitica var. nicotianae with significantly reduced lesion area (Figure 4a,b). These plants were also found to exhibit enhanced resistance to the causal agent of brown or leaf spot disease, Alternaria alternata var. nicotianae (Figure S7). Whole seedling assay of T2 generation of transgenic plants using the fungal pathogen, Rhizoctonia solani, that causes root rot disease in a wide range of plant species showed that the high-expression plant progeny (L-18) transgenic plants showed significantly enhanced level of resistance with vigorous growth even after 2 weeks of infection (Figure 5a–d). Thus, the highexpression plant progeny exhibited significantly enhanced resistance to all the three tested pathogens: P. parasitica, Alternaria alternata and Rhizoctonia solani, while L-6 with low expression displayed delayed disease symptoms in comparison with the wildtype plants, which were severely affected by the treatment with all the test fungal pathogens.

We have generated putative transgenic peanut plants of A. hypogaea cv. JL-24 using the binary vector reported earlier for tobacco. The progeny of the putative peanut transformants developed through in planta method of transformation was screened by PCR for nptII and AdSGT1; the latter was amplified with the forward primer in the 35S promoter region and the reverse primer in SGT1 coding sequence to avoid the amplification of the native gene (Figures S8–S10). Two amplicons of nptII from the putative transgenic peanut plants were cloned in the cloning vector, pTZ57R, and sequenced. This sequencing confirmed the presence of nptII gene stably integrated in the genome of the putative transgenic plants. VirD2 gene was amplified using VirD2-F and VirD2-R primers to confirm the absence of contamination of EHA105 cells in the plants in the second generation, T1 (Figure S11). Relative expression of AdSGT1 was examined by qPCR in transgenic AdSGT1 plants. Putative transgenic plants designated as #33, #42 and #54 showed higher expression, while the plant number #4 exhibited low expression (Figure S13).


Sgt1 of the wild peanut, Arachis diogoi 81 (Hoser et al., 2013; Noel et al., 2007). Our observations clearly point out the efficacy of AdSGT1 in imparting resistance in heterologous systems against pathogens and can be a good candidate gene for deployment in crop plants.

Experimental procedures 50 /30 RACE-PCR, isolation of full-length cDNA and transient conditional expression of SGT1 Full-length cDNA sequence of AdSGT1 was obtained by aligning the sequences obtained from the 50 /30 RACE products using 50 AdSGT1-GSP1 and 30 AdSGT1-GSP1 primers, respectively, (Table 1) and the partial sequence obtained during the preliminary differential expression analysis using the cDNA-AFLP (Kumar and Kirti Submitted) in A. diogoi infected with Phaeoisariopsis personata. The open reading frame was finally amplified with primers incorporating specific restriction enzymes for cloning in pER8 vector using PhusionTM High Fidelity DNA polymerase (Finnzymes, New England BioLabs, Ipswich, MA). Primer sequences used to this study are AdSGT1-ApaI-F and AdSGT1SpeI-R (Table 1).

Agroinfiltration, chemical treatment and cell death measurement Agroinfiltration and estradiol induction were carried out essentially following Kumar and Kirti (2012). Cell death was carried out using the method outlined by Baker and Mock (1994).

Hormonal treatments and expression of pathogen induced genes Rooted stem of Arachis diogoi for various treatments were maintained as reported in Kumar and Kirti (2011). The treatments given to the rooted stem were 100 lM salicylic acid (SA), 100 lM methyl jasmonate (MeJA), 100 lM abscisic acid (ABA), 250 lM ethephon and 100 lM sodium nitroprusside (SNP). Samples were collected at regular intervals, quick frozen in liquid nitrogen and stored at 80 °C until used for RNA isolation. The chemicals used for treatments were purchased from Sigma-Aldrich, St. Louis, MO.

Table 1 Oligonucleotide sequences used in the study 0

0

Gene

Primer abbreviation

Primer sequence (5 -3 )

AdSGT1

50 AdSGT1-GSP1

CTTGTTGGTTTTGAGGATGGGTAAG

30 AdSGT1-GSP1

CATTTGTGGAGTCTAATGGGACAG

VirD2 nptII CaMV35S

AdSGT1-ApaI-F

CGGGCCCATGGCTTCTGATCTGGAAG

AdSGT1-SpeI-R

CACTAGTCTAATATTCCCATTTCTTCAACTC

AdSGT1-NcoI-F

GCCATGGCTTCTGATCTGGAAGC

AdSGT1-SacI-R

GCGAGCTCCTAATATTCCCATTTCTTCAAC

VirD2-F

TGCCAGGAGGTGGAACCAAGA

VirD2-R

CGATTGACTGAGGTCCCGACGA

NptII-F

AGATGGATTGCACGCAGGTTCTC

NptII-R

ATCGGGAGCGGCGATACCGTA

CaMV35S-F

ACGACACTCTCGTCTACTC

Underlined bases indicate the recognition sequences for the corresponding restriction enzymes.

Binary vector construction and genetic transformation of tobacco The open reading frame of the cDNA of AdSGT1 was amplified using PhusionTM High Fidelity DNA polymerase, and the primers containing corresponding restriction site used are AdSGT1-NcoI-F and AdSGT1-SacI-R (Table 1). The ORF of AdSGT1 was cloned as an NcoI-SacI fragment into a plant expression cassette containing vector pRT100. The AdSGT1 expression cassette with CaMV35S promoter was released with PstI and cloned in the binary vector pCAMBIA2300. Recombinant binary vectors were mobilized into virulent Agrobacterium strain EHA105 by freeze–thaw method. Genetic transformation of tobacco was carried out following Horsch et al. (1985).

Bioassay of AdSGT1 transgenic tobacco plants against phytopathogenic fungal pathogens Standard methods were followed in fungal treatments on tobacco transgenic plants with Phytophthora parasitica var. nicotianae, and fungal mycelium grown on potato dextrose agar (PDA) was placed on the adaxial side of leaf after damaging the leaf surface to promote fungal infection (Tedford et al., 1990). For Alternaria alternata var. nicotianae, treatment, a 105 spores/mL suspension solution was inoculated on leaf petiole cut point covered with water-soaked cotton (Lorito et al., 1998). One-month-old plantlets of WT and transgenic seedlings were used to evaluate their resistance against Rhizoctonia solani (Anderson, 1982). Fully grown fungal mycelium on PDA were cut into number of pieces of 0.5 cm diameter, and 4–5 pieces were placed in each pot containing the plantlets, which were pretreated with 3% sucrose for better growth of the fungal mycelium. These potted plantlets were placed in the growth room, and symptoms were recorded after 15 dpi.

In Planta genetic transformation of Arachis hypogaea cv. JL-24 with pCAMBIA2300 harbouring AdSGT1 gene We have used the in planta method (with no tissue culture manipulation) to generate transgenic peanut plants as reported by Rohini and Rao (2000) with minor modifications using the Agrobacterium strain EHA105 carrying AdSGT1:pCAMBIA2300 that was grown overnight at 28 °C in LB medium with appropriate antibiotics.

Molecular analysis of tobacco and peanut transgenic plants Standard methods were followed in molecular analyses. Southern analysis for transgenic plants was performed in which the genomic DNA was digested with EcoRI, and hybridization was performed using [a-32P] dATP labelled nptII fragment obtained from the amplification of neomycin phosphotransferase (nptII) gene with nptII F and nptII R primers (Table 1). The primers used in semi-quantitative RT-PCR and real-time PCR analyses were listed in Tables S1 and S2.

Phaeoisariopsis personata fungal bioassay of AdSGT1 peanut transgenic plants T2Transgenic peanut plants in the green house were evaluated for resistance against the late leaf spot pathogen, P. personata. Conidia were collected from infected leaf samples and were allowed to germinate in sterile double-distilled water, and the


82 Dilip Kumar and Pulugurtha Bharadwaja Kirti germination of the conidia was checked microscopically before plant infection.

Detached leaf assay Fungal assay was performed using healthy leaves from 1-monthold T2 transgenic peanut plants. The concentration of conidial suspension was adjusted to 105 conidia/mL using a haemocytometer, and assays were carried out using conidial suspension containing 0.1% of Tween-20 (v/v) as a surfactant. Conidial suspension was inoculated using an atomizer, and leaves were placed on moist filter paper inside 110 mm Petri dishes sealed with parafilm to maintain humid conditions (≥95% RH) with 16 h:8 h of light: dark photoperiod, and symptoms were recorded after 18 and 21 dpi.

Whole plant assay Six-week-old healthy T2 transgenic plants in the green house were inoculated uniformly by spraying the conidial suspension at a concentration of 105 per mL, using an atomizer. Plants were irrigated and covered with thin plastic covers to maintain high humidity (≥95% RH) for 2–3 days at 24 °C. Symptoms were recorded after 21 days postinoculation, and the experiment was repeated twice.

Subcellular localization of AdSGT1 AdSGT1 cDNA was amplified from reverse-transcribed RNA using primers AdSGT1NcoI-F and AdSGT1SpeI-R incorporating NcoI and SpeI restriction sites, respectively. The resulting fragment was cloned into pCAMBIA1302 vector digested with appropriate restriction enzymes to make an in-frame N-terminal fusion with GFP to obtain AdSGT1:pCAMBIA1302, in which the GFP has been c-terminally tagged with histidine residues. The pCAMBIA1302 control vector and AdSGT1:pCAMBIA1302 constructs were mobilized into A. tumefaciens strain EHA105 by the freeze–thaw method (Holsters et al., 1978). In order to determine the subcellular localization of GFP-AdSGT1 fusion protein, leaves from 4-week-old N. benthamiana plants were used for transient gene expression by agroinfiltration as described by Yang et al. (2000). After 48–72 h, GFP was visualized with a laser scanning confocal microscope (Leica, Wetzlar, Germany). Protein extraction and immunoblot analysis were performed as described earlier (Kumar and Kirti, 2012). The primers, AdSGT1NcoI-F and AdSGT1SpeI-R, were used for subcellular localization study of AdSGT1.

Acknowledgements The authors are grateful to ICRISAT, Patancheru, India, for the supply of the Arachis diogoi (accession ICG8962) used in the study. The work is funded by the Department of Biotechnology, Government of India under the Project: BT/PR6853/PBD/ 16/627/2005. Facilities provided under DST-FIST, UGC-SAP, DBT-CREBB by the Department are acknowledged. Facilities provided by the Department of Plant Sciences, University of Hyderabad under the DST-FISTII, UGC-CAS programs were acknowledged.

References Anderson, N.A. (1982) The genetics and pathology of Rhizoctonia solani. Annu. Rev. Phytopathol. 20, 329–347.

Anuradha, T.S., Divya, K., Jami, S.K. and Kirti, P.B. (2008) Transgenic tobacco and groundnut plants expressing a mustard defensin show resistance to fungal pathogens. Plant Cell Rep. 27, 1777–1786. Austin, M.J., Muskett, P., Kahn, K., Feys, B.J., Jones, J.D. and Parker, J.E. (2002) Regulatory role of SGT1 in early R gene mediated plant defenses. Science, 295, 2077–2080. Azevedo, C., Sadanandom, A., Kitagawa, K., Freialdenhoven, A., Shirasu, K. and Schulze-Lefert, P. (2002) The RAR1 interactor SGT1, an essential component of R gene-triggered disease resistance. Science, 295, 2073–2076. Azevedo, C., Betsuyaku, S., Peart, J., Takahashi, A., No€el, L., Sadanandom, A., Casais, C., Parker, J. and Shirasu, K. (2006) Role of SGT1 in resistance protein accumulation in plant immunity. EMBO J. 25, 2007–2016. Baker, C.J. and Mock, N.M. (1994) An improved method for monitoring cell death in cell suspension and leaf disc assays using Evans blue. Plant Cell Tissue Organ Cult. 39, 7–12. Belkhadir, Y., Subramaniam, R. and Dangl, J.L. (2004) Plant disease resistance protein signalling: NBS-LRR proteins and their partners. Curr. Opin. Plant Biol. 7, 391–399. Bieri, S., Mauch, S., Shen, Q.H., Peart, J., Devoto, A., Casais, C., Ceron, F., Schulze, S., Steinbiss, H.H., Shirasu, K. and Schulze-Lefert, P. (2004) RAR1 positively controls steady state levels of barley MLA resistance proteins and enables sufficient MLA6 accumulation for effective resistance. Plant Cell, 16, 3480–3495. Boter, M., Amigues, B., Peart, J., Breuer, C., Kadota, Y., Moore, G., Kleanthous, C., Ochsenbein, F., Shirasu, K. and Guerois, R. (2007) Structural and functional analysis of SGT1 reveals that its interaction with HSP90 is required for the accumulation of Rx, an R protein involved in plant immunity. Plant Cell, 19, 3791–3804. Chisholm, S.T., Coaker, G., Day, B. and Staskawicz, B.J. (2006) Host–microbe interactions: shaping the evolution of the plant immune response. Cell, 124, 803–814. Courtois, C., Besson, A., Dahan, J., Bourque, S., Dobrowolska, G., Pugin, A. and Wendehenne, D. (2008) Nitric oxide signaling in plants: interplays with Ca2+ and protein kinases. J. Exp. Bot. 59, 155–163. Cuzick, A., Maguire, K. and Hammond-Kosack, K.E. (2009) Lack of the plant signalling component SGT1b enhances disease resistance to Fusarium culmorum in Arabidopsis buds and flowers. New Phytol. 181, 901–912. Dangl, J.L. and Jones, J.D. (2001) Plant pathogens and integrated defense responses to infection. Nature, 411, 826–833. Daughtrey, M.L. and Benson, M. (2005) Principles of plant health management for ornamental plants. Annu. Rev. Phytopathol. 43, 141–169. Delledonne, M., Polverari, A. and Murgia, I. (2003) The functions of nitric oxide-mediated signaling and changes in gene expression during the hypersensitive response. Antioxid. Redox Signal. 5, 33–41. Dubacq, C., Guerois, R., Courbeyrette, R., Kitagawa, K. and Mann, C. (2002) Sgt1 contributes to cyclic AMP pathway activity and physically interacts with the adenylyl cyclase yr1p/Cdc35p in budding yeast. Eukaryot. Cell, 1, 568–582. El Oirdi, M. and Bouarab, K. (2007) Plant signalling components EDS1 and SGT1 enhance disease caused by the necrotrophic pathogen, Botrytis cinerea. New Phytol. 175, 131–139. Erwin, D.C. and Ribeiro, O.K. (1996) Phytophthora Diseases Worldwide. St. Paul, MN: APS Press. Fu, D.Q., Ghabrial, S. and Kachroo, A. (2009) GmRAR1 and GmSGT1 are required for basal, R gene-mediated and systemic acquired resistance in soybean. Mol. Plant-Microbe Interact. 22, 86–95. Goebl, M. and Yanagida, M. (1991) The TPR snap helix: a novel protein repeat motif from mitosis to transcription. Trends Biochem. Sci. 16, 173–177. Greenberg, J.T. (1997) Programmed cell death in plant-pathogen interaction. Annu. Rev. Plant Physiol. Plant Mol. Biol. 48, 525–545. Greenberg, J.T. and Yao, N. (2004) The role and regulation of programmed cell death in plant–pathogen interactions. Cell. Microbiol. 6, 201–211. Grichar, W.J., Besler, B.A. and Jaks, A.J. (1998) Groundnut (Arachis hypogaea L.) cultivar response to leaf spot disease development under four disease management programs. Groundnut Sci. 25, 35–39. Holsters, M., De Waele, D. and Depicker, A. (1978) Transfection and transformation of Agrobacterium tumefaciens. Mol. Gen. Genet. 163, 181–187.


Sgt1 of the wild peanut, Arachis diogoi 79 (a)

(b)

(c)

(d)

Figure 6 Phaeoisariopsis personata fungal conidia bioassay of (a) wild-type and AdSGT1-T2 transgenic-detached leaves after 17 days postinoculation, (b) enlarged view of wild-type and AdSGT1-42-2 transgenic plant leaf after 20 days postinfection. Transgenic plants showed enhanced resistance to infection with Phaeoisariopsis personata, and experiment was repeated three times. (c) Bar diagram represents number of lesions present in wild-type and transgenic plants after conidial spray on the detached leaf assays. A significant decrease in the number of lesions on transgenic plants was detected compared with wild type. (d) Cell death was quantified in wild-type and transgenic peanut plants using Evans blue with spectrophotometry. Data from three independent experiments with mean value SD were plotted.

time analysis confirmed its transcript accumulation at an early stage upon challenge with biotrophic pathogen, P. personata, in resistant wild species, Arachis diogoi. No such up-regulation was detected in susceptible peanut plants indicating the role of SGT1 in defence responses against pathogen. SGT1 protein is conserved throughout eukaryotes and is shown to play important role in immune response triggered by pathogen elicitors in plants and humans as well (Mayor et al., 2007; Shirasu, 2009). Immune system in plants has different strategies to combat the different types of pathogens (Jones and Dangl, 2006). One of the important strategies that confers broadspectrum disease resistance in plants is hypersensitive response, which is a form of localized programmed cell death preventing the pathogen advancement at the infection site (Greenberg, 1997). Peart et al. (2002) showed that SGT1-mediated cell death occurs by Avr–R protein interactions, and several effectors are involved in inducing cell death. Wang et al. (2010) showed overexpression of NbSGT1 and accelerated cell death induced by

nonhost and host pathogens during ETI and PTI, which was not observed in the absence of pathogen, suggesting that tobacco SGT1 is a component of signalling cascade and positively regulates the process of cell death during both compatible and incompatible interactions. However, El Oirdi and Bouarab (2007) reported that silencing tobacco SGT1 resulted in hypersensitive response induced by the necrotrophic pathogen, Botrytis cinerea, and found that the pathogen activated the expression of the two plant signalling components, EDS1 and SGT1, required for HR dependent plant disease resistance. We have expressed AdSGT1 in N. tabacum to study its response as agroinfiltration method could not be established in the wild peanut Arachis diogoi because of the leaf architecture. Cell death was found to be high in the transiently expressed AdSGT1 tobacco infiltrated regions. To date, there were no reports of chemical-induced cell death of SGT1 in plants. In the case of estradiol-induced cell death in the present case, SGT1 appears to induce cell death through the activation of genes


80 Dilip Kumar and Pulugurtha Bharadwaja Kirti

Figure 7 Relative transcript levels of defence response genes in AdSGT1 overexpressing peanut plant (#42-2) compared with wild type were analysed by quantitative RT-PCR using total RNA. The genes were found differentially expressed in cDNA-AFLP analysis during resistant host responses of Arachis diogoi when challenged with the late leaf spot pathogen except defensin (AY288448). CC-NB-LRR: Coiled coil nucleotide-binding leucine-rich repeat (GU592820), HSP70: heat shock protein 70 (GQ922059), LRR-RLK: leucine-rich repeat receptor like kinase (FJ581437), serine–threonine protein kinase (GQ922055) and protein kinase-6 (GU592825). Relative gene expression was calculated by comparative DDCT method, and data were normalized to the alcohol dehydrogenase-3 as it was used as internal reference gene, and data were plotted from three biological replicates. The primer sequences used in this study were given in Table S2.

involved in hypersensitive response. This is in agreement with Wang et al. (2010). We evaluated the defence-related gene expression induced upon conditional expression of AdSGT1. The induced expression of HR marker genes, HMGR, HSR203J and HIN1, also suggested the involvement of AdSGT1 in inducing HR-like cell death (Pontier et al., 1999; Takahashi et al., 2004; Zhang and Liu, 2001). In addition to HR marker genes, pathogenesis-related proteins like PR1a and PR1b were found to be up-regulated, which were also reported previously (Jang et al., 2009; Kumar and Kirti, 2010, 2012). We found that AdSGT1 transcripts were highly up-regulated in response to all the signalling molecules except ABA. Tobacco SGT1 has been reported to be up-regulated by Botrytis cinerea through salicylic acid pathway, and the pathogen attack promotes its expression to exploit the antagonistic effect between SA and JA (El Oirdi and Bouarab, 2007; Meldau et al., 2011). Similar up-regulation of AdSGT1 was found in methyl jasmonate treatment indicating the possible cross-talk between the two signalling molecules in regulating its role in defence. ABA did not significantly up-regulate AdSGT1. Ethylene is a well-known player in stress response signalling pathways in plants, particularly in plant defence, and we have found strong up-regulation of AdSGT1 transcripts at 3 h of ethephon treatment and maintained up to 24 h. Nitric oxide is an important signalling molecule to induce a signalling cascade regulating plant responses to developmental processes, biotic and abiotic stress (Courtois et al., 2008; Delledonne et al., 2003; Qiao and Fan, 2008). AdSGT1 was detected to be strongly induced up to 24 h of SNP treatment, indicating its important role in signalling to regulate plant response upon stress. There were no previous reports on the

expression of SGT1 in nitric oxide signalling. Based on these observation, it can be postulated that the induced expression of SGT1 upon SA, JA, NO and ethephon treatment may enhance resistance in host plant through systemic acquired resistance and effector-triggered immunity, and there exists a significant crosstalk between various signalling molecules in modulating its expression. Essential role of SGT1 in basal disease resistance to plant pathogens has been reported by Wang et al. (2008) as they found that overexpression of OsSGT1 in rice showed enhanced basal resistance to virulent bacterial blight, Xanthomonas oryzae pv. oryzae PXO99, including four virulent blast fungal Magnoporthe oryzae races. Recently, Xing et al. (2013) reported that wheat, overexpressing Hv-SGT1 exhibited enhanced resistance to a biotrophic pathogen-powdery mildew and a hemibiotrophic pathogen, Fusarium graminearum. It is also involved in H2O2 production correlating with the hypersensitive response. There are limited reports on heterologous expression of SGT1 in transgenic plants (Wang et al., 2010). Transgenic tobacco plants constitutively expressing AdSGT1 showed enhanced disease resistance to three fungal pathogens in addition to chemicalinduced hypersensitive-like cell death. When we overexpressed it in the closely related system, the peanut, we observed significantly enhanced levels of resistance against the late leaf spot pathogen. A significant decrease in number of lesions was found on transgenic plants in comparison with untransformed control plants. Cell death was found to be high in wild-type infected plant in comparison with AdSGT1-expressing transgenic peanut plants, which further indicated that late leaf spot was more severe on the wild-type plants. Several earlier studies showed that SGT1 regulates R-gene signalling, R-protein accumulation, defence responses in plants and also the process of cell death in both compatible and incompatible interactions (Azevedo et al., 2006; Muskett and Parker, 2003; Wang et al., 2010). We have analysed some defence-related genes in AdSGT1-expressing transgenic peanut plants, which were also found to be differentially expressed in cDNA-AFLP analysis during plant–pathogen interaction. We have found transcript accumulation of CC-NB-LRR, LRR-RLK, Serine– Threonine protein kinase and protein kinase-6, which belong to different classes of R genes (Tor et al., 2003). Plants respond to pathogen attack by expressing disease resistance-related R-gene products for recognizing and countering pathogen-derived molecules (Dangl and Jones, 2001), and these are usually recognized through nucleotide-binding domain and Leucine-rich repeat containing (NLR) regions of the protein (Bieri et al., 2004; Leister et al., 2005). We have not found changes in transcript levels of defensin, while chaperone protein HSP70 was up-regulated in transgenic plant in comparison with the wild type, which suggests that AdSGT1 might be involved in interaction with HSP70 playing an important role in folding and stability of the protein complexes. Noel et al. (2007) reported that SGT1 can interact with HSP70 through the SGS domain, which is supporting our observations. Hence, transcript accumulation of these R proteins and chaperone proteins in transgenic peanut plants expressing AdSGT1 indicate its role in R-gene mediated response and might be one of the important contributors in enhancing disease resistance against the late leaf spot disease. We have observed AdSGT1 localized to both in the nucleus and in the cytoplasm. Previous reports also support our observation and showed that it is localized simultaneously in nucleus and cytoplasm depending upon phosphorylation and interaction


Sgt1 of the wild peanut, Arachis diogoi 81 (Hoser et al., 2013; Noel et al., 2007). Our observations clearly point out the efficacy of AdSGT1 in imparting resistance in heterologous systems against pathogens and can be a good candidate gene for deployment in crop plants.

Experimental procedures 50 /30 RACE-PCR, isolation of full-length cDNA and transient conditional expression of SGT1 Full-length cDNA sequence of AdSGT1 was obtained by aligning the sequences obtained from the 50 /30 RACE products using 50 AdSGT1-GSP1 and 30 AdSGT1-GSP1 primers, respectively, (Table 1) and the partial sequence obtained during the preliminary differential expression analysis using the cDNA-AFLP (Kumar and Kirti Submitted) in A. diogoi infected with Phaeoisariopsis personata. The open reading frame was finally amplified with primers incorporating specific restriction enzymes for cloning in pER8 vector using PhusionTM High Fidelity DNA polymerase (Finnzymes, New England BioLabs, Ipswich, MA). Primer sequences used to this study are AdSGT1-ApaI-F and AdSGT1SpeI-R (Table 1).

Agroinfiltration, chemical treatment and cell death measurement Agroinfiltration and estradiol induction were carried out essentially following Kumar and Kirti (2012). Cell death was carried out using the method outlined by Baker and Mock (1994).

Hormonal treatments and expression of pathogen induced genes Rooted stem of Arachis diogoi for various treatments were maintained as reported in Kumar and Kirti (2011). The treatments given to the rooted stem were 100 lM salicylic acid (SA), 100 lM methyl jasmonate (MeJA), 100 lM abscisic acid (ABA), 250 lM ethephon and 100 lM sodium nitroprusside (SNP). Samples were collected at regular intervals, quick frozen in liquid nitrogen and stored at 80 °C until used for RNA isolation. The chemicals used for treatments were purchased from Sigma-Aldrich, St. Louis, MO.

Table 1 Oligonucleotide sequences used in the study 0

0

Gene

Primer abbreviation

Primer sequence (5 -3 )

AdSGT1

50 AdSGT1-GSP1

CTTGTTGGTTTTGAGGATGGGTAAG

30 AdSGT1-GSP1

CATTTGTGGAGTCTAATGGGACAG

VirD2 nptII CaMV35S

AdSGT1-ApaI-F

CGGGCCCATGGCTTCTGATCTGGAAG

AdSGT1-SpeI-R

CACTAGTCTAATATTCCCATTTCTTCAACTC

AdSGT1-NcoI-F

GCCATGGCTTCTGATCTGGAAGC

AdSGT1-SacI-R

GCGAGCTCCTAATATTCCCATTTCTTCAAC

VirD2-F

TGCCAGGAGGTGGAACCAAGA

VirD2-R

CGATTGACTGAGGTCCCGACGA

NptII-F

AGATGGATTGCACGCAGGTTCTC

NptII-R

ATCGGGAGCGGCGATACCGTA

CaMV35S-F

ACGACACTCTCGTCTACTC

Underlined bases indicate the recognition sequences for the corresponding restriction enzymes.

Binary vector construction and genetic transformation of tobacco The open reading frame of the cDNA of AdSGT1 was amplified using PhusionTM High Fidelity DNA polymerase, and the primers containing corresponding restriction site used are AdSGT1-NcoI-F and AdSGT1-SacI-R (Table 1). The ORF of AdSGT1 was cloned as an NcoI-SacI fragment into a plant expression cassette containing vector pRT100. The AdSGT1 expression cassette with CaMV35S promoter was released with PstI and cloned in the binary vector pCAMBIA2300. Recombinant binary vectors were mobilized into virulent Agrobacterium strain EHA105 by freeze–thaw method. Genetic transformation of tobacco was carried out following Horsch et al. (1985).

Bioassay of AdSGT1 transgenic tobacco plants against phytopathogenic fungal pathogens Standard methods were followed in fungal treatments on tobacco transgenic plants with Phytophthora parasitica var. nicotianae, and fungal mycelium grown on potato dextrose agar (PDA) was placed on the adaxial side of leaf after damaging the leaf surface to promote fungal infection (Tedford et al., 1990). For Alternaria alternata var. nicotianae, treatment, a 105 spores/mL suspension solution was inoculated on leaf petiole cut point covered with water-soaked cotton (Lorito et al., 1998). One-month-old plantlets of WT and transgenic seedlings were used to evaluate their resistance against Rhizoctonia solani (Anderson, 1982). Fully grown fungal mycelium on PDA were cut into number of pieces of 0.5 cm diameter, and 4–5 pieces were placed in each pot containing the plantlets, which were pretreated with 3% sucrose for better growth of the fungal mycelium. These potted plantlets were placed in the growth room, and symptoms were recorded after 15 dpi.

In Planta genetic transformation of Arachis hypogaea cv. JL-24 with pCAMBIA2300 harbouring AdSGT1 gene We have used the in planta method (with no tissue culture manipulation) to generate transgenic peanut plants as reported by Rohini and Rao (2000) with minor modifications using the Agrobacterium strain EHA105 carrying AdSGT1:pCAMBIA2300 that was grown overnight at 28 °C in LB medium with appropriate antibiotics.

Molecular analysis of tobacco and peanut transgenic plants Standard methods were followed in molecular analyses. Southern analysis for transgenic plants was performed in which the genomic DNA was digested with EcoRI, and hybridization was performed using [a-32P] dATP labelled nptII fragment obtained from the amplification of neomycin phosphotransferase (nptII) gene with nptII F and nptII R primers (Table 1). The primers used in semi-quantitative RT-PCR and real-time PCR analyses were listed in Tables S1 and S2.

Phaeoisariopsis personata fungal bioassay of AdSGT1 peanut transgenic plants T2Transgenic peanut plants in the green house were evaluated for resistance against the late leaf spot pathogen, P. personata. Conidia were collected from infected leaf samples and were allowed to germinate in sterile double-distilled water, and the


82 Dilip Kumar and Pulugurtha Bharadwaja Kirti germination of the conidia was checked microscopically before plant infection.

Detached leaf assay Fungal assay was performed using healthy leaves from 1-monthold T2 transgenic peanut plants. The concentration of conidial suspension was adjusted to 105 conidia/mL using a haemocytometer, and assays were carried out using conidial suspension containing 0.1% of Tween-20 (v/v) as a surfactant. Conidial suspension was inoculated using an atomizer, and leaves were placed on moist filter paper inside 110 mm Petri dishes sealed with parafilm to maintain humid conditions (≥95% RH) with 16 h:8 h of light: dark photoperiod, and symptoms were recorded after 18 and 21 dpi.

Whole plant assay Six-week-old healthy T2 transgenic plants in the green house were inoculated uniformly by spraying the conidial suspension at a concentration of 105 per mL, using an atomizer. Plants were irrigated and covered with thin plastic covers to maintain high humidity (≥95% RH) for 2–3 days at 24 °C. Symptoms were recorded after 21 days postinoculation, and the experiment was repeated twice.

Subcellular localization of AdSGT1 AdSGT1 cDNA was amplified from reverse-transcribed RNA using primers AdSGT1NcoI-F and AdSGT1SpeI-R incorporating NcoI and SpeI restriction sites, respectively. The resulting fragment was cloned into pCAMBIA1302 vector digested with appropriate restriction enzymes to make an in-frame N-terminal fusion with GFP to obtain AdSGT1:pCAMBIA1302, in which the GFP has been c-terminally tagged with histidine residues. The pCAMBIA1302 control vector and AdSGT1:pCAMBIA1302 constructs were mobilized into A. tumefaciens strain EHA105 by the freeze–thaw method (Holsters et al., 1978). In order to determine the subcellular localization of GFP-AdSGT1 fusion protein, leaves from 4-week-old N. benthamiana plants were used for transient gene expression by agroinfiltration as described by Yang et al. (2000). After 48–72 h, GFP was visualized with a laser scanning confocal microscope (Leica, Wetzlar, Germany). Protein extraction and immunoblot analysis were performed as described earlier (Kumar and Kirti, 2012). The primers, AdSGT1NcoI-F and AdSGT1SpeI-R, were used for subcellular localization study of AdSGT1.

Acknowledgements The authors are grateful to ICRISAT, Patancheru, India, for the supply of the Arachis diogoi (accession ICG8962) used in the study. The work is funded by the Department of Biotechnology, Government of India under the Project: BT/PR6853/PBD/ 16/627/2005. Facilities provided under DST-FIST, UGC-SAP, DBT-CREBB by the Department are acknowledged. Facilities provided by the Department of Plant Sciences, University of Hyderabad under the DST-FISTII, UGC-CAS programs were acknowledged.

References Anderson, N.A. (1982) The genetics and pathology of Rhizoctonia solani. Annu. Rev. Phytopathol. 20, 329–347.

Anuradha, T.S., Divya, K., Jami, S.K. and Kirti, P.B. (2008) Transgenic tobacco and groundnut plants expressing a mustard defensin show resistance to fungal pathogens. Plant Cell Rep. 27, 1777–1786. Austin, M.J., Muskett, P., Kahn, K., Feys, B.J., Jones, J.D. and Parker, J.E. (2002) Regulatory role of SGT1 in early R gene mediated plant defenses. Science, 295, 2077–2080. Azevedo, C., Sadanandom, A., Kitagawa, K., Freialdenhoven, A., Shirasu, K. and Schulze-Lefert, P. (2002) The RAR1 interactor SGT1, an essential component of R gene-triggered disease resistance. Science, 295, 2073–2076. Azevedo, C., Betsuyaku, S., Peart, J., Takahashi, A., No€el, L., Sadanandom, A., Casais, C., Parker, J. and Shirasu, K. (2006) Role of SGT1 in resistance protein accumulation in plant immunity. EMBO J. 25, 2007–2016. Baker, C.J. and Mock, N.M. (1994) An improved method for monitoring cell death in cell suspension and leaf disc assays using Evans blue. Plant Cell Tissue Organ Cult. 39, 7–12. Belkhadir, Y., Subramaniam, R. and Dangl, J.L. (2004) Plant disease resistance protein signalling: NBS-LRR proteins and their partners. Curr. Opin. Plant Biol. 7, 391–399. Bieri, S., Mauch, S., Shen, Q.H., Peart, J., Devoto, A., Casais, C., Ceron, F., Schulze, S., Steinbiss, H.H., Shirasu, K. and Schulze-Lefert, P. (2004) RAR1 positively controls steady state levels of barley MLA resistance proteins and enables sufficient MLA6 accumulation for effective resistance. Plant Cell, 16, 3480–3495. Boter, M., Amigues, B., Peart, J., Breuer, C., Kadota, Y., Moore, G., Kleanthous, C., Ochsenbein, F., Shirasu, K. and Guerois, R. (2007) Structural and functional analysis of SGT1 reveals that its interaction with HSP90 is required for the accumulation of Rx, an R protein involved in plant immunity. Plant Cell, 19, 3791–3804. Chisholm, S.T., Coaker, G., Day, B. and Staskawicz, B.J. (2006) Host–microbe interactions: shaping the evolution of the plant immune response. Cell, 124, 803–814. Courtois, C., Besson, A., Dahan, J., Bourque, S., Dobrowolska, G., Pugin, A. and Wendehenne, D. (2008) Nitric oxide signaling in plants: interplays with Ca2+ and protein kinases. J. Exp. Bot. 59, 155–163. Cuzick, A., Maguire, K. and Hammond-Kosack, K.E. (2009) Lack of the plant signalling component SGT1b enhances disease resistance to Fusarium culmorum in Arabidopsis buds and flowers. New Phytol. 181, 901–912. Dangl, J.L. and Jones, J.D. (2001) Plant pathogens and integrated defense responses to infection. Nature, 411, 826–833. Daughtrey, M.L. and Benson, M. (2005) Principles of plant health management for ornamental plants. Annu. Rev. Phytopathol. 43, 141–169. Delledonne, M., Polverari, A. and Murgia, I. (2003) The functions of nitric oxide-mediated signaling and changes in gene expression during the hypersensitive response. Antioxid. Redox Signal. 5, 33–41. Dubacq, C., Guerois, R., Courbeyrette, R., Kitagawa, K. and Mann, C. (2002) Sgt1 contributes to cyclic AMP pathway activity and physically interacts with the adenylyl cyclase yr1p/Cdc35p in budding yeast. Eukaryot. Cell, 1, 568–582. El Oirdi, M. and Bouarab, K. (2007) Plant signalling components EDS1 and SGT1 enhance disease caused by the necrotrophic pathogen, Botrytis cinerea. New Phytol. 175, 131–139. Erwin, D.C. and Ribeiro, O.K. (1996) Phytophthora Diseases Worldwide. St. Paul, MN: APS Press. Fu, D.Q., Ghabrial, S. and Kachroo, A. (2009) GmRAR1 and GmSGT1 are required for basal, R gene-mediated and systemic acquired resistance in soybean. Mol. Plant-Microbe Interact. 22, 86–95. Goebl, M. and Yanagida, M. (1991) The TPR snap helix: a novel protein repeat motif from mitosis to transcription. Trends Biochem. Sci. 16, 173–177. Greenberg, J.T. (1997) Programmed cell death in plant-pathogen interaction. Annu. Rev. Plant Physiol. Plant Mol. Biol. 48, 525–545. Greenberg, J.T. and Yao, N. (2004) The role and regulation of programmed cell death in plant–pathogen interactions. Cell. Microbiol. 6, 201–211. Grichar, W.J., Besler, B.A. and Jaks, A.J. (1998) Groundnut (Arachis hypogaea L.) cultivar response to leaf spot disease development under four disease management programs. Groundnut Sci. 25, 35–39. Holsters, M., De Waele, D. and Depicker, A. (1978) Transfection and transformation of Agrobacterium tumefaciens. Mol. Gen. Genet. 163, 181–187.


Sgt1 of the wild peanut, Arachis diogoi 83 Horsch, R.B., Fry, J.E., Hoffman, N.L., Eichholtz, D., Rogers, S.G. and Fraley, R.T. (1985) A simple and general method for transferring genes into plants. Science, 227, 1229–1231. Hoser, R., Zurczak, M., Lichocka, M., Zuzga, S., Dadlez, M., Samuel, M.A., Ellis, B.E., Stuttmann, J., Parker, J.E., Hennig, J. and Krzymowska, M. (2013) Nucleocytoplasmic partitioning of tobacco N receptor is modulated by SGT1. New Phytol. 200, 158–171. Hubert, D.A., Tornero, P., Belkhadir, Y., Krishna, P., Takahashi, A., Shirasu, K. and Dangl, J.L. (2003) Cytosolic HSP90 associates with and modulates the Arabidopsis RPM1 disease resistance protein. EMBO J. 22, 5679–5689. Jang, E.K., Min, K.H., Kim, S.H., Nam, S.H., Zhang, S., Kim, Y.C., Cho, B.H. and Yang, K.Y. (2009) Mitogen-activated protein kinase cascade in the signaling for polyamine biosynthesis in tobacco. Plant Cell Physiol. 50, 658–664. Jones, J.D. and Dangl, J.L. (2006) The plant immune system. Nature, 444, 323–329. Kamoun, S., Huitema, E. and Vleeshouwers, V.G. (1999) Resistance to oomycetes: a general role for the hypersensitive response? Trends Plant Sci. 4, 196–200. Kitagawa, K., Skowyra, D., Elledge, S.J., Harper, J.W. and Hieter, P. (1999) SGT1 encodes an essential component of the yeast kinetochore assembly pathway and a novel subunit of the SCF ubiquitin ligase complex. Mol. Cell, 4, 21–33. Kumar, K.R.R. and Kirti, P.B. (2010) A mitogen-activated protein kinase, AhMPK6 from peanut localizes to the nucleus and also induces defense responses upon transient expression in tobacco. Plant Physiol. Biochem. 48, 481–486. Kumar, K.R.R. and Kirti, P.B. (2011) Differential gene expression in Arachis diogoi upon interaction with groundnut late leaf spot pathogen Phaeoisariopsis personata and characterization of a pathogen induced cyclophilin. Plant Mol. Biol. 75, 497–513. Kumar, K.R.R. and Kirti, P.B. (2012) A novel role for a serine/arginine-rich splicing factor, AdRSZ21 in plant defence and HR-like cell death. Plant Mol. Biol. 80, 461–476. Lamb, J.R., Tugendreich, S. and Hieter, P. (1995) Tetratricopeptide repeat interactions: to TPR or not to TPR? Trends Biochem. Sci. 20, 257–259. Leister, R.T., Dahlbeck, D., Day, B., Li, Y., Chesnokova, O. and Staskawicz, B.J. (2005) Molecular genetic evidence for the role of SGT1 in the intramolecular complementation of Bs2 protein activity in Nicotiana benthamiana. Plant Cell, 17, 1268–1278. Liu, Y., Burch-Smith, T., Schiff, M., Feng, S. and Dinesh Kumar, S.P. (2004) Molecular chaperone Hsp90 associates with resistance protein N and its signalling proteins SGT1 and Rar1 to modulate an innate immune response in plants. J. Biol. Chem. 279, 2101–2108. Lorito, M., Woo, S.L., Fernandez, I.G., Colucci, G., Harman, G.E., Pintor-Toro, J.A., Filippone, E., Muccifora, S., Lawrence, C.B., Zoina, A., Tuzun, S. and Scala, F. (1998) Genes from mycoparasitic fungi as a source for improving plant resistance to fungal pathogens. Proc. Natl Acad. Sci. USA, 95, 7860–7865. Lu, R., Malcuit, I., Moffett, P., Ruiz, M.T., Peart, J., Wu, A.J., Rathjen, J.P., Bendahmane, A., Day, L. and Baulcombe, D.C. (2003) High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance. EMBO J. 22, 5690–5699. Martin, G.B., Bogdanove, A.J. and Sessa, G. (2003) Understanding the functions of plant disease resistance proteins. Annu. Rev. Plant Biol. 54, 23–61. Mayor, A., Martinon, F., De Smedt, T., Petrilli, V. and Tschopp, J. (2007) A crucial function of SGT1 and HSP90 in inflammasome activity links mammalian and plant innate immune responses. Nat. Immunol. 8, 497–503. Meldau, S., Baldwin, I.T. and Wu, J. (2011) SGT1 regulates wounding and herbivory-induced jasmonic acid accumulation and Nicotiana attenuata’s resistance to the specialist lepidopteran herbivore Manduca sexta. New Phytol. 189, 1143–1156. Mene-Saffrane, L., Esquerre-Tugaye, M.T. and Fournier, J. (2003) Constitutive expression of an inducible lipoxygenase in transgenic tobacco decreases susceptibility to Phytophthora parasitica var. nicotianae. Mol. Breeding, 12, 271–282.

Muskett, P. and Parker, J. (2003) Role of SGT1 in the regulation of plant R gene signalling. Microbes Infect. 5, 969–976. Nguyen, T.C., Lakshman, D.K., Han, J., Galvez, L.C. and Mitra, A. (2011) Transgenic plants expressing antimicrobial lactoferrin protein are resistant to a fungal pathogen. J. Plant Mol. Biol. Biotechnol. 2, 1–8. Noel, L.D., Cagna, G., Stuttmann, J., Wirthmuller, L., Betsuyaku, S., Witte, C.P., Bhat, R., Pochon, N., Colby, T. and Parker, J.E. (2007) Interaction between SGT1 and cytosolic/nuclear HSC70 chaperones regulates Arabidopsis immune responses. Plant Cell, 19, 4061–4076. Park, H.C., Kang, Y.H., Chun, H.J., Koo, J.C., Cheong, Y.H., Kim, C.Y., Kim, M.C., Chung, W.S., Kim, J.C., Yoo, J.H., Koo, Y.D., Koo, S.C., Lim, C.O., Lee, S.Y. and Cho, M.J. (2002) Characterization of a stamen-specific cDNA encoding a novel plant defensin in Chinese cabbage. Plant Mol. Biol. 50, 57–68. Peart, J.R., Cook, G., Feys, B.J., Parker, J.E. and Baulcombe, D.C. (2002) An EDS1 orthologue is required for N mediated resistance against tobacco mosaic virus. Plant J. 29, 569–579. Pontier, D., Gan, S., Amasino, R.M., Roby, D. and Lam, E. (1999) Markers for hypersensitive response and senescence show distinct patterns of expression. Plant Mol. Biol. 39, 1243–1255. Punja, Z.K. (2001) Genetic engineering of plants to enhance resistance to fungal pathogens—a review of progress and future prospects. Can. J. Plant Pathol. 23, 216–235. Qiao, W. and Fan, L.M. (2008) Nitric oxide signalling in plant responses to abiotic stresses. J. Integr. Plant Biol. 50, 1238–1246. Rohini, V.K. and Rao, S.K. (2000) Transformation of groundnut (Arachis hypogaea L.): a non-tissue culture based approach for generating transgenic plants. Plant Sci. 150, 41–49. Rohini, V.K. and Sankara Rao, K. (2001) Transformation of groundnut (Arachis hypogaea L.) with tobacco chitinase gene: variable response of transformants to leaf spot disease. Plant Sci. 160, 883–892. Shapiro, R.S., Zaas, A.K., Betancourt-Quiroz, M., Perfect, J.R. and Cowen, L.E. (2012) The Hsp90 Co-chaperone Sgt1 governs Candida albicans morphogenesis and drug resistance. PLoS ONE, 7, 44734. Shirasu, K. (2009) The HSP90-SGT1 chaperone complex for NLR immune sensors. Annu. Rev. Plant Biol. 60, 139–164. Shirasu, K. and Schulze-Lefert, P. (2003) Complex formation, promiscuity and multi-functionality: protein interactions in disease-resistance pathways. Trends Plant Sci. 8, 252–258. Sundaresha, S., Manoj Kumar, A., Rohini, S., Math, S.A., Keshamma, E., Chandrashekar, S.C. and Udayakumar, M. (2010) Enhanced protection against two major fungal pathogens of groundnut, Cercospora arachidicola and Aspergillus flavus in transgenic groundnut overexpressing a tobacco b 1–3 glucanase. Eur. J. Plant Pathol. 126, 497–508. Takahashi, A., Casais, C., Ichimura, K. and Shirasu, K. (2003) HSP90 interacts with RAR1 and SGT1 and is essential for RPS2-mediated disease resistance in Arabidopsis. Proc. Natl Acad. Sci. USA, 100, 11777–11782. Takahashi, Y., Uehara, Y., Berberich, T., Ito, A., Saitoh, H., Miyazaki, A., Terauchi, R. and Kusano, T. (2004) A subset of hypersensitive response marker genes, including HSR203J, is the downstream target of a spermine signal transduction pathway in tobacco. Plant J. 40, 586–595. Tedford, E.C., Miller, T.L. and Nielsen, M.T. (1990) A detached-leaves technique for detecting Phytophthora parasitica var. nicotianae in tobacco. Plant Dis. 74, 313–316. Tor, M., Yemm, A. and Holub, E. (2003) The role of proteolysis in R gene mediated defence in plants. Mol. Plant Pathol. 4, 287–296. Tu, C.C., Hsieh, T.F. and Chang, Y.C. (1996) Vegetable diseases incited by Rhizoctonia species. In Rhizoctonia Species: Taxonomy (Sneh, B., Jabaji-Hare, S., Neate, S. and Dijst, G., eds), pp. 369–379. Boston, MA: Molecular Biology, Ecology, Pathology and Disease Control, Kluwer Academic Publishers. Vijayan, S. and Kirti, P.B. (2012) Mungbean plants expressing BjNPR1 exhibit enhanced resistance against the seedling rot pathogen, Rhizoctonia solani. Transgenic Res. 21, 193–200. Wang, Y., Gao, M., Li, Q., Wang, L., Wang, J., Jeon, J.S., Qu, N., Zhang, Y. and He, Z. (2008) OsRAR1 and OsSGT1 physically interact and function in rice basal disease resistance. Mol. Plant-Microbe Interact. 21, 294–303. Wang, K., Uppalapati, S.R., Zhu, X., Dinesh Kumar, S.P. and Mysore, K.S. (2010) SGT1 positively regulates the process of plant cell death during both


84 Dilip Kumar and Pulugurtha Bharadwaja Kirti compatible and incompatible plant–pathogen interactions. Mol. Plant Pathol. 11, 597–611. Wu, Y., Wettstein, D.V., Kannangara, C.G., Nirmala, J. and Cook, R.J. (2006) Growth inhibition of the cereal root pathogens Rhizoctonia solani AG8, R. oryzae and Gaeumannomyces graminis var. tritici by a recombinant 42-kDa endochitinase from Trichoderma harzianum. Biocontrol Sci. Technol. 16, 631–646. Xing, L., Qian, C., Cao, A., Li, Y., Jiang, Z., Li, M., Jin, X., Hu, J., Zhang, Y., Wang, X. and Chen, P. (2013) The Hv-SGT1 gene from Haynaldia villosa contributes to resistances towards both biotrophic and hemi-biotrophic pathogens in common wheat (Triticum aestivum L.). PLoS ONE, 8, e72571. Yang, Y., Li, R. and Qi, M. (2000) In vivo analysis of plant promoters and transcription factors by agroinfiltration of tobacco leaves. Plant J. 22, 543–551. Zhang, S. and Liu, Y. (2001) Activation of salicylic acid-induced protein kinase, a mitogen activated protein kinase, induces multiple defence responses in tobacco. Plant Cell, 13, 1877–1889. Zhang, W., Chen, J., Zhang, H. and Song, F. (2008) Overexpression of a rice diacylglycerol kinase gene OsBIDK1 enhances disease resistance in transgenic tobacco. Mol. Cells, 26, 258–264. Zhang, M., Kadota, Y., Prodromou, C., Shirasu, K. and Pearl, L.H. (2010) Structural basis for assembly of Hsp90-Sgt1-CHORD protein complexes: implications for chaperoning of NLR innate immunity receptors. Mol. Cell, 39, 269–281.

Supporting information Additional Supporting information may be found in the online version of this article: Figure S1 Cloning of AdSGT1 from Arachis diogoi. Gel picture represent 50 RACE-PCR product of AdSGT1 and its ORF. Figure S2 Alignment of deduced amino acid sequence of AdSGT1 with closely related SGT1 sequences from other organisms.

Figure S3 The phylogenetic relationship of AdSGT1 with other SGT1 family members from different plant species. Figure S4 Transient constitutive expression of AdSGT1 induced cell death in tobacco leaf. Figure S5 Subcellular localization of AdSGT1. GFP was visualized using confocal images of representative Nicotiana benthamiana leaf epidermal cells transiently expressed through agroinfiltration. Figure S6 Semi-quantitative RT-PCR analysis of AdSGT1 expression in untransformed and T0 transgenic plants. Figure S7 Detached leaf assay with Alternaria alternata var. nicotianae and transgenic tobacco expressing AdSGT1-T2 plants. Figure S8 Screening of the T1 generation groundnut plants by PCR with nptII gene specific primers. Figure S9 Screening of the T2 generation groundnut plants by PCR with nptII gene specific primers. Figure S10 Screening of the T2 generation groundnut plants by PCR with 35S-F and SGT-R gene specific primers. Figure S11 Representative putative T1- SGT1 transgenic groundnut plants were screened by PCR amplified VirD2-F & VirD2-R primers. Figure S12 Southern hybridization analyses of peanut T1 transgenic plants expressing AdSGT1 gene. Figure S13 Relative expression of AdSGT1 examined by real-time reverse transcription-polymerase chain reaction (qRT-PCR) in groundnut transgenic AdSGT1-overexpressing lines. Figure S14 Phaeoisariopsis personata whole plant bioassay performed on T2-transgenic plants under green house conditions. Table S1, S2 Primers used in the study.
