Interleukin-4 Inhibits Indoleamine 2,3-Dioxygenase ...

Interleukin-4 Inhibits Indoleamine 2,3-Dioxygenase Expression in Human Monocytes By Tiziana Musso, G. Luca Gusella,Alan Brooks, Dan L. Longo, and Luigi Varesio Indoleamine 23dioxygenase (IDO), aflavin-dependent enzyme that catalyzes the conversionof tryptophan to kynurenine, is induced in peripheral blood mononuclear cells that by interferon-y(IFNy). Interleukin-4 (IL-4) is a cytokine modulates the functional properties of monocytes/macrophages, andwe investigatedthe effectsof IL-4 on IDO. We showed that IL-4 inhibited the induction of ID0 rnRNA and

ID0 activity by IFNy in human monocytes. The inhibitory effect was evident with as little as 2 U/mL of IL-4. These results provide the first evidencethat a cytokine can provide a negativesignal forID0 expression andthat IL-4 can influence the catabolism of tryptophan. This is a US government work. There are no restrictions on its use.

I

under immunologic control. We show that IL-4 isa potent inhibitor of 1FN-y-inducedI D 0 activity, suggesting that IL4 can play an important role in controllingthe catabolism of tryptophan.

NDOLEAMINE 2,3-dioxygenase ( I D O ) is a flavin-dependent enzyme that uses superoxide anion to catalize the degradation of tryptophan and other indole derivatives, such as 5-hydroxytryptophan, tryptamine, and serotonin to kynurenine.’ This enzyme isfound in all tissues examined so far and is inducible preferentiallyby interferons (IFNs) and IFN-inducers such as lipopolysaccharide (LPS) and viruses.’ The induction of ID0 has been associated withthe antiproliferative activity of IFNy on tumor cells,3 antimicrobial effectsof IFNy on pathogens such as Toxoplasma gondii and Clamydia p~ittaci.~*’ Human peripheral blood mononuclear cells (PBMCs)express I D 0 after in vitro stimulation with IFNy, a,and p” and they are the main source of ID0 activity in response to IFNy.Thus, I D 0 can be considered an IFNy-inducible genethat mediates some of the IFNy biologic activities. Interleukin-4 (IL-4)is a cytokine that exerts a dual role on mononuclear phagocytes. IL-4 can downregulate the activation of mononuclear phagocyte^'.^ and antagonize IFNyand IL-2-induced responses including the production of IL1, IL-6, tumor necrosis factor CY (TNFcY),~”’ hydrogen peroxide production, and antileishmanial activity.” However, IL-4 can alsostimulate monocytic functions.For example, IL-4 can induce antigen presentation, expressionof major histocompatibility complex class 11’32’4and CD23,” and production of G-CSF, M-CSFI6 and the C2 complement protein.17We wereinterested in exploringthe potential control exerted by IL-4 on I D 0 expression/activity in human monocytes to determine whether ID0 expression could be From the Biological Carcinogenesis and Development Program, PRI/DynCorp, Instituie of Microbiology, University of Turin, Turin, Italy; and the Ofice ofthe Associate Director, Biological Response Modifiers Program, Division of Cancer Treatment and Laboratory of Molecular Immunology, National Cancer lnstituteFrederick Cancer Research and Development Center, Frederick, MD. Submilled July 9, 1993;accepted October 26, 1993. The content of this publication does not necessarily reflect the views or policies of the Department of Health and Humanservices, nor does mention of trade names, commercial products, or organizations implyendorsement by the US Government. Address reprini requests to TizianaMusso, PhD, Frederick Cancer Research and Development Center Bldg 560, Frederick, MD 21702-1201. The publicationcosls of this article were defrayed in part by page charge payment.This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. section 1734 sole1.v to indicate this fact. This is a USgovemmenl work. There are no restrictions on its use. 0006-4971/94/8305-0005$0.00/0 1408

MATERIALSANDMETHODS

Cell culture. Monocytes were purified from PBMCsby centrifugal elutriation as described elsewhere.”The punty of the monocyte preparation used in these study was 93%? 3% as assessed by morphology on Giemsa-stained cytocentrifuge preparations and flow cytometry using the monocyte-specific monoclonal antibody LeuM3. Cells were cuhured in RPM1 1640 (Advanced Biotecnology, Inc, Columbia, MD), containing penicillin 100 U/mL, streptomycin 100 pg/mL, L-glutamine 2 mmol/L, HEPES 20 mmol/L (GIBCO,Grand Island, NY), and 10%heat-inactivated fetal bovine serum (HyClone Lab, Logan,UT). Human recombinant (r) IFNy (lot NN9027AX, specific activity 2.02 X IO’ U/mg) was kindly provided by Dr H.M. Shepard (Genentech Labs, San Francisco, CA).Human rIL-4 wasobtained from PeproTech (Rocky Hill, NJ). Endotoxin levels were less than 12 pg/ mL in all reagentsand media used. Northern blot analysis. For RNA extraction, 5 X IO’ monocytes were plated in 25 mL medium alone or supplemented with the indicated cytokines. Cells werelysed in guanidinium isothiocyanate and total RNA was isolated by sedimentation through a CsCl gradient as described.” Twenty microgramsof total RNA were electrophoresed in denaturing conditions, blotted onto Nytran membranes (Schleicher & Schuell Inc, Keene, NH), and hybridized as described elsewhere.’’ For I D 0 detection, a Pst I fragment wasobtained by cDNA amplificationby polymerasechain reaction (PCR). Total RNA wasisolated fromhuman monocytes treated with IFNy by the guanidinium thiocyanate-cesium chloride technique.” The RNA was reverse transcribed and the resulting first-strand cDNA was amplified by PCR.” For this purpose, PCR primers 5‘ CCAGAGGAGCAGACTACAAG and 5‘ GTTGGGTTACATTAACCTTC were synthesized basedon the I D 0 cDNA sequence.2’The resulting PCR product was digested with Pst I. The fragment was ligated in the pBluescript vector and sequenced by the dideoxy chain termination method.” All filterswere subsequently rehybridized witha probe specific forG3PDH to ensure that equal amounts of RNA were loaded in each lane. G3PDH probe was purchased from Clontech(Palo Alto, CA). Assay of I D 0 activity. L-tryptophan and L-kynurenine were measured using high performance liquid chromatography (HPLC). Samples were preparedby mixing 100 pL ofhuman monocyte supernatants with 200pL of glacialacetic acid and 1.25 mL of acetonitrile. The samples were centrifuged at 15,OOOg for 10 minutes at room temperature. The deproteinated supernatants were dried ina speed vac centrifugeat 45’C, resuspended in 200 pL of water, and dried a second time to remove excessacetic acid. The samples were then resuspended in 200 pLof water and filtered. One-hundred microliters of prepared sample were injected into a 4.6 X 250-mm YMC18 ODs-AQ column (YMC, Moms Plains, NJ) and eluted with 100% buffer A ( 1 0 0 mmol/L H3W4)for 4 minutes followed by 8/ood,Vol83,No5(Marchl), 1994: 1408-1411

INHIBITION OF ID0 ACTIVITY BY IL-4

1409

B Fig 1. Northern blot analysis of the expression ofID0 mRNA in humanmonocytes. (A); Human monocytes were cultured for 18 hours with medium alone (lane 1) or supplemented with IFNy (500 U/mL) (lane 2).IL-4 (l00 U/mL) (lane 3) or IFNy plus IL-4 (lane 4). (B); Human mono18 cytes were cultured for hours with medium alone (lane l), IFNy 500 U/mL (lane 2). or IFNy (500 U/mL) plus IL-4 (500, 100, 2, 20, 0.2U/mL) (lanes 3 to 7). Total cellularRNA was examinedfor I D 0 mRNA(top panels) as described in Materials and Methods. Arrows indicate 28 (upper) and 18 (lower) ribosomal RNA. The same filter was subsequently rehybridized witha probe specificforG3PDH to ensure that equal amounts of RNA were loaded in each lane.

U

il) G3PDH

G3PDH

1

2

3

a linear gradient reaching 60% buffer B (70% Acetonitrile) in 41 minutes. The elution time of L-kynurenine was 16.0 minutes. of Ltryptophan was 23.7 minutes. Absorbance of L-kynurenine at 360 nm and of L-tryptophan at 265 nm was determined to measure the concentration. Samples were spiked with an internal standard of dexamethasone to normalize the levels of tryptophan metabolites. RESULTS

To evaluate the effects of IL-4 on the IFNy-induced expression of ID0 mRNA, monocytes were cultured for 18 hours with medium alone or supplemented with lFNy (500 U/mL), IL-4 (100 U/mL) or lFNy plus IL-4. Activation of monocytes to a cytotoxic stageand peak of gene expression was previously observed'*.*' at a concentration of 500 U/ mLof IFNy. As shown in Fig IA, ID0 mRNA was not constitutively expressed in untreated human monocytes butan approximately 2-kbID0 mRNA could be induced by treatment with IFNy. Minor high molecular-weight forms were also detected. It is likely that they represent precursors of ID0 mRNA because they vary according to the expression of the mature form. IL-4 did not induce I D 0 mRNA and inhibitedIFNy-induced ID0 mRNA. The inhibition of IFNy-induced ID0 mRNA in response to different dosesof IL-4 was determined in monocytes stimulated for18 hours with increasing concentrations of IL-4 (Fig 1 B). As little as 2 U/mL of IL-4 was sufficient to produce a threefold to fivefold decrease in IFN-induced I D 0 mRNA. Maximum decrease of about 20-fold was observed with 100 U/mL. Kinetic experimentsshowed that the induction of ID0 mRNA by IFNy was detectable within 3 hours and increased progressively until 18 hours aftertreatment. IL-4 inhibitedI D 0 mRNA at every time point (Fig2). indicating that the inhibitory effects observed could not be accounted by a shift in the kinetics of IDO-mRNA expression. The induction of ID0 mRNA by lFNy treatment of human monocytes was associated with increased ID0 activity as measured by a re-

QW V W 0W 0 1

4

2

3

4

5

6

7

duction in L-tryptophan and an increase in L-kynurenine concentration in the culture media (Table l ) . Among three independentexperiments.IFNyreducedL-Tryptophan concentration by 35.5% 2 15.6%. Treatment of monocytes with increasing concentration of IL-4 progressively inhibited IFNy-induced ID0 activity: in the presence ofIL-4 (100 U/mL) plus IFNy. the L-Tryptophan concentration was reduced only by 7.3% 2 4.1% (P< .05). Furthermore, IL-4reducedL-Kynurenineconcentrationinduced by IFNy from 3.3 ? 0.86 pmol/L to 0.76 2 0.5 pmol/L (P .05). DISCUSSION

We have shown

that IL-4 can inhibit the induction by

lFNy of ID0 mRNA and activity in human monocytes pro-

viding the first evidence of inhibitory signals controlling ID0 expression. The inhibitory effects of IL-4 were rather potent because low concentrations (as low as 2 U/mL) caused substantial inhibition of ID0 mRNA and activity. These results indicate the existence of a tight immunologic control of tryptophan metabolism by the immune system, because ID0 expression is under both positive(IFNy) and negative (IL-4) control by T-lymphocyte-derived lymphokines. The exact role of I D 0 induction by cytokines is not defined. However, the catabolism of tryptophan that follows ID0 activation can affect host reactivity at several levels. Tryptophan depletion afterI D 0 activation could cause cell growth inhibition and be responsible for some ofthe antiproliferative effects of IFNy..' Furthermore, tryptophan depletion may inhibit the growth of intracellular parasite^.^.' In addition, IDO. by initiating tryptophan catabolism,will promote the generation of biologicallyactive metabolitesof tryptophan. Forexample,3-hydroxy-anthranilic acidis toxic to most cells and could enhance monocyte cytotoxic

1410

MUSS0 ET

1 hr

3 hr

6 hr

18 hr

G3PDH

6

8

9

10 11 12

potential24; 3-hydroxyanthranilic-acid and hydroxy-kynurenine are powerful antioxidant^^^; picolinic acid, an end product of tryptophan metabolism, synergizes with IFNy in inducing tumoricidal activity in murine macrophages.26 ID0 may have important effects within the central nervous system because key metabolites in the kynurenine pathway are neuroactive. Immunostimulation causes increases in I D 0 activity and quinolinic acid levels in brain and cerebrospinal fluid in rodents and primate experimental models.27Furthermore, increased levels of quinolinic acid were found in the cerebrospinal fluid of patients infected with human immunodeficiency virus, particularly in patients with neurologic deficits and theacquired immune deficiency syndrome (AIDS) dementia complex.28 Tryptophan catabolites can be shown in vivo under pathologic conditions, in response to cytokine administration and inflammatory stimuli in human and inexperimental murine ~ y s t e m s . Decreased ~ ~ - ~ ~ levels of circulating tryptophan attributed to increased tryptophan degradation were reported in patients with tumors29 and in AIDS patients." Collectively these observations indicate that tryptophan cataboTable 1. Degradation of Tryptophan in Human Monocytes L-Tryptophan

L-Kynurenine

Monocytes Cultivated With

(rmol/L)

(mollL)

Medium 11-4 100 U/mL IFNy 500 U/mL 4.6 IFNy 500 U/mL IL-4 1.2 100 U/mL 1.22 0 U/mL IFNy 500 U/mL IL-4 IFNy 500 U/mL 11-4 2.32 U/mL 0 . 2 U/mL IFN 500 U/mL 11-44.1

20.0 19.2 12.7 18.3 18.6 16.3 12.9

+

+ + +

50.5 ~0.6

Monocytes were incubated in the presenceof the indicated stimuli for the CUI18 hours. The concentrationof L-tryptophan and L-kynurenine in ture medium were determined by HPLC as described in Materials and Methods. Replicate runsof the same sample indicateless than 0.5% variation.

Fig 2 . Northern analysis of ID0 mRNA in human monocytes cultured with mediumalone (lanes 1,4. 7,101. IFNr (500 U/mL) (lanes 2 , 5 , 8 , 1 1 ) , or IFNr ( 5 0 0 U/mL) plus IL-4(1 00 U/mL) (lanes 3 , 6 , 9 , 1 2 ) for the length of time specified in the figure. Total cellular RNA was examined for IDO-mRNA (top panel) expression as described inMaterialsand Methods. The same filter was subsequently rehybridized with a probe specific for G3PDH toensure that equal amountsof RNAwereloaded.

lites are important BRMs and that I D 0 induction by cytokines leads to increased levels of tryptophan catabolites in various tissues including the central nervous system. We can speculate that prolonged or deregulated expression of I D 0 may be detrimental for the organism because of the toxic effects exerted by some catabolites of tryptophan. Our results indicate that IL-4 inhibits I D 0 induction by IFNy and could be important to limit the generation of tryptophan catabolites with toxic potential. Furthermore, IL-4 can inhibitthe macrophage activating properties of picolinic acid, indicating that 1L-4 antagonizes the effects of tryptophan not only by affecting production of catabolites but also by limiting their function.'^^ IL-4 can inhibit the respiratory burst dependent-antimicrobial activity induced by IFNy as shown for antileishmanial activity in monocytes.I2 Inhibition of I D 0 by IL-4 could also prevent the antimicrobial activity of IFNy-treated human monocytes that is mediated by tryptophandepleti0n.4.~Thus, IL-4 could exert inhibitory effects on IFNy-induced antimicrobial activity at different levels. IL-4 can inhibit the production of several cytokines and the expression of functional activities by leukocytes. There is growing evidence that IL-4 and IFNy exert reciprocal functions and that IL-4 can decrease many of the effects of IFNy on bothB cells and macrophages. In B cells, IL-4and IFNy induce different classes of Igs and they reciprocally inhibit switch-promoting functions. In fact, IFNy induction of IgG2a secretion is inhibited by IL-4,33and IL-4 induction ~ ~monocytes/macof IgG 1 and IgE is inhibited by I F N Y . In rophages there is a potent antagonistic effect of IL-4 on IFNy-induced responses: 1L-4 inhibits the level of RNA of IFNy or LPS-induced IL-I, TNF, IL-6, and Fcy receptor mRNA.9q'0.35 The inhibitory effects ofIL-4 on I D 0 expression indicate that the anti-inflammatory properties of this lymphokine also involve control of biologically active molecules such as tryptophan catabolites, not usually considered as mediatorsof the immunesystem.

INHIBITION

OF ID0 ACTIVITY

BY IL-4

ACKNOWLEDGMENT

We thank DrJ. Ortaldo for kindly reviewing the manuscript. REFERENCES

I. Shimizu T, Nomiyama S, Hirata F, Hayashi 0 Indoleamine 2,3-dioxygenase. Purification and some properties. J Biol Chem 253:4700,1978 2. Hayaishi 0, Ryotaro Y, Takikawa 0, Yasui H: Indoleminedioxyenase. A possible biological function, in Schlossberger HG (ed): Progress in Tryptophan andSerotonin Research. Berlin, Germany, de Gruyter, 1984, p 33 3. Carlin JM, Ozaki Y, Byrne GI, Brown RR, Borden E C Interferons and indoleamine 2,3-dioxygenase: Role in antimicrobial and antitumor effects. Experientia 45535, 1989 4. Carlin JM, Borden EC, Byrne GI: Interferon-induced indoleamine 2,3-dioxygenase activity inhibits Chlamydia psiftaci replication in human macrophages. J Interferon Res 9:329, 1989 5 . Pfefferkorn E R Interferon gamma blocks the growth of Toxoplasma gondii in human fibroblasts by inducing the host cells to degrade tryptophan. Proc Natl Acad Sci USA8 I :908,1984 6. Ozaki Y, Edelstein MP, Duch D S The actions of interferon of indoleamine 2,3-dioxand antiinflammatory agents of induction ygenase in human peripheral blood monocytes. Biochem Biophys ResCommun 144:1147, 1987 7. Cox GW, Chattopadhyay U, Oppenheim JJ, Varesio L: IL-4 inhibits the costimulatoryactivity of IL-2 or picolinic acid but not of lipopolysaccharide on IFN-y-treated macrophages. J Immunol 147:3809, 1991 8. Melillo G, Cox GW, Radzioch D, Varesio L: Picolinic acid, a catabolite of L-tryptophan, is a costimulus for the induction of reactive nitrogen intermediate production in murine macrophages. J lmmunol 150:1, 1993 9. Donnelly RP, Fenton MJ, Finbloom DS, Gerrard T L Differential regulation of IL-I production in human monocytes by IFNy and IL-4. J Immunol 145:569, 1990 IO. te Velde AA, Huijbens RJ, Heije K, de Vries JE, Figdor CC: Interleukin-4 (IL-4) inhibits secretion of IL-1 0,TNF a,and IL-6 by human monocytes. Blood 76: 1392, 1990 1 I . Cheung DL, Hart PH, Vitti GF, Whitty CA, Hamilton TA: Contrasting effects of interferon-gamma and interleukin-4 on the interleukin-6 activity of stimulated human monocytes. Immunology 7 1:70, 1990 12. Lehn M, Weiser WY, Engelhorn S, Gillis S, Remold HG: IL4 inhibits H202production and antileishmanial capacity of human culturedmonocytes mediated by IFN-gamma. J Immunol 143: 3020, 1989 13. Stuart PM, Zlotnik A, Woodward JG: Induction of class I and class I1 MHC antigen expression on murine bone marrow-derived macrophages by IL-4(B cell stimulatory factor l). J Immunol 140:1542, 1988 14. te Velde AA, Klomp JPG,Yard BA, de Vries JE, Figdor CC: Modulation of phenotypicand functional properties of human peripheral blood monocytes by IL-4. J Immunol 140:1548, 1988 15. Vercelli D, Jabara HH, LeeBW, Woodland N, Geha RS, Leung DYM: Human recombinant interleukin 4 induces FcR2/ CD23 on normal human monocytes. J Exp Med 167:1406,1988 16. Weiser M, Bonifer R, Oster W, Lindemann A, Mertelsmann R, Henman F Interleukin-4 induces secretion of CSF for granulocytes and CSF for macrophages by peripheral blood monocytes. Blood 73:1105, 1989

141 1 17. Littman BH, Davstan FF, Carlson PL, Sanders KM: Regulation of monocyte/macrophage C2 production and HLA-DR expression by IL-4 (BSF-I) and IFN gamma. J Immunol 142520, 1989 18. Musso T, Espinoza-Delgado I, Pulkki K, Gusella CL, Longo DL, Varesio L: Transforming growth factor 0 downregulates interleukin-l (IL- l)-induced IL-6 production by human monocytes. Blood 76:2466, I990 19. Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ: Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 185294, 1979 20. Gubler U, Hoffman BJ: A simple and very efficient method for generating cDNA libraries. Gene 25:263, 1983 2 I . Dai W, Gupta SL: Molecular cloning, sequencing and expression of human interferon-y-inducible indoleamine 2,3-dioxigenase cDNA. Biochem Biophys Res Commun 168: I , 1990 22. Sanger F, Nicklen S, Coulson AR: DNA-sequencing with chain-terminatinginhibitors. Proc Natl Acad SciUSA 745463, 1977 23. Espinoza-Delgado I, Longo DL, Gusella CL, Varesio L IL2 enhances c-fms expression in human monocytes. J Immunol 145: 1137, 1990 24. Werner ER, Bitterlich G, Fuchs D, HausenA, Reibnegger G, Szabo G, Dierich MP, Wachter H: Human macrophages degrade tryptophan upon induction by interferon-y. Life Sci41:273, 1987 25. Christen S, Peterhans E, Stocker R: Antioxidant activities of some tryptophan metabolites: Possible implication for inflammatory diseases. Proc Natl Acad Sci USA 87:2506, 1990 26. Varesio L, Clayton M, Blasi E, Ruffmann R, Radzioch D: Picolinic acid, a catabolite oftryptophan, as the second signal in the activation of IFN-y-primed macrophages. J Immunol 145:4265, I990 27. Schwarcs R, Whetsell WO, Mangano RM: Quinolinic acid asaneurotoxin,Science219:316,1983 28. Fuchs D, Forsman A, Hagberg L, Larsson M, Norkrans G, Reibnegger G, Werner ER, WachterH: Immune activation and decreased tryptophan in patients with HIV-1 infection. J Interferon Res 10399, 1990 29. Yasui H, Takai K, Yoshida R, Hayaishi 0: Interferon enhances tryptophan metabolism by inducingpulmonary indoleamine 2,3-dioxygenase: Its possible occurrence in cancer patients. Proc Natl Acad Sci USA 83:6622, 1986 30. Yoshida R, Hayaishi 0: Induction of pulmonary indoleamine 2,3-dioxygenase by intraperitoneal injection of bacterial lipopolysaccharide. Proc Natl Acad Sci USA75:3998,1978 3 l. Yoshida R, Urade Y, Tokuda M, Hayaishi 0 . Induction of indoleamine 2,3-dioxygenase in mouse lung during virus infection. Proc Natl Acad Sci USA 76:4084, 1979 32. Byrne GI, Lehmann LK, Kirschbaum JG, Borden EC, Lee CM, Brown RR: Induction of tryptophan degradation in vitro and in vivo: A gamma-interferon-stimulated activity. J Interferon Res 6:389, 1986 33. Snapper CM, Paul WE: Interferon7 and B cell stimulatory factor- 1 reciprocally regulate Ig isotype production. Science 236: 944,1987 34. Thyphronitis G, Tsokos GC, June CH, Levine AD, Finkelman FD: IgE secretion by Epstein-Barr virus-infected purified human B lymphocytes is stimulated by IL-4 and suppressed by interferony. Proc Natl Acad Sci USA 865580, 1989 35. te Velde AA, Huijbens RJ, de Vries JE, Figdor CC: IL-4 decreases FcyR membrane expression and FcyR-mediated cytotoxic activity ofhuman monocytes. J Immunol 144:3046, 1990