Inhibitors of mammalian target of rapamycin downregulate ... - Nature

Oncogene (2008) 27, 2910–2922

& 2008 Nature Publishing Group All rights reserved 0950-9232/08 $30.00 www.nature.com/onc

ORIGINAL ARTICLE

Inhibitors of mammalian target of rapamycin downregulate MYCN protein expression and inhibit neuroblastoma growth in vitro and in vivo JI Johnsen1,6, L Segerstro¨m1,6, A Orrego2, L Elfman1, M Henriksson3, B Ka˚gedal4, S Eksborg1, B Sveinbjo¨rnsson1,5 and P Kogner1 1 Department of Woman and Child Health, Karolinska Institutet, Childhood Cancer Research Unit, Stockholm, Sweden; 2Department of Oncology and Pathology, Karolinska Institutet, Stockholm, Sweden; 3Department of Microbiology, Tumor and Cellbiology, Karolinska Institutet, Stockholm, Sweden; 4Division of Clinical Chemistry, Faculty of Health Sciences, Linko¨ping University, Sweden and 5Department of Cell Biology and Histology, University of Tromso¨, Tromso¨, Norway

Mammalian target of rapamycin (mTOR) has been shown to play an important function in cell proliferation, metabolism and tumorigenesis, and proteins that regulate signaling through mTOR are frequently altered in human cancers. In this study we investigated the phosphorylation status of key proteins in the PI3K/AKT/mTOR pathway and the effects of the mTOR inhibitors rapamycin and CCI-779 on neuroblastoma tumorigenesis. Significant expression of activated AKT and mTOR were detected in all primary neuroblastoma tissue samples investigated, but not in non-malignant adrenal medullas. mTOR inhibitors showed antiproliferative effects on neuroblastoma cells in vitro. Neuroblastoma cell lines expressing high levels of MYCN were significantly more sensitive to mTOR inhibitors compared to cell lines expressing low MYCN levels. Established neuroblastoma tumors treated with mTOR inhibitors in vivo showed increased apoptosis, decreased proliferation and inhibition of angiogenesis. Importantly, mTOR inhibitors induced downregulation of vascular endothelial growth factor A (VEGF-A) secretion, cyclin D1 and MYCN protein expression in vitro and in vivo. Our data suggest that mTOR inhibitors have therapeutic efficacy on aggressive MYCN amplified neuroblastomas. Oncogene (2008) 27, 2910–2922; doi:10.1038/sj.onc.1210938; published online 19 November 2007 Keywords: neuroblastoma; mTOR; rapamycin; CCI-779; MYCN; preclinical

the most common and deadly solid tumor of childhood (Brodeur, 2003). Amplification of the MYCN oncogene is associated with rapid tumor progression and frequently detected in advanced-stage neuroblastoma, but is also a major negative prognostic factor in localized tumors (Schwab et al., 2003). Advanced-stage tumors and those with MYCN amplification show typically emergence of treatment resistance, and alternative treatment strategies for these patients are therefore urgently needed. Proteins regulating signaling through the phosphatidylinositol 3-kinase (PI3K)/AKT/mTOR pathway are frequently altered in various cancers (Hennessy et al., 2005; Cully et al., 2006). Activation of PI3K, AKT or mTOR is associated with resistance to apoptosis, increased cell proliferation and deregulated cellular energy metabolism (Hennessy et al., 2005; Cully et al., 2006). mTOR, a serine/ threonine kinase, is a central regulator of cell growth and proliferation by controlling protein translation, cytoskeleton organization and energy metabolism (Hay, 2005; Hennessy et al., 2005; Cully et al., 2006). mTOR regulates translation by phosphorylation of ribosomal p70S6 kinase 1 (S6K1), thus allowing translation of ribosomal proteins, and cap-dependent translation through phosphorylation of eukaryotic translation initiation factor 4E-binding protein 1 (4E-BP1) (Hay, 2005; Hennessy et al., 2005; Cully et al., 2006) In this study we investigated the activation status of key protein involved in the PI3K/AKT/mTOR signaling pathway in neuroblastoma primary tumors and the effects of mTOR inhibition on neuroblastoma cell growth in vitro and in vivo.

Introduction Neuroblastoma, an embryonic tumor derived from primitive cells of the sympathetic nervous system, is Correspondence: L Segerstro¨m, Childhood Cancer Research Unit, Q6:05, Department of Women & Child Health, Karolinska Institutet, S-171-76, Stockholm, Sweden. E-mail: [email protected] 6 These authors contributed equally to this work. Received 4 April 2007; revised 21 September 2007; accepted 17 October 2007; published online 19 November 2007

Results Expression of phosphorylated AKT and mTOR in primary neuroblastoma, ganglioneuroma and non-malignant adrenal tissue samples We investigated 30 primary neuroblastoma tissue samples from different biological subsets and all clinical stages for the expression of activated AKT and mTOR using antibodies directed against phosphorylated AKT

mTOR inhibitors in neuroblastoma therapy JI Johnsen et al

2911

(pAKT ser473) and mTOR (pmTOR ser2448). All 30 samples analysed showed specific expression of pAKT and pmTOR in the cytoplasm (Table 1, Figure 1). Four ganglioneuromas were investigated and showed pAKT and pmTOR immunopositivity in the tumorderived ganglion cells but not in the surrounding benign stroma (Table 1, Figure 1). Non-malignant adrenals from children showed weak staining for pAKT and pmTOR in the cortex whereas the medulla, where the majority of primary neuroblastoma arises, was negative (Table 1, Figure 1). Antibodies directed against fulllength AKT and mTOR were used as controls to eliminate differences in the overall expression levels of the proteins (Figure 1). Inhibition of mTOR decrease neuroblastoma cell proliferation and clonogenic capacity Rapamycin and its ester-analog CCI-779 both form a complex with FK506-binding protein 12 and mTOR,

resulting in a potent inhibition of mTOR signaling (Hennessy et al., 2005). The effect of rapamycin or CCI779 on proliferation was investigated in seven neuroblastoma cell lines, of which three have MYCN gene amplification and express MYCN protein, three are not MYCN amplified but express MYCN protein and one has neither MYCN gene amplification nor expresses high levels of MYCN protein (Table 2; Beppu et al., 2004). All neuroblastoma cell lines demonstrated a concentrationdependent decrease in cell viability after 48 h of exposure (Figures 2a and b). Concentrations associated with 50% growth inhibition (biologic EC50) ranged from 10.6 to 15.2 mM (median 13.7 mM) for rapamycin and 9.5 to 19.1 mM (median 12.0 mM) for CCI-779 (Table 2). Neuroblastoma cell lines containing MYCN amplifications or expressing high levels of MYCN protein (Beppu et al., 2004) were significantly more sensitive to treatment with rapamycin or CCI-779 compared to cell lines expressing low MYCN protein levels (rapamycin; IMR-32 vs SK-NSH Po0.01, SK-N-DZ vs SH-SY5Y Po0.001, SH-SY5Y

Table 1 Clinical features of tumors and control samples investigated for pAKT and pmTOR Sample

Diaa

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23a 23b 24 25 26 27 28 29 30 31 32 33 34 35 36 37

NBe NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB NB GNl GN GN GN ADRm ADR ADR

Age (months)

Sex

Stage INSSb

MYCN amplifications

1p deletion

DNA Ploidy

High-riskc

Outcome

Survival (months)

PAKTd (ser473)

PmTORd (ser2448)

21 123 7 13 18 31 33 8 110 5 103 6 12 0 79 43 43 35 136 39 35 28 8 8 41 22 50 0 10 0 10 145 30 59 137 19 25 12

M F F M F M F F M F F M F M M F F F M F F M M M F M F M M M M M F F M F F F

1 1 1 1 1 2B 2A 2 2 2 2B 3 3 3 3 3 3 4 4 4 4 4 4Mk 4M 4 4 4 4S 4S 4S 4S

No No Yes No No No No No No No No No No No Yes No No No Yes Yes No Yes No No No Yes Yes No No No No

No No Yes No No No No No No No No NDi No No Yes No No Yes Yes Yes Yes Yes No No Yes Yes Yes No No ND No

4n 3n 2n

No No No No No No No No No No No No No No Yes No No Yes Yes Yes Yes Yes No No Yes Yes Yes No No No No

NEDf NED DODg NED NED NED NED NED NED AWDh NED NED NED DOCj NED NED NED NED DOD DOD NED NED NED NED NED DOD DOD NED NED NED NED NED AWD NED NED

159+ 131+ 8 41+ 153+ 165+ 179+ 68+ 58+ 58+ 173+ 174+ 157+ 0 96+ 65+ 65+ 57+ 10 9 57+ 109+ 59+ 59+ 93+ 44 18 152+ 75+ 174+ 75+ 108+ 92+ 75+ 122+

+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +

+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +

3n 3n 3n 2n 3n 2n 3n 5n 3n 3n 3n 3n 2n 2n 3n 3n 4n/5n 4n 3n 3n 4n 3n

a

Diagnosis. bINSS, International Neuroblastoma Staging System. cPatient fulfilling clinico-biological criteria to obtain high-risk therapy. Phosphorylated protein expression as assed by immunnohistochemistry according to Materials and methods. eNeuroblastoma. fNo evidence of disease. gDead of disease. hAlive with disease. iNot determined. jDead of surgical complications. kMultifocal primary. lGanglioneuroma. mNonmalignant adrenal gland. d

Oncogene


2912 Neuroblastoma

Ganglioneuroma

Non-malignant adrenal

pAKT (ser473)

AKT

pmTOR (ser2448)

mTOR

Figure 1 Immunohistochemistry of phosphorylated AKT(ser473), phosphorylated mTOR(ser2448), AKT and mTOR in neuroblastoma primary tumors, ganglioneuromas and non-malignant adrenals from children, showing specific staining of pAKT(ser473, top row) and pmTOR(ser2448, third row) in the cytoplasm of a neuroblastoma (sample no. 8, Table 1) and in differentiated ganglion cells of a benign ganglioneuroma (sample no 31, Table 1). Non-malignant adrenal showed weak staining of pAKT and pmTOR in the cortex but not in the medulla (sample no 36, Table 1). Staining of AKT (second row) and mTOR (bottom row) showed no differences in protein expression.

vs SK-N-SH Po0.001, CCI-779; IMR-32 vs SK-N-FI Po0.01, SK-N-DZ vs SK-N-FI Po0.001 and SK-N-DZ vs SK-N-AS Po0.01). No significant differences in sensitivity was observed for the MYCN amplified, multiresistant, p53 mutated SK-N-BE(2) cell line compared to the remaining panel of cell lines. To investigate the significance of neuroblastoma MYCN expression for mTOR inhibition, we examined the effect of rapamycin or CCI-779 on the proliferation of human neuroblastoma SH-EP cells containing a tetracycline-regulated MYCN transgene (Tet21N cells; Lutz et al., 1996). As shown in Figures 2c and d, Tet21N cells expressing MYCN (MYCN ON) was significantly more sensitive to treatment with mTOR inhibitors as compared to Tet21N cells not expressing MYCN (MYCN OFF, Po0.001). Clonogenic assay on three of the neuroblastoma cell lines further supported the antitumor effects of rapamycin and CCI-779, of which both induced a Oncogene

significant dose-dependent inhibition of colony formation (Po0.001; Figures 2e and f). Examination of lowdose, long-term drug exposure showed that both mTOR inhibitors significantly inhibited colony formation (Po0.001; Figures 2e and f). mTOR inhibitors induce cell cycle arrest and apoptosis of neuroblastoma cells To study the mechanisms of mTOR inhibitors on neuroblastoma cell growth, we evaluated the effect of rapamycin or CCI-779 on cell cycle progression and apoptosis. A pronounced accumulation of SH-SY5Y and SK-N-AS cells with hypodiploid DNA content (sub-G1) was observed after CCI-779 treatment and SH-SY5Y cells treated with rapamycin, whereas only a minor accumulation of hypodiploid cells was observed in SK-N-AS cells treated with rapamycin (Table 3). Moreover, rapamycin induced a


2913 Table 2 Rapamycin and CCI-779 treatment of neuroblastoma cell lines in vitro Rapamycin MYCN amplifications SK-N-AS IMR-32 SK-N-FI SK-N-DZ SH-SY5Y SK-N-BE(2) SK-N-SH Median

No Yes No Yes No Yes No

CCI-779

EC50a (mM)

s.d.

VC %b

EC50a (mM)

s.d.

VC %b

12.81 11.18 14.58 15.23 10.56 13.66 15.24 13.66

0.49 0.41 0.45 0.48 0.63 0.31 0.21 0.45

3.84 3.65 3.12 3.14 5.95 2.25 1.38 3.14

12.79 10.59 19.05 9.47 10.49 12.07 11.96 11.96

0.21 0.71 0.75 0.31 0.60 0.52 0.81 0.60

1.66 6.72 3.95 3.23 5.72 4.31 6.80 4.31

Cell growth was measured after 48 h of treatment with rapamycin or CCI-779 using the colorimetric MTT assay. aEffective concentration that inhibits 50% of cell proliferation (EC50). bVariable coefficient.

transient G1 arrest of SK-N-AS cells, whereas CCI-779 treatment induced an accumulation of S-phase cells (Table 3). To determine whether the reduction in neuroblastoma cell viability was due to apoptosis, western blotting to detect proteins in the apoptotic cascade was performed on rapamycin or CCI-779-treated cells. Activation of caspase-3 and subsequent cleavage of poly (ADP)-ribose polymerase (PARP), its downstream substrate, was evident in both cell lines treated with either mTOR inhibitor (Figure 3). mTOR inhibitors have profound effects on the growth of established neuroblastoma xenografts To investigate the therapeutic effects of mTOR inhibitors on neuroblastoma growth in vivo, nude mice carrying SH-SY5Y xenografts were treated with either rapamycin or CCI-779. Tumor growth was significantly inhibited after treatment for 3 days with rapamycin (P ¼ 0.016) or 4 days with CCI-779 (P ¼ 0.038) compared with untreated controls (Figure 4a). Tumor volumes were reduced by 56 and 71% after rapamycin or CCI-779 treatment, respectively, compared to controls at the end of treatment (Figure 4a). Quantification showed that both mTOR inhibitors significantly reduced expression of the nuclear proliferation marker Ki-67 (Po0.001), increased activation of caspase-3 (Po0.001) and decreased microvessel density (Po0.001) compared to untreated controls (Figure 4b). Inhibition of mTOR reduce neuroblastoma VEGF-A secretion Since inhibition of mTOR resulted in decreased vessel density, we evaluated the effect of rapamycin or CCI779 on the secretion of vascular endothelial growth factor A (VEGF-A) in four neuroblastoma cell lines. Concentrations of VEGF-A were significantly lower in cell-free culture media from rapamycin or CCI-779treated cells than in media from corresponding untreated controls (P ¼ 0.0022; all groups, Figure 4c). Effect of rapamycin and CCI-779 on mTOR target proteins Having established that both rapamycin and CCI-779 inhibited growth of neuroblastoma cells in vitro and

in vivo, we examined the effects on mTOR target proteins. Western blotting to detect phosphorylation of the mTOR downstream target proteins, S6K1 and 4E-BP1, revealed that both proteins displayed reduced phosphorylation after treatment with either mTOR inhibitor compared to untreated cells (Figure 5a). Analysis of SH-SY5Y xenografts by immunohistochemistry demonstrated a reduced expression of pmTOR(ser2448) and pS6K1(thr389) in tumors isolated from mice treated with either of the mTOR inhibitors (Figure 5b). Rapamycin has been reported to activate AKT (Sun et al., 2005). Therefore, we investigated the effect of mTOR inhibitors on the phosphorylation of AKT in neuroblastoma cells. Western blotting using a pAKT(ser473) specific antibody revealed a small increase of AKT phosphorylation and a reduction of pmTOR (ser2448) in all neuroblastoma cell lines investigated when treated with rapamycin or CCI-779 (Figure 5c). Also, immunohistochemistry of xenografts isolated from mice treated with either rapamycin or CCI-779 demonstrated increased phosphorylation of AKT. Combination of mTOR inhibitors with the PI3K-inhibitor LY294002 enhances neuroblastoma growth inhibition The activation of AKT by mTOR inhibitors in neuroblastoma cells may attenuate the growth inhibitory effect of these drugs. To investigate if this potential negative feedback mechanism had any effect on neuroblastoma cells, we treated SK-N-AS and SK-NBE(2) cells with a combination of rapamycin or CCI-779 and the PI3K inhibitor, LY294002. Both cell lines were treated with increasing concentrations of rapamycin, CCI-779 and LY294002. Single drug activity of LY294002 in SH-SY5Y and SK-N-BE(2) cells were determined in initial experiments (data not shown). Fixed concentration ratios of the drugs were used with serial dilutions for combination and single-drug treatment. As summarized in Table 4, showing the combination index (CI) at EC70, LY294002 induced a synergistic or additive cytotoxic effect in combination with rapamycin or CCI-779 in both the MYCN amplified neuroblastoma cell line SK-N-BE(2) as well as in the non-MYCN amplified cell line SK-N-AS. These results indicate that the combination of rapamycin or CCI-779 Oncogene


2914 100

Cell growth (% of control)

SK-N-F1 SK-N-DZ

50

SH-SY5Y SK-N-BE(2)

25

SK-N-SH

75

IMR-32

50

SK-N-DZ

SK-N-SH

8

10 15 20 25 Rapamycin concentration (µM)

100 Cell growth (% of control)

Rapamycin Tet21N MYCN ON

50

10 15 20 25 CCI-779 concentration (µM)

100

Rapamycin Tet21N MYCN OFF

75

25

75

CCI-779 Tet21N MYCN OFF

50

CCI-779 Tet21N MYCN ON

25

0

0 20

CCI-779 (µM)

SH-SY5Y

0

8h da ys

8h

5

µM

/7

/4

/4

µM

µM

l

75 50 25

da ys

/4 8h

/7

5

µM

8h /4

µM 10

15

8h /4

l

da ys

tro

µM

µM

0.

0. 5

µM

/7

/4

8h

8h /4

µM 15

10

µM

/4

µM

C

on tro

l

8h

0

5

da ys

8h /4

/7

0.

5

µM

µM

µM

/4 8h 15

/4 8h 10

l

µM

tro

0.

25 0

0 tro

on

5

50

on

25

100

75 Number of clones

50

on

C

/7 µM

5 0.

Number of clones

75

C

8h

8h da ys

8h 15

µM

µM 10

5

/4

/4

8h

l

/4

tro on C

µM

/4

/7 µM

0.

100

5

25 0

5

15

da ys

8h

8h /4

µM

µM

/4 10

on

5

C

µM

tro

l

8h

0

50

/4

25

25

75

10

50

50

µM

75

100

75

Number of clones

Number of clones

Number of clones

100

Number of clones

SK-N-BE(2)

SK-N-AS

15

15 10 Rapamycin (µM)

C

5

5

0

Rapamycin

SK-N-BE(2)

25 0

8

CCI-779

SK-N-F1 SH-SY5Y

0


SK-N-AS

IMR-32

75


100

SK-N-AS

Figure 2 Effects of mTOR inhibitors on the growth of neuroblastoma cells in vitro. Neuroblastoma cells were treated with increasing concentrations of (a) rapamycin or (b) CCI-779 for 48 h and cell growth was measured using MTT. Mean survival of six replicas is shown and the experiment was repeated three times with similar results. Effect of mTOR inhibitors on Tet21N cells. Tet21N are human neuroblastoma SH-EP cells stably transfected with a tetracycline-regulated MYCN expression construct. Tet21N cells were treated with (c) rapamycin or (d) CCI-779 in the absence or presence of doxycycline. Cell growth was measured by MTT assays. Mean survival of six replicates ±95% CI is shown. The experiment was repeated two times with similar results. Effect of mTOR inhibitors on the clonogenic capacity of neuroblastoma cells. SH-SY5Y, SK-N-AS and SK-N-BE(2) cells were treated with 5, 10 or 15 mM (e) rapamycin or (f) CCI-779, respectively for 48 h, or with 0.5 mM rapamycin or CCI-779 for 7 days to examine long-term effects of low-dose drug exposure.

Oncogene


2915 Table 3 Cell cycle analysis of rapamycin or CCI-779 treated neuroblastoma cells Time (h)

Treatment

SH-SY5Y 24 Control Rapamycin CCI-779

Sub-G1 (%)

G1 (%)

S (%)

G2 (%)

1.7 14.7 3.3

56.2 44.6 35.6

28.3 21.9 39.9

13.8 18.8 21.2

48

Control Rapamycin CCI-779

1.3 34.1 20.3

47.3 38.6 39.5

42.2 21.2 24.9

9.2 6.1 15.2

72


1.2 36.2 29.6

57.5 36.5 31.9

31.8 19.3 25.6

9.5 8.0 12.9

96


1.5 39.2 27.8

70.6 32.6 31.3

19.6 19.9 27

8.3 8.3 13.9


2.5 3.8 8

47.9 64.7 25.2

40.2 22.8 55.2

9.4 8.7 11.6

48


2.9 3.8 10.3

48.7 47.7 24.5

36.8 37.3 54.4

11.6 11.2 10.7

72


2.3 5.1 14.2

53.1 47.7 29.7

35.6 37.4 41.6

9 9.8 14.5

96


2.8 4.6 29.1

64.9 54.3 27.6

26.9 33.2 29.7

5.4 7.9 13.6

SK-N-AS 24

Moreover, it has been shown that MYCN is destabilized by GSK-3b through phosphorylation, whereas C-MYC can drive oncogenic cell proliferation through transcriptional upregulation of cyclin D1 expression (Kenney et al., 2004). To study the potential of mTOR inhibitors to modulate the activity of these proteins we treated neuroblastoma cells with rapamycin or CCI-779 and observed increased phosphorylation of GSK-3b and reduced expression of MYCN and cyclin D1 protein levels (Figure 5d). To further study the observed in vitro effect of mTOR inhibitors on MYCN and cyclin D1 protein expression, untreated neuroblastoma xenografts were compared to xenografts treated with rapamycin or CCI-779. Western blotting revealed a reduction of both MYCN and cyclin D1 proteins in xenografts treated with the mTOR inhibitors compared to untreated (Figure 5e). Similar, immunohistochemistry of xenografts revealed a reduction of MYCN expression in tumors treated with mTOR inhibitors (Figure 5b). We also investigated the effect of rapamycin or CCI-779 on MYCN and cyclin D1 transcription using real-time PCR. TaqMan analysis revealed no significant differences in MYCN or cyclin D1 mRNA expression in neuroblastoma cell lines or SH-SY5Y xenograft tumors treated with mTOR inhibitors compared to untreated control cells or tumors (data not shown). These results indicate that mTOR inhibitors regulate the expression of MYCN and cycling D1 at a post-transcriptional level.

Discussion

SH-SY5Y Ctrl Cleaved Caspase 3 PARP

R

SK-N-AS CCI

Ctrl

R

CCI -19 kD -17 kD -116 kD -89 kD

β-actin Figure 3 Effect of mTOR inhibitors on apoptotic proteins in neuroblastoma cells. SH-SY5Y and SK-N-AS cells were treated with 12 mM rapamycin or CCI-779 for 24 h and protein extracts were subjected to western blotting using antibodies detecting cleaved caspase-3 and poly (ADP)-ribose polymerase (PARP). The experiment was repeated twice with similar results and b-actin was used to ensure equal protein loading.

with LY294002 augmented the growth-inhibitory effect of neuroblastoma cells. mTOR inhibition downregulate expression of MYCN and cyclin D1 protein in vitro and in vivo Other studies suggest cyclin D1 as a key target of mTOR, and that activation of GSK-3b is critical for regulating cyclin D1 expression (Nelsen et al., 2003; Aguirre et al., 2004; Gera et al., 2004; Dong et al., 2005).

Recent studies indicate that numerous components of the PI3K/AKT/mTOR signaling pathway frequently are targets for amplification, translocations and mutations in cancer, with resultant activation of the pathway (Hennessy et al., 2005). We found that all primary neuroblastoma tumors investigated expressed activated pAKT and pmTOR. We also detected both pAKT and pmTOR in differentiated ganglion cells of ganglioneuroma, but not in the surrounding stroma or in nonmalignant adrenal medullas from children. Activation of AKT has recently been suggested to be a factor predicting poor outcome in neuroblastoma (Opel et al., 2007). Neuroblastoma exhibit increased expression of several growth factor receptors that transmit their signals through the PI3K/AKT/mTOR pathway (Vanhaesebroeck et al., 2001; Kozma and Thomas, 2002; Cully et al., 2006), such as insulin-like growth factor I receptor (IGF-IR; Singleton et al., 1996; Wang et al., 2001; Kim et al., 2004), epidermal growth factor receptor (EGFR; Ho et al., 2005), tyrosine receptor kinase B (TrkB; Macdonald et al., 2001; Ho et al., 2002; Jaboin et al., 2002), platelet-derived growth factor receptor B (PDGFRB; Eggert et al., 2000; Beppu et al., 2004) and c-KIT (Cohen et al., 1994; Vitali et al., 2003; Beppu et al., 2004; Uccini et al., 2005). Although a number of agents that target the PI3K or AKT pathway have been developed, no drugs have yet progressed to clinical cancer trials, whereas agents that Oncogene


2916 Ki-67

Casp-3

BS-1

Control

Rapamycin

CCI-779

Figure 4 Effect of mTOR inhibitors on neuroblastoma xenograft growth in vivo. NMRI nu/nu mice engrafted with 30 106 SH-SY5Y cells subcutaneously was randomized to receive rapamycin (5 mg kg1; n ¼ 9), CCI-779 (20 mg kg1; n ¼ 8) intraperitoneally daily for 12 days or no treatment (n ¼ 9), starting at the appearance of palpable tumors of B0.20 ml (mean 0.26 ml). (a) Comparison of tumor volumes from mice treated with rapamycin, CCI-779 or untreated controls (mean±s.d.). (b) Immunohistochemical staining of untreated xenografts (top row), xenografts treated with rapamycin (5 mg kg1, second row) or CCI-779 (20 mg kg1, third row). Proliferation was detected by Ki-67 (left panel; 400 magnification) and apoptosis by cleaved caspase-3 (middle panel; 400 magnification), whereas BS-1 lectin staining for murine endothelial cells was used for visualizing microvessel density (right panel; 200 magnification). Quantification (bottom row) of proliferation, apoptosis and microvessel density in xenografts treated with rapamycin or CCI-779 is shown in the diagrams (c). Effect of mTOR inhibitors on vascular endothelial growth factor A (VEGF-A) secretion by neuroblastoma cells. SH-SY5Y, SK-N-AS, SK-N-BE(2) and IMR-32 cells were incubated with 6 mM rapamycin or CCI779 for 72 h, cell free growth media collected and the concentration of VEGF-A was measured using VEGF-A DuoSet ELISA. Media from untreated cells were used as controls.

inhibit mTOR, like rapamycin and its analogs CCI-779 and RAD001, have been approved for clinical use and trials (Hennessy et al., 2005). Inhibitors of mTOR have been shown to function both as inhibitors of cell proliferation, leading to cell cycle arrest, and as cytotoxic agents, inducing apoptosis, depending on the tumor cell type (Cully et al., 2006). We show that treatment of neuroblastoma cells with rapamycin or CCI-779 induced apoptosis (Table 3), which was preceded by activation of caspase-3 and PARP (Figure 3). No activation of caspase-9 was observed for either treatment, indicating that neuroblastoma cells underwent apoptosis through the extrinsic pathway (data not shown). Rapamycin treatment induced a G1 arrest whereas CCI-779 induced cell cycle arrest in the S and G2 phase (Table 3). The observed S/G2 arrest may be due to repression of MYCN since MYCN has been shown to activate expression of S-phase specific cyclins, with cyclin D1 being one of the major mediators (Yaari et al., 2005). We also noticed that only a minor fraction of SK-N-AS cells treated with rapamycin had sub-G1 DNA content. However, we detected activation of caspase-3 and PARP cleavage in these cells (Table 3, Figure 3). Moreover, data from the proliferation assay (Figures 2a and b) and clonogenic assay (Figures 2e and Oncogene

f) showed a concentration-dependent inhibition of SKN-AS cell proliferation as well as an inhibition of clonogenic capacity. The reason for this discrepancy might be that some of the neuroblastoma cells are subjected to autophagy, a process that is closely regulated by mTOR (Easton and Houghton, 2006). We observed significant effects with rapamycin or CCI-779 treatment in vitro on all seven neuroblastoma cell lines, regardless of MYCN amplification or expression levels. Interestingly, MYCN-amplified cell lines were more sensitive to rapamycin or CCI-779 treatment compared to non-amplified cells, whereas cells with the lowest MYCN-expression showed the least sensitivity to rapamycin treatment (Table 2). To investigate if the difference in sensitivity to mTOR inhibitors was due to expression of MYCN, we investigated the effect of mTOR inhibitors in SH-EP cells containing a stably transfected tetracycline-inducible MYCN construct (Tet21N cells). Tet21N cells expressing MYCN was significantly more sensitive to treatment with mTOR inhibitors compared to Tet21N cells expressing no MYCN (Figures 2c and d). Taken together, these data suggest that MYCN is a target for mTOR inhibitors. Almost one-fourth of all neuroblastoma patients have amplification of MYCN and MYCN is a powerful


2917

predictor of aggressive biological behavior and poor clinical outcome. Dysregulation of MYCN expression is critically involved in the pathogenesis of the disease (Brodeur, 2003). The importance of MYCN amplification and overexpression in malignant progression of neuroblastoma is further supported by the development

of a mouse model having a MYCN transgene targeted to the developing neural crest by the tyrosine hydroxylase promoter. Depending on gene dose, these mice develop tumors with biological and genetic features that are highly similar to the aggressive MYCN amplified neuroblastomas seen in humans (Weiss et al., 1997).

SK-N-AS

SH-SY5Y Ctrl

R

CCI

Ctrl

R

CCI

p-S6K1 (thr389) S6K1 p4E-BP1 (ser65) 4E-BP1 β-actin

SK-N-AS

SH-SY5Y Ctrl

R

CCI

Ctrl

R

CCI

IMR-32

SK-N-BE(2) Ctrl

R

CCI

Ctrl

R

CCI

pmTOR (Ser 2448) mTOR pAkt (Ser 473) Akt β-actin

SK-N-AS

SH-SY5Y Ctrl

R

CCI

Ctrl

R

IMR-32

SK-N-BE(2) CCI

Ctrl

R

CCI

Ctrl

R

CCI

pGSK-3β (ser9) GSK-3β MYCN Cyclin D1 β-actin

Ctrl

R

CCI Cyclin D1 MYCN β-actin

Figure 5 Effects of rapamycin or CCI-779 on mTOR downstream targets and the expression of cyclin D1 and MYCN in neuroblastoma cells and xenografts. (a) Effect of mTOR inhibition on S6K1 and 4E-BP1 phosphorylation. Cells were treated with 12 mM rapamycin or CCI-779 for 24 h, and protein extracts were subjected to western blotting to detect pS6K1(thr389), S6K1, p4EBP1(ser65) and 4E-BP1. (b) Immunohistochemistry (following page) of xenograft tumors from untreated controls (left panel) or animals treated with rapamycin (5 mg kg1, middle panel) or CCI-779 (20 mg kg1, right panel). Sections were stained with antibodies detecting pAKT (ser473) (top row), AKT (second row), pmTOR (ser2448) (third row), mTOR (fourth row), pS6K1 (thr389) (fifth row), S6K1 (sixth row) and MYCN (bottom row). All 400 magnification. (c) Western blot of AKT and mTOR phosphorylation in neuroblastoma cells treated with mTOR inhibitors. Cells were treated as above and protein extracts were subjected to western blotting to detect pAKT(ser473) and mTOR(ser2448). (d) Effect of rapamycin or CCI-779 on GSK-3b phosphorylation, cyclin D1 and MYCN protein expression. Cells were treated as above, and protein extracts were subjected to western blotting to detect pGSK-3b(ser9), GSK-3b, cyclin D1 and MYCN. (e) Effect of mTOR inhibitors on cyclin D1 and MYCN protein expression in SH-SY5Y xenografts. Protein extracts from frozen xenografts tissue were subjected to western blotting with antibodies detecting cyclin D1 and MYCN. Antibodies detecting unphosphorylated AKT, mTOR, GSK-3b, S6K1 and 4E-BP1 were used as controls to exclude possible differences in total protein expression. b-actin was used to ensure equal protein loading. Oncogene


2918 Control

Rapamycin

CCI-779

pAKT (ser473)

AKT

pmTOR (ser2448)

mTOR

pS6K1 (thr389)

S6K1

MYCN

Figure 5

Oncogene

Continued.


2919 Table 4

Combination of mTOR inhibitors and the PI3K-inhibitor LY294002 on neuroblastoma cells

Combinationsa LY294002 (mM) 3.45 6.9 13.8 3.45 6.9 13.8

SK-N-AS

Rapamycin (mM)

CCI-779 (mM)

n

3.45 6.9 13.8 — — —

— — — 3.45 6.9 13.8

5 5 5 5 5 5

Mean CI at EC70 (95% CI) 0.70 0.81 1.01 0.53 0.76 0.92

(0.61–0.80) (0.66–0.95) (0.68–1.33) (0.50–0.56) (0.67–0.86) (0.76–1.08)

SK-N-BE(2) Effectb

n

Synergistic Synergistic Additive Synergistic Synergistic Additive

5 5 5 5 5 5

Mean CI at EC70 (95% CI) 0.37 0.45 0.46 0.49 0.65 0.48

(0.32–0.42) (0.33–0.58) (0.41–0.52) (0.46–0.53) (0.60–0.71) (0.43–0.54)

Effectb Synergistic Synergistic Synergistic Synergistic Synergistic Synergistic

a Neuroblastoma cells were treated with a combination of equimolar concentrations of rapamycin, CCI-779 and LY294002 for 48 h and cell survival was measured by the MTT assay. bSynergistic effects are defined as a CI mean statistically significantly lower than 1 and additive effects as a CI mean not significantly higher or lower than 1 (one sample t-test, Po0.05).

Given the important role of MYCN expression in highrisk neuroblastoma and the limited expression in other postnatal tissues (Grimmer and Weiss, 2006), the MYCN protein appears to be an attractive candidate for targeted therapy. We here show that both rapamycin and CCI-779 have profound effects on MYCN protein expression, suggesting that mTOR inhibitors may be effective in the treatment of aggressive neuroblastoma expressing high levels of MYCN. This is supported by the recent findings that small-molecule inhibitors of PI3K, LY294002 or wortmannin, represent an effective preclinical therapy for neuroblastoma through destabilization of MYCN (Chesler et al., 2006). This further indicate that dysregulation of the PI3K/AKT/mTOR pathway are important in the malignant progression of neuroblastoma. Treatment of neuroblastoma cells with mTOR inhibitors also resulted in phosphorylation of GSK-3b and reduced expression of cyclin D1. GSK-3b has been shown to be critical for the regulation of cyclin D1 expression and to destabilize MYCN through phosphorylation (Nelsen et al., 2003; Aguirre et al., 2004; Gera et al., 2004; Kenney et al., 2004; Dong et al., 2005). Moreover, C-MYC has been shown to transcriptionally upregulate cyclin D1 expression (Yu et al., 2005). Hence, inhibition of mTOR signaling affects the expression of several proteins shown to be important in the tumorigenesis of neuroblastoma. We found that rapamycin or CCI-779 inhibited growth of human neuroblastoma xenograft tumors in nude mice (Figure 4a). Proliferation, apoptosis and microvessel density was quantified (Figure 4b) to further understand the basis for this effect. Rapamycin and CCI-779-treated xenografts showed significant reduction of proliferation and increased apoptosis in vivo compared to untreated controls (Figure 4b). Treated tumors also had a significant reduction in microvessel density compared to untreated (Figure 4b), a parameter that is previously shown to correlate to poor prognosis (Meitar et al., 1996). One of the most potent inducers of angiogenesis is VEGF-A, which induces endothelial cell proliferation and migration (Ferrara and Alitalo, 1999). The majority of neuroblastoma cell lines and tumors express VEGF-A and the levels of expression have been correlated with both disease progression and poor prognosis (Meitar et al., 1996; Eggert et al., 2000).

Moreover, VEGF-A secreted by neuroblastoma cells contributes to the growth of endothelial cells in vitro and to angiogenesis in vivo (Eggert et al., 2002) whereas blockade of VEGF-A function is associated with suppression of neuroblastoma growth (Davidoff et al., 2001; Kim et al., 2002; Segerstrom et al., 2006). VEGFA expression has also been correlated with higher levels of AKT and mTOR phosphorylation in various human tumors (Klos et al., 2006). Our data showing that rapamycin or CCI-779 treatment reduce the production of VEGF-A (Figure 4c) suggest that inhibition of mTOR may suppress neuroblastoma growth by inhibition of angiogenesis, contributing to the observed reduction in proliferation and increase of apoptosis. AKT and mTOR are linked to each other via positive and negative regulatory feedback loops, which might have been evolved as a protective mechanism to inhibit uncontrolled cell survival and proliferation (Hay, 2005). Rapamycin has been shown to activate AKT (Sun et al., 2005). We observed increased phosphorylation of AKT when neuroblastoma cells or xenograft tumors were treated with rapamycin or CCI-779 (Figures 5b and c). This may potentially be a dilemma when designing anticancer therapies using these compounds. This is supported by our findings that a combination of mTOR inhibitors with LY294002 inhibited neuroblastoma cell proliferation in a synergistic or additive manner in vitro (Table 4). Therefore, treatment with agents that simultaneously target receptors transmitting signals through the PI3K/AKT/mTOR pathway or AKT itself, in combination with inhibitors of mTOR, may prove to be more efficacious. Taken together, our results suggest that the PI3K/ AKT/mTOR signaling pathway is constitutively activated in neuroblastoma and that mTOR inhibitors targeting key proteins in this pathway may represent an approach for the treatment of children with neuroblastoma.

Materials and methods Tissue samples and patient characteristics Thirty neuroblastoma tumor tissue samples from different clinical (age, stage and risk group) or biological (MYCN amplification, 1p deletion and DNA ploidy) subsets were examined (Table 1). Four ganglioneuromas and three non-malignant adrenal glands from Oncogene


2920 children, ages 12–25 months, were also included (Table 1). Ethical approval was obtained by the Karolinska University Hospital Research Ethics Committee (Approval no. 03–708). Chemicals Rapamycin (Sirolimus, LC Laboratories, Woodburn, MA, USA) or CCI-779, an ester-analog of rapamycin (Temsirolimus, a kind gift from Wyeth Pew River, NY, USA), was dissolved in 99.5% ethanol while the PI3K-inhibitor LY294002 (Cell Signaling, Beverly, MA, USA) was dissolved in dimethyl sulfoxide. All inhibitors were further diluted in OptiMEM (Gibco BRL, Sudbyberg, Sweden) to the desired in vitro concentration. For in vivo use of rapamycin and CCI779, the stock was diluted in 5% PEG 400 (Sigma-Aldrich, Solna, Sweden), 5% Tween 20 (BioRad, Sundbyberg, Sweden) and 0.9% sterile saline. Each dose was freshly prepared prior to injection. Neuroblastoma cell lines Human neuroblastoma cell lines were grown in Eagle Minimal Essential Medium (SH-SY5Y, Sigma-Aldrich) or RPMI 1640 (SK-N-BE(2), SK-N-AS, SK-N-FI, SK-N-SH, SK-N-DZ, IMR-32 and Tet21N; Gibco) medium supplemented with 10% fetal bovine serum (Gibco) and 2 mM L-glutamine (Sigma-Aldrich) at 37 1C humidified 5% CO2 atmosphere. Tet21N are neuroblastoma SH-EP cells containing a tetracycline-regulated NMYC transgene (Tet-Off) and were maintained as described previously (Lutz et al., 1996). The cells were continuously grown as MYCN ON and MYCN were switched OFF ( þ Tet) 24 ho prior to experiments. Cytotoxic and clonogenic assay Effects of rapamycin, CCI-779 or LY294002 on neuroblastoma cell growth were determined using a colorimetric 3-(4,5dimethylthiazol-2-yl)-2,5-diphenyl-tetrazoleum (MTT) assay (Sigma-Aldrich). Five or six parallels of each treatment were performed in each experiment. The concentration that inhibited 50% of cell proliferation (EC50) was calculated. To determine clonogenic capacity, neuroblastoma cells were seeded, allowed to attach for 24 h and treated with rapamycin or CCI-779 for 48 h (5, 10 or 15 mM) or 7 days (0.5 mM). Clones were then grown in drug-free media for 10 days, fixed in formaldehyde, stained with Giemsa (Gibco) and colonies (>50 cells) were counted manually. Fluorescence-activated cell sorting SH-SY5Y and SK-N-AS cells were treated with 16 mM rapamycin or CCI-779 for 24, 48, 72 or 96 h. Cells were harvested, stained with 40 ,6-diamidino-2-phenylindole (DAPI) and subjected to cell cycle analysis using single parameter DNA flow cytometry as described previously (Ponthan et al., 2003). In vivo xenografts and administration of mTOR inhibitors Nude animal housing and engrafting was done as described previously (Segerstrom et al., 2006). Tumors were measured daily with a digital caliper and tumor volume calculated as length width2 0.44. At a tumor volume of X0.2 ml (mean 0.26 ml) the animals were randomized to receive either rapamycin (5 mg kg1) or CCI-779 (20 mg kg1) intraperitoneally daily for 12 days or no treatment (controls). Tumor materials was fixed in 4% paraformaldehyde and frozen in liquid nitrogen and stored at 4 or 80 1C, respectively. Animal experiments were approved by the regional ethics committee (N234-05) in accordance with national regulations (SFS 1988:534, SFS 1988:539 and SFS 1988:541). Oncogene

Immunohistochemistry Sections were incubated with primary antibody phospho-AKT (ser473), phospho-mTOR (ser2448), phospho-S6K1 (thr389), AKT, mTOR and S6K1 (Cell Signaling), Ki-67 (NeoMarkers, Fremont, CA, USA), MYCN (Oncogene Research Products, Darmstadt, Germany) or cleaved caspase-3 (R&D Systems, Abingdon, UK). As a secondary antibody, the HRP-SuperPicture Polymer detection kit and matched isotype controls were used (Zymed Laboratories Inc., San Francisco, CA, USA). Bandeirea simplifolica (BS-1; Sigma-Aldrich) lectin was used to highlight murine endothelial cells as described previously (Segerstrom et al., 2006; Ponthan et al., 2007). Proliferation (Ki-67) and apoptosis (cleaved caspase-3) were quantified at 400 magnification, whereas microvessel density (BS-1) was quantified at 200. Fifteen randomly chosen fields per slide and four slides per group were quantified for each staining. Ki-67 is presented as the proportion of positively staining cells over the total number of cells, whereas microvessel density and caspase-3 positive cells are presented as an average number per field. Western blotting Cells were treated with 16 mM rapamycin or CCI-779 and proteins extracted on ice either in 1 SDS sample buffer (BioRad) or in RIPA buffer (Cell Signaling) containing protease inhibitors (Roche Diagnostic, Mannheim, Germany). Frozen xenograft tissues were homogenized on ice in RIPA buffer and cleared by repeated centrifugations. Protein concentrations were measured using Bradford reagent (BioRad). Equal quantities were separated by SDS–PAGE, transferred to nylon membranes (Millipore Inc., Sundbyberg, Sweden) and probed with antibodies against phosphoAKT(ser473), phospho-mTOR(ser2448), phospho-S6K1(thr389), phospho-4E-BP1(ser65), phospho-GSK-3b(ser9), AKT, mTOR, S6K1, 4E-BP1, GSK-3b, caspase-9, cleaved caspase-3, PARP, cyclin D1 (Cell Signaling), MYCN (Oncogene Research Products) and b-actin (Sigma-Aldrich). Anti-mouse IgG or anti-rabbit IgG, conjugated with horseradishperoxidase (Cell Signaling) were used as secondary antibodies, and Pierce Super Signal (Pierce, Rockford, IL, USA) for chemiluminescent detection. Analysis of cyclin D1, MYCN and b2-microglobulin transcripts RNA was isolated and cDNA synthesized as earlier described (Kagedal et al., 2004). For MYCN mRNA quantification the forward primer was ACCCTGAGCGATTCAGATGAT, the reverse primer GTGGTGACAGCCTTGGTGTT and the probe TGGAGAAGCGGCGTTCCTCCTC. For cyclin D1 mRNA quantification the forward primer was AACAAACAG ATCATCCGCAAAC, the reverse primer ACCATGGA GGGCGGATT and the probe TCTGTGCCACAGATGT GAA. For b2-microglobulin mRNA quantification the forward primer was GAGTATGCCTGCCGTGTG, the reverse primer AATCCAAATGCGGCATCT and the probe CCTCCATGATGCTGCTTACATGTCTC. The probes were labeled with FAM at the 50 ends and TAMRA at the 30 ends (Applied Biosystems, Foster City, CA, USA). Double stranded DNA calibrators were synthesized for each transcript according to principles described earlier (Kagedal et al., 2004). Vascular endothelial growth factor A measurement Neuroblastoma cells were treated with 6 mM rapamycin or CCI-779 for 72 h and cell-free culture supernatant harvested. Soluble VEGF-A was measured using the VEGF DuoSet ELISA (R&D Systems) to manufacturers specifications.


2921 Statistical analysis EC50 values were evaluated from a plot of survival versus the logarithm of the molar drug concentration, using a standard dose–response curve defined by four parameters, that is, the baseline response (Bottom), the maximum response (Top), the slope (Hill slope) and the drug concentration. ^ Response ¼ Bottom þ ðTop BottomÞ=ð1 þ 10ððlog EC50x Þ Hill slopeÞÞ

ð1Þ

where x is the logarithm of the drug concentration. Non-linear regression analysis was performed by the PCNONLIN program (version 2.0). Data was initially fitted to Eq. (1) with the Hill slope fixed to 1, but also fitted along with the other parameters. The choice of the final model was based on the F-ratio test. Mann–Whitney U-test and the Kruskal–Wallis test (non-parametric ANOVA) followed by Dunn’s multiple

comparison test were used for analysis of statistical differences between two and several independent populations, respectively. All statistical tests were two-sided. Testing for synergistic or additive effects of combination therapy the data was done as described (Ponthan et al., 2007). Acknowledgements We thank M Schwab (German Cancer Research Centre, DKFZ, Heidelberg, Germany) for providing us with the Tet21N cell line. This work was supported by grants from the Swedish Childhood Cancer Foundation, The Swedish Cancer Foundation, The Swedish Research Council and Ma¨rta and Gunnar V Philipson Foundation.

References Aguirre D, Boya P, Bellet D, Faivre S, Troalen F, Benard J et al. (2004). Bcl-2 and CCND1/CDK4 expression levels predict the cellular effects of mTOR inhibitors in human ovarian carcinoma. Apoptosis 9: 797–805. Beppu K, Jaboine J, Merchant MS, Mackall CL, Thiele CJ. (2004). Effect of imatinib mesylate on neuroblastoma tumorigenesis and vascular endothelial growth factor expression. J Natl Cancer Inst 96: 46–55. Brodeur GM. (2003). Neuroblastoma: biological insights into a clinical enigma. Nat Rev Cancer 3: 203–216. Chesler L, Schlieve C, Goldenberg DD, Kenney A, Kim G, Mcmillan A et al. (2006). Inhibition of phosphatidylinositol 3-kinase destabilizes Mycn protein and blocks malignant progression in neuroblastoma. Cancer Res 66: 8139–8146. Cohen PS, Chan JP, Lipkunskaya M, Biedler JL, Seeger RC. (1994). Expression of stem cell factor and c-kit in human neuroblastoma. The Children’s Cancer Group. Blood 84: 3465–3472. Cully M, You H, Levine a J, Mak TW. (2006). Beyond PTEN mutations: the PI3K pathway as an integrator of multiple inputs during tumorigenesis. Nat Rev Cancer 6: 184–192. Davidoff AM, Leary MA, Ng CY, Vanin EF. (2001). Gene therapymediated expression by tumor cells of the angiogenesis inhibitor flk-1 results in inhibition of neuroblastoma growth in vivo. J Pediatr Surg 36: 30–36. Dong J, Peng J, Zhang H, Mondesire WH, Jian W, Mills GB et al. (2005). Role of glycogen synthase kinase 3beta in rapamycinmediated cell cycle regulation and chemosensitivity. Cancer Res 65: 1961–1972. Easton JB, Houghton PJ. (2006). mTOR and cancer therapy. Oncogene 25: 6436–6446. Eggert A, Grotzer MA, Ikegaki N, Liu XG, Evans a E, Brodeur GM. (2002). Expression of the neurotrophin receptor TrkA down-regulates expression and function of angiogenic stimulators in SH-SY5Y neuroblastoma cells. Cancer Res 62: 1802–1808. Eggert A, Ikegaki N, Kwiatkowski J, Zhao H, Brodeur GM, Himelstein BP. (2000). High-level expression of angiogenic factors is associated with advanced tumor stage in human neuroblastomas. Clin Cancer Res 6: 1900–1908. Ferrara N, Alitalo K. (1999). Clinical applications of angiogenic growth factors and their inhibitors. Nat Med 5: 1359–1364. Gera JF, Mellinghoff IK, Shi Y, Rettig MB, Tran C, Hsu JH et al. (2004). AKT activity determines sensitivity to mammalian target of rapamycin (mTOR) inhibitors by regulating cyclin D1 and c-myc expression. J Biol Chem 279: 2737–2746. Grimmer MR, Weiss WA. (2006). Childhood tumors of the nervous system as disorders of normal development. Curr Opin Pediatr 18: 634–638. Hay N. (2005). The Akt-mTOR tango and its relevance to cancer. Cancer Cell 8: 179–183.

Hennessy BT, Smith DL, Ram PT, Lu Y, Mills GB. (2005). Exploiting the PI3K/AKT pathway for cancer drug discovery. Nat Rev Drug Discov 4: 988–1004. Ho R, Eggert A, Hishiki T, Minturn JE, Ikegaki N, Foster P et al. (2002). Resistance to chemotherapy mediated by TrkB in neuroblastomas. Cancer Res 62: 6462–6466. Ho R, Minturn JE, Hishiki T, Zhao H, Wang Q, Cnaan A et al. (2005). Proliferation of human neuroblastomas mediated by the epidermal growth factor receptor. Cancer Res 65: 9868–9875. Jaboin J, Kim CJ, Kaplan DR, Thiele CJ. (2002). Brain-derived neurotrophic factor activation of TrkB protects neuroblastoma cells from chemotherapy-induced apoptosis via phosphatidylinositol 30 -kinase pathway. Cancer Res 62: 6756–6763. Kagedal B, Kullman A, Lenner L, Trager C, Kogner P, Farneback M. (2004). Pterin-dependent tyrosine hydroxylase mRNA is not expressed in human melanocytes or melanoma cells. Pigment Cell Res 17: 346–351. Kenney AM, Widlund HR, Rowitch DH. (2004). Hedgehog and PI-3 kinase signaling converge on Nmyc1 to promote cell cycle progression in cerebellar neuronal precursors. Development 131: 217–228. Kim B, Van Golen CM, Feldman EL. (2004). Insulin-like growth factor-I signaling in human neuroblastoma cells. Oncogene 23: 130–141. Kim ES, Serur A, Huang J, Manley CA, Mccrudden KW, Frischer JS et al. (2002). Potent VEGF blockade causes regression of coopted vessels in a model of neuroblastoma. Proc Natl Acad Sci USA 99: 11399–11404. Klos KS, Wyszomierski SL, Sun M, Tan M, Zhou X, Li P et al. (2006). ErbB2 increases vascular endothelial growth factor protein synthesis via activation of mammalian target of rapamycin/p70S6 K leading to increased angiogenesis and spontaneous metastasis of human breast cancer cells. Cancer Res 66: 2028–2037. Kozma SC, Thomas G. (2002). Regulation of cell size in growth, development and human disease: PI3K, PKB and S6K. Bioessays 24: 65–71. Lutz W, Stohr M, Schurmann J, Wenzel A, Lohr A, Schwab M. (1996). Conditional expression of N-myc in human neuroblastoma cells increases expression of alpha-prothymosin and ornithine decarboxylase and accelerates progression into S-phase early after mitogenic stimulation of quiescent cells. Oncogene 13: 803–812. Macdonald TJ, Brown KM, Lafleur B, Peterson K, Lawlor C, Chen Y et al. (2001). Expression profiling of medulloblastoma: PDGFRA and the RAS/MAPK pathway as therapeutic targets for metastatic disease. Nat Genet 29: 143–152. Meitar D, Crawford SE, Rademaker AW, Cohn SL. (1996). Tumor angiogenesis correlates with metastatic disease, N-myc amplification, and poor outcome in human neuroblastoma. J Clin Oncol 14: 405–414. Oncogene


2922 Nelsen CJ, Rickheim DG, Tucker MM, Hansen LK, Albrecht JH. (2003). Evidence that cyclin D1 mediates both growth and proliferation downstream of TOR in hepatocytes. J Biol Chem 278: 3656–3663. Opel D, Poremba C, Simon T, Debatin KM, Fulda S. (2007). Activation of Akt predicts poor outcome in neuroblastoma. Cancer Res 67: 735–745. Ponthan F, Johnsen JI, Klevenvall L, Castro J, Kogner P. (2003). The synthetic retinoid RO 13-6307 induces neuroblastoma differentiation in vitro and inhibits neuroblastoma tumour growth in vivo. Int J Cancer 104: 418–424. Ponthan F, Wickstrom M, Gleissman H, Fuskevag OM, Segerstrom L, Sveinbjornsson B et al. (2007). Celecoxib prevents neuroblastoma tumor development and potentiates the effect of chemotherapeutic drugs in vitro and in vivo. Clin Cancer Res 13: 1036–1044. Schwab M, Westermann F, Hero B, Berthold F. (2003). Neuroblastoma: biology and molecular and chromosomal pathology. Lancet Oncol 4: 472–480. Segerstrom L, Fuchs D, Backman U, Holmquist K, Christofferson R, Azarbayjani F. (2006). The anti-VEGF antibody bevacizumab potently reduces the growth rate of high-risk neuroblastoma xenografts. Pediatr Res 60: 576–581. Singleton JR, Randolph a E, Feldman EL. (1996). Insulin-like growth factor I receptor prevents apoptosis and enhances neuroblastoma tumorigenesis. Cancer Res 56: 4522–4529. Sun SY, Rosenberg LM, Wang X, Zhou Z, Yue P, Fu H et al. (2005). Activation of Akt and eIF4E survival pathways by rapamycin-

Oncogene

mediated mammalian target of rapamycin inhibition. Cancer Res 65: 7052–7058. Uccini S, Mannarino O, Mcdowell HP, Pauser U, Vitali R, Natali PG et al. (2005). Clinical and molecular evidence for c-kit receptor as a therapeutic target in neuroblastic tumors. Clin Cancer Res 11: 380–389. Vanhaesebroeck B, Leevers SJ, Ahmadi K, Timms J, Katso R, Driscoll PC et al. (2001). Synthesis and function of 3-phosphorylated inositol lipids. Annu Rev Biochem 70: 535–602. Vitali R, Cesi V, Nicotra MR, Mcdowell HP, Donfrancesco A, Mannarino O et al. (2003). c-Kit is preferentially expressed in MYCN-amplified neuroblastoma and its effect on cell proliferation is inhibited in vitro by STI-571. Int J Cancer 106: 147–152. Wang JY, Del Valle L, Gordon J, Rubini M, Romano G, Croul S et al. (2001). Activation of the IGF-IR system contributes to malignant growth of human and mouse medulloblastomas. Oncogene 20: 3857–3868. Weiss WA, Aldape K, Mohapatra G, Feuerstein BG, Bishop JM. (1997). Targeted expression of MYCN causes neuroblastoma in transgenic mice. EMBO J 16: 2985–2995. Yaari S, Jacob-Hirsch J, Amariglio N, Haklai R, Rechavi G, Kloog Y. (2005). Disruption of cooperation between Ras and MycN in human neuroblastoma cells promotes growth arrest. Clin Cancer Res 11: 4321–4330. Yu Q, Ciemerych MA, Sicinski P. (2005). Ras and Myc can drive oncogenic cell proliferation through individual D-cyclins. Oncogene 24: 7114–7119.