Involvement of a guanine nucleotide-exchange protein, ARF-GEP100 ...

Involvement of a guanine nucleotide-exchange protein, ARF-GEP100/BRAG2a, in the apoptotic cell death of monocytic phagocytes Akimasa Someya,*,1 Joel Moss,† and Isao Nagaoka* *Department of Host Defense and Biochemical Research, Juntendo University School of Medicine, Tokyo, Japan; and †Pulmonary-Critical Care Medicine Branch, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, Maryland

Abstract: We previous identified adenosine 5ⴕdiphosphate-ribosylation factor (ARF)-guanine nucleotide-exchange protein, 100 kDa (GEP100), as a novel GEP with a molecular size of ⬃100 kDa, which preferentially activates ARF6. In this study, we examined the effect of ARF-GEP100 on monocytic cell apoptosis. Overexpression of ARF-GEP100 in PMA-differentiated human monocyte-macrophage-like U937 cells and mouse macrophage RAW264.7 cells induced apoptotic cell death, which was detected by morphological changes (chromatin condensation, nucleus fragmentation, and shrinking of cytoplasm), annexin V-staining, and TUNEL assay. It is interesting that a mutant lacking the Sec7 domain, which is responsible for ARF activation, was able to induce apoptosis of the target cells to the level of that of a wild-type ARF-GEP100. Furthermore, ARF-GEP100-silencing experiments indicated that the TNF-␣-induced apoptosis was significantly suppressed among ARF-GEP100-depressed cells. These observations apparently suggest that ARF-GEP100 is involved in the induction of apoptosis in monocytic phagocytes, possibly independent of ARF activation. J. Leukoc. Biol. 80: 915–921; 2006. Key Words: apoptosis 䡠 GEF 䡠 Sec7 domain 䡠 macrophages 䡠 siRNA

INTRODUCTION Guanine nucleotide-exchange proteins (GEPs) activate guanosine 5⬘-triphosphate (GTP)-binding proteins by accelerating the replacement of bound guanosine 5⬘-diphosphate (GDP) by GTP. Previously, we found a novel, 100-kDa GEP [adenosine 5⬘-diphosphate-ribosylation factor (ARF)-GEP100] as an ARF, which belongs to a family of 20 kDa GTP-binding proteins (small G-proteins) [1]. ARF-GEPs are responsible for ARF activation and are divided into three groups based on their structural and functional properties. Those of ⬎100 kDa molecular size include brefeldin A (BFA)-inhibitable GEP (BIG) 1 and BIG 2 [2, 3] and Golgi-specific BFA-resistance factor 1 [4]. The cytohesin family with smaller sizes (⬃50 kDa) is comprised of cytohesin 1, cytohesin 2/ARF nucleotide0741-5400/06/0080-915 © Society for Leukocyte Biology

binding site opener, cytohesin 3, and cytohesin 4 [5–9]. The third group includes the medium-sized (50 –100 kDa) and BFA-insensitive GEPs; ARF-GEP100 [1] and exchange factor for ARF6 [10]. All ARF-GEPs contain an ⬃200 amino acid Sec7 domain, which is responsible for the acceleration of GDP release and GTP binding to ARFs [11, 12]. On phylogenetic analysis, ARF-GEP100 belongs to a subfamily referred to as the brefeldin-resistant Arf-GEFs (BRAGs), and ARF-GEP100 is also called BRAG2a [13, 14]. ARF-GEP100/BRAG2a (hereafter termed GEP100) contains, in addition to the central Sec7 domain, an IQ-like motif near the N terminus and a pleckstrin homology (PH) domain near the C terminus. IQ motif participates in calmodulin binding [15], whereas PH domain interacts specifically with phosphoinositides [16]. ARFs activated by ARF-GEPs participate in the regulation of intracellular trafficking events and actin cytoskeletal dynamics [11, 17–22]. In mammalian cells, ARFs are grouped into three classes based on their sizes, amino acid sequence identities, and gene structures: Class I (ARFs 1–3), II (ARFs 4 and 5), and III (ARF 6) [20]. Most ARF-GEPs act on Class I ARFs; however, GEP100 preferentially activates Class III ARF (ARF6) [1], which has been shown to be involved in a variety of biological events, including migration [23], phagocytosis [24 –26], and superoxide production [27]. Previously, we revealed that GEP100 mRNA was widely distributed but the most abundant in peripheral blood leukocytes in human tissues and cells by Northern blot analysis [1]. Here, we report that overexpression of GEP100 induced apoptotic cell death of PMA-differentiated human monocytemacrophage-like U937 cells and mouse macrophage RAW264.7 cells. Furthermore, mutant analysis indicated that the N- and C-terminal regions but not the Sec7 domain of the GEP100 molecule are essential for the induction of apoptosis. In addition, the apoptosis of GEP100-knockdown cells induced by TNF-␣-induced apoptosis was suppressed. Thus, ARFGEP100 is likely to be involved in the induction of apoptosis.

1

Correspondence: Department of Host Defense and Biochemical Research, Juntendo University School of Medicine, 2-1-1 Hongo, Bunkyo-ku, Tokyo 113-8421, Japan. E-mail: [email protected] Received January 26, 2006; revised June 9, 2006; accepted June 10, 2006; doi: 10.1189/jlb.0106059.

Journal of Leukocyte Biology Volume 80, October 2006 915

MATERIALS AND METHODS Reagents Ex Taq DNA polymerase was purchased from Takara Bio Inc. (Shiga, Japan). Restriction enzymes were obtained from Toyobo (Osaka, Japan). An anti-GFP mAb (JL-8) was purchased from BD Biosciences Clontech (Palo Alto, CA); anti-myc and anti-FLAG mAb from Invitrogen (Carlsbad, CA) and Sigma Chemical Co. (St. Louis, MO), respectively; anti-GAPDH mAb from Chemicon International Inc. (Temecula, CA); and Alexa Fluor 594-conjugated goat anti-rabbit IgG (H⫹L) and Alexa Fluor 488-conjugated goat anti-mouse IgG (H⫹L) from Molecular Probes (Eugene, OR). Recombinant human TNF-␣ was purchased from Genzyme (Boston, MA). Goat whole serum was from ImmunoBiological Laboratories Co., Ltd. (Takasaki, Japan). All other reagents were obtained from Sigma Chemical Co. unless otherwise specified.

Cell line and culture Human monocyte macrophage cell line U937 and murine macrophage cell line RAW264.7 were obtained from American Type Culture Collection (Manassas, VA). Cells were grown at 37°C in 5% CO2 atmosphere in RPMI-1640 medium (Nissui Pharmaceutical, Tokyo, Japan) containing 10% FCS (Sanko Junyaku, Tokyo, Japan), penicillin (100 U/ml), and streptomycin (0.1 mg/ml).

Preparation of anti-GEP100 antibody Antiserum against GEP100 was raised in rabbits by injection of keyhole limpet hemocyanin-conjugated, synthetic peptide (AHKEDKADTDTSCR), corresponding to the amino acids 225–238 of GEP100. Antibody was affinity-purified using the immunizing peptide conjugated to epoxy-activated Sepharose 6B (Amersham Biosciences, Piscataway, NJ), according to the manufacturer’s instructions.

Overexpression of GEP100 and its mutant proteins

Plasmid construction of GEP100-expression vectors A cDNA for GEP100 was amplified by PCR using S1 and AS841 primers (Table 1) and pAcHLT-C/ARF-GEP100 [1] as a template. The resulting PCR product was subcloned into pCR-Blunt II-TOPO vector (Invitrogen). The

TABLE 1.

Sense primers

Antisense primers

plasmid was digested with EcoRI and KpnI, and the cDNA fragment was ligated with pEGFP-N1 vector (BD Biosciences Clontech) or pFLAG-CMV-5b (Sigma Chemical Co.) for expression of GFP-tagged or FLAG-tagged GEP100, respectively. GEP100 cDNA/pCR-Blunt II-TOPO vector was also digested with EcoRI and NotI, and the cDNA fragment was ligated with pcDNA3.1(–) myc/His-c (Invitrogen) for expression of myc/His-tagged GEP100. To express the GEP100 mutants with deleted regions (see Fig. 3) or the specific regions of GEP100 (see Fig. 4), cDNAs were generated by PCR using various primers listed in Table 1. cDNAs for N-terminal fragments, GEP100⌬743– 841, GEP100:1–27, GEP100:1–139, GEP100:1–278, and GEP100: 1–398, were amplified using S1 and AS742 primers, S1 and AS27 primers, S1 and AS139 primers, S1 and AS278 primers, and S1 and AS398 primers, respectively. cDNAs for C-terminal fragments GEP100⌬IQ, GEP100⌬1–398, and GEP100:743– 841 were amplified using S30 and AS841 primers, S399 and AS841 primers, and S743 and AS841 primers, respectively. cDNAs for internal deletion mutants (GEP100⌬Sec7, GEP100⌬591– 630, GEP100⌬PH, GEP100:1–27/743– 841, GEP100:1–139/743– 841, GEP100:1– 278/743– 841, and GEP100:1–398/743– 841) were generated by a two-step PCR amplification. Combinations of primers for generating each mutant are given in Table 2. Namely, for cDNA of GEP100⌬Sec7, cDNAs corresponding to the amino acids 1–398 and 591– 841 of GEP100 were amplified using S1 and AS⌬Sec7 primers and S⌬Sec7 and AS841 primers, respectively, by first-step PCR. Then, two cDNA fragments were mixed and amplified with S1 and AS841 primers to obtain cDNA, corresponding to the amino acids 1–398 plus 591– 841 by second-step PCR. The resulting PCR products were subcloned into pCR-Blunt II-TOPO vector, and EcoRI- and KpnI-digested cDNA fragments were ligated with pEGFP-N1 vector. cDNAs subcloned into pCR-Blunt II-TOPO vector (GEP100:1–139, GEP100: 1–278, GEP100:743– 841, GEP100:1–139/743– 841 and GEP100:1–278/743– 841) were also digested with EcoRI and NotI, and the cDNA fragments were ligated with pcDNA3.1(–) myc/His-c.

U937 cells (2.5⫻105 cells/0.5 ml, 40 – 60% confluent) in RPMI-1640 medium containing FCS, penicillin, and streptomycin were cultured on a 12-mm round glass slip (Fisher, Pittsburgh, PA) in the presence of 10 nM PMA for 2 days to promote differentiation to monocyte-macrophage-like cells [28] in a 24-well plate. RAW264.7 cells (1⫻105 cells in 0.5 ml, 40 – 80% confluent) were also

List of PCR Primers Used

Name

Sequence

S1 S 30 S 399 S ⌬Sec7 S ⌬591-630 S ⌬PH S 743 S 1-27/743-841 S 1-139/743-841 S 1-278/743-841 S 1-398/743-841 AS 841 AS 742 AS ⌬Sec7 AS ⌬591-630 AS ⌬PH AS 27 AS 139 AS 278 AS 398 AS 1-27/743-841 AS 1-139/743-841 AS 1-278/743-841 AS 1-398/743-841

5⬘-tggaattcaccatgctagaacgaa-3⬘ 5⬘-tgaattcaccatgaacaagaacttc-3⬘ 5⬘-tgaattcaccatggatgtcatccgc-3⬘ 5⬘-gcctgcctttagcaacaagaccaatgaggacc-3⬘ 5⬘-gcgagagctattggtctgct-3⬘ 5⬘-tctgccccaccgtcggcaagagatggagaagc-3⬘ 5⬘-tggaattcaccatgcaagagatggagaag-3⬘ 5⬘-tttcgccagtaccagcaagagatggagaag-3⬘ 5⬘-gccctcaactgccgccaagagatggagaag-3⬘ 5⬘-tcggagcgggggtcacaagagatggagaag-3⬘ 5⬘-cctgcctttagcaaccaagagctggagaag 5⬘-tggtaccgcggccgcggagcacagcact-3⬘ 5⬘-tggtaccgcggccgcgacttccgcaatgga-3⬘ 5⬘-ggtcctcattggtcttgttgttaaaggcaggc-3⬘ 5⬘-agcagaccaa tagctctcgc-3⬘ 5⬘-gcttctccatctcttgccgacggtggggcaga-3⬘ 5⬘-tggtaccgcggccgcctggtactggcgaaa-3⬘ 5⬘-tggtaccgcggccgcgcggcagttgagggc-3⬘ 5⬘-tggtaccgcggccgctgacccccgctccga-3⬘ 5⬘-tggtaccgcggccgcgttgctaaaggcagg-3⬘ 5⬘-cttctccatctcttgctggtactggcgaaa-3⬘ 5⬘-cttctccatctcttggcggcagttgagggc-3⬘ 5⬘-cttctccatctcttgtgacccccgctccga-3⬘ 5⬘-cttctccatctcttggttgctaaaggcagg-3⬘

In sense primers and antisense primers, EcoRI and KpnI/NotI restriction-site sequences are underlined, respectively. Initiation codons are in bold type.

916

Journal of Leukocyte Biology Volume 80, October 2006

http://www.jleukbio.org

TABLE 2.

Combinations of Primers Used to Generate the ARF-GEP100 Mutants by a Two-Step PCR Primer combination First PCR

Constructs

N-terminal fragment

C-terminal fragment

Second PCR

GEP100⌬Sec7 GEP100⌬591–630 GEP100⌬PH GEP100:1–27/743–841 GEP100:1–139/743–841 GEP100:1–278/743–841 GEP100:1–398/743–841

S1/AS ⌬Sec7 S1/AS⌬591-630 S1/AS⌬PH S1/AS1-27/743-841 S1/AS1-139/743-841 S1/AS1-278/743-841 S1/AS1-398/743-841

S ⌬Sec7/AS 841 S⌬591-630/AS841 S⌬PH/AS841 S1–27/743–841/AS841 S1–139/743–841/AS841 S1–278/743–841/AS841 S1–398/743–841/AS841

S1/AS841 S1/AS841 S1/AS841 S1/AS841 S1/AS841 S1/AS841 S1/AS841

cultured on a 12-mm round glass slip in a 24-well plate in the same medium. Cells were transfected by incubation with appropriate plasmid (0.6 ␮g) for 3 h using SuperFect transfection reagent (4 ␮l per 0.6 ␮g plasmid, Qiagen, Valencia, CA) in a total volume of 0.5 ml in a serum-free medium, followed by changing the medium with 10% FCS and further incubated for 11 h. In preliminary experiments, we found that 24 h after transfection, almost-GEP100overexpressed cells were detached from the glass slips, whereas cells adhered to the glass but became apoptotic 11 h after transfection. Therefore, apoptotic changes were evaluated 11 h after transfection unless otherwise noted. Under these conditions, 2– 4% PMA-differentiated U937 cells and 3–7% RAW 264.7 cells were transfected, based on the expression of GFP.

Evaluation of apoptosis PMA-differentiated U937 cells or RAW264.7 cells transfected with GFPGEP100 expression vectors were stained with Hoechst 33342 (2 ␮g/ml) and annexin V-Alexa 568 (Roche Diagnostics, Mannhein, Germany) for 15 min at room temperature in 10 mM HEPES (pH 7.4) containing 150 mM NaCl and 5 mM CaCl2. The cells were washed with PBS (137 mM NaCl, 2.7 mM KCl, 8.1 mM Na2HPO4, 1.5 mM KH2PO4, pH 7.4) containing 1 mM CaCl2, fixed with 4% paraformaldehyde in PBS for 20 min, washed with PBS, and mounted with FluoroGuard antifade reagent (Bio-Rad Laboratories, Hercules, CA). For cells expressing myc/His-GEP100 or FLAG-tagged GEP100, cells were fixed with 4% paraformaldehyde in PBS. Fixed cells were permeabilized with 0.05% Triton X-100 in PBS for 2 min at room temperature, washed with PBS, and blocked with blocking buffer (PBS containing 3% BSA and 1% goat whole serum). After washing with PBS, cells were incubated with anti-myc mAb (1/500 dilution) or anti-FLAG mAb (10 ␮g/ml) overnight at 4°C in tenfolddiluted blocking buffer. After washing with PBS, cells were incubated for 1 h with Alexa Fluor 488-conjugated goat anti-mouse IgG (H⫹L; 4 ␮g/ml) containing Hoechst 33342 (2 ␮g/ml), washed with PBS, and mounted with FluoroGuard antifade reagent. The stained cells were inspected with a Zeiss Axioplan 2 immunofluorescence microscope (Carl Zeiss, Inc., Oberkochen, Germany) for determination of apoptosis. Exogenously expressed GEP100 proteins were detected by green signals (GFP or Alexa Fluor 488). Apoptotic cells were characterized with condensed and fragmented nuclei detected by Hoechst 33342 staining and a shrinking of cytoplasm observed by the differential interference contrast (DIC) image. Apoptotic cells are presented as percentage of ⬎100 GFP- or Alexa Fluor 488-positive, transfected cells. Apoptosis of GFP-GEP100-transfected cells was also evaluated by TUNEL assay using an in situ cell death detection kit, TMR Red (Roche Diagnostics). TUNEL-positive apoptotic cells are presented as percentage of ⬎100 GFPpositive cells.

Western blot analyses For the detection of exogenously expressed GEP100 or its mutants, transfected cells were suspended in SDS-PAGE sample buffer (62.5 mM Tris-HCl, pH 6.8, 2% SDS, 10% glycerol, 0.005% bromophenol blue, and 5% 2-ME) and disrupted by sonication on ice. After heat treatment for 3 min at 100°C, cell lysates (20 ␮l; containing 3⫻105 cell equivalents) were subjected to SDSPAGE in 8 –12% or 11% gels, and separated proteins were electroblotted onto polyvinylidene fluoride (PVDF) membranes (Immobilon-P, Millipore, Bedford,

MA). Blots were blocked with BlockAce (Dainippon Pharmaceutical Co. Ltd., Osaka, Japan) for 1 h at room temperature and probed overnight with anti-GFP or anti-myc mAb (1 ␮g/ml or 0.5 ␮g/ml, respectively) at 4°C. The blots were further probed with HRP-conjugated goat anti-mouse IgG (1:5000 dilution, Chemicon International), and GFP- or myc/His-tagged proteins were finally detected by SuperSignal chemiluminescent substrate (Pierce, Rockford, IL). For detection of endogenous GEP100, cell lysates (20 ␮l; containing 7⫻104 cell equivalents) were subjected to SDS-PAGE in 9% gels and blotted on PVDF membranes. After blocking, endogenous GEP100 was detected using rabbit polyclonal anti-GEP100 antibody (0.2 ␮g/ml) and HRP-conjugated goat anti-rabbit IgG (1:5000 dilution, Chemicon International). For detection of GAPDH, the antibodies were stripped by incubating the blots with Restore Western blot stripping buffer (Pierce) at 50°C for 30 min, and then GAPDH was detected using anti-GAPDH mAb (20 ng/ml) and HRP-conjugated goat anti-mouse IgG (1:5000 dilution).

Silencing of GEP100 expression by small interfering RNA (siRNA) To examine the role of endogenous GEP100 in apoptosis, we attempted to knock down the GEP100 by using siRNA. The GEP100 siRNA duplexes corresponding to the sequences 5⬘-AGAACUCGGUGACGUACAG-3⬘ [14] (Duplex-1), 5⬘GAGCAGAUAUCAAAGUGUU-3⬘ (Duplex-2, determined by using siDirectTM siRNA design system, GeneExpression Systems, Inc., Waltham, MA), and control duplex 5⬘-UCGACUGUGGAUUGGCAUU-3⬘ [14] (Control duplex) were chemically synthesized by RNAi Co., Ltd. (Tokyo, Japan). U937 cells (7⫻104 cells) were transfected with siRNA duplexes using Hiperfect transfection reagent (3.5 ␮l per 18 pmole RNA duplex, Qiagen) in a total volume of 0.1 ml in RPMI-1640 medium containing FCS, penicillin, and streptomycin. After 6 h, 0.2 ml RPMI-1640 medium containing PMA (final concentration of 10 nM) was added and further incubated for 24 h in a 16-well Lab-Tek chamber slide system (Nunc, Rochester, NY). After the treatment with 100 ng/ml TNF-␣ for 6 h at 37°C, the cells were fixed and stained with Hoechst 33342. The slides were inspected using an immunofluorescence microscope, and cells with apoptotic features were presented as percentage of ⬎200 counted cells. To further evaluate the role of endogenous GEP100 in apoptosis, we attempted to knock down the GEP100 by stably expressing a GEP100-targeting short hairpin RNA (shRNA). Target sequence was chosen by using short interfering RNA finder systems on Ambion (Austin, TX) and Takara Bio Inc. websites. Two double-stranded oligonucleotides were generated by annealing 5⬘-gatccgaagaactcggtgacgtacgaagcttggtacgtcaccgagttcttcttttttggaagc-3⬘ and 5⬘ggccgcttccaaaaaagaagaactcggtgacgtaccaagcttcgtacgtcaccgagttcttcg-3⬘ (for shRNA-1) or 5⬘-gatccgaagaactcggtgacgtacgaagcttggtacgtcaccgagttcttcttttttggaagc-3⬘ and 5⬘-ggccgcttccaaaaaagaagaactcggtgacgtaccaagcttcgtacgtcaccgagttcttcg-3⬘ (for shRNA-2) and inserted into BamHI and NotI-digested pGSH1-GFP shRNA vector (Gene Therapy Systems, Inc., San Diego, CA). Underlined sequences represent the region forming a hairpin loop structure. For the expression of scrambled shRNA sequence as controls, double-stranded oligonucleotides were generated by annealing 5⬘-gatccggcaagaccttgatgacaagaagcttgtgttgtcatcaaggtcttgccttttttggaagc-3⬘ and 5⬘-ggccgcttccaaaaaaggcaagaccttgatgacaacaagcttcttgtcatcaaggtcttgccg-3⬘ (for Scrambled shRNA-1) or 5⬘-gatccgcgtaagagctgcaacgtaggaagcttgctacgttgcagctcttacgttttttgga-

Someya et al. ARF-GEP100-mediated monocytic cell apoptosis

917

agc-3⬘ and 5⬘-ggccgcttccaaaaaacgtaagagctgcaacgtagcaagcttcctacgttgcagctcttacgcg-3⬘ (for Scrambled shRNA-2) and inserted into BamHI and NotI-digested pGSH1-GFP shRNA vector. U937 cells were transfected with 4 ␮g each vector in 300 ␮l serum-free RPMI-1640 medium by electroporation at 960 ␮F and 300 V using a Gene Pulser apparatus (Bio-Rad Laboratories). The cells were cultured in RPMI-1640 medium containing 1 mg/ml G418. After a 4- to 5-week selection with G418, the viable cells were diluted and cultured in a 24-well culture plate (ca. 500 cells/well) in RPMI-1640 medium containing 1 mg/ml G418. To obtain the GEP100-suppressed cell population, G418 selection was repeated, and the suppression of endogenous GEP100 expression was confirmed by Western blot analysis, as described below. GEP100-suppressed cell populations (shRNA-1 and -2) and control cell populations (Scrambled shRNA-1 and -2) were treated with 10 nM PMA for 24 h. The cells were incubated further with 100 ng/ml TNF-␣ for 6 h at 37°C, fixed with 4% paraformaldehyde, and stained with Hoechst 33342. The slides were inspected using an immunofluorescence microscope. Cells with apoptotic features are presented as percentage of ⬎200 counted cells.

Statistical analysis Statistical significance was determined by one-way ANOVA. A P value of ⬍0.05 was considered to be significant.

RESULTS Induction of apoptosis by overexpressing GEP100 To examine the involvement of GEP100 in the apoptosis of monocytic phagocytes, we exogenously expressed GEP100 in PMA-differentiated U937 cells and RAW 264.7 cells. Expression of GFP-GEP100 in PMA-differentiated U937 cells (Fig. 1A, GEP100) or RAW 264.7 cells (Fig. 1B, GEP100) resulted in the cell-surface binding of annexin V and chromatin condensation (Hoechst 33342 staining) detected by fluorescence images. Shrinking of cytoplasm was also observed in GFPGEP100-transfected apoptotic cells by differential interference contrast images. Conversely, expression of GFP alone did not induce apoptosis (Fig. 1, A and B, Control). Thus, the expres-

A

sion of GFP-GEP100 but not GFP induced characteristic futures of apoptosis. Approximately 60% of PMA-differentiated U937 cells and 40% of RAW264.7 cells exhibited apoptotic changes among GEP100-transfected, GFP-positive cells (Fig. 2, A and B), whereas less than 10% of GFP-expressing control cells were apoptotic. Furthermore, apoptosis was confirmed by TUNEL assay using PMA-differentiated U937 cells (GFPexpressing control cells, 3.3⫾0.7%, and GFP-GEP100-expressing cells, 42.3⫾8.9%; mean⫾SE, n⫽4) and RAW 264.7 cells (GFP-expressing control cells, 2.3⫾0.6%, and GFPGEP100-expressing cells, 31.5⫾8.2%; mean⫾SE, n⫽4). Expression of myc/His-tagged GEP100 and FLAG-tagged GEP100 similarly induced apoptosis as observed with GFP-GEP100 (data not shown). Thus, overexpression of GEP100, but not tags (GFP, myc/His, and FLAG), induced apoptotic cell death.

Apoptosis-inducing region(s) of GEP100 To identify the apoptosis-inducing region(s) in the GEP100 molecule, we constructed the series of plasmids expressing deletion mutants of GEP100. As shown in Figure 3A, all the deletion mutant proteins were detected in the predicted molecular sizes, and the expression levels of these proteins were essentially similar. The N-terminal deletion mutants (GEP100⌬IQ and GEP100⌬1-398) and C-terminal deletion mutant (GEP100⌬743-841) exhibited only 20 –30% of the apoptosis-inducing abilities compared with a full-length GEP100 (Fig. 3B). It is reported that the Sec7 domain is required for the acceleration of GTP binding to ARFs [11, 12], and that the PH domain interacts with phosphoinositides [16]. It is interesting that the Sec7 domain-deleted mutant (GEP100⌬Sec7) and the PH domaindeleted mutant (GEP100⌬PH) induced the apoptosis to the level of that of a full-length GEP100. These results suggest that the N- terminal region containing IQ motif and C-terminal

GFP

Annexin V

Hoechst

Merge

DIC

GFP

Annexin V

Hoechst

Merge

DIC

Control Fig. 1. Fluorescence images of GFP-GEP100-expressed monocytic phagocytes. PMA-differentiated U937 cells (A) and RAW 264.7 cells (B) were transfected with plasmid containing GFP (Control) or GFP-tagged GEP100 (GEP100). After 11 h, the cells were stained with annexin V-Alexa 568 (Annexin V) and Hoechst 33342. Left panels show the fluorescence images of GFP. Right panels show the DIC images. Arrows show the annexin V-positive and chromatin-condensed apoptotic cells (Merge). Data represent one of more than eight experiments. Original scale bars: 40 ␮m.

GEP100

B Control

GEP100

918



A

Transfection of the two siRNA duplexes (Duplex-1 and -2), which act on the different target sequences within GEP100, reduced the expression of GEP100 by 70 – 80% (Fig. 5A). In contrast, the expression of GAPDH and the patterns of CBB staining were not affected. As shown in Figure 5B, apoptotic cells were increased by TNF-␣ treatment from 11% to 23% among control cells (Control duplex). Of note, the TNF-␣treatment induced the apoptosis by only 15% among GEP100depressed cells (Duplex-1 and -2), and the TNF-␣-induced apoptosis was suppressed significantly among GEP100-depressed cells, compared with control cells (P⬍0.05; Fig. 5B). Furthermore, we evaluated the involvement of GEP100 in apoptosis by using the stably GEP100-supressed cells. The two GEP100-depressed U937 cell populations were established by the stable transfection of shRNA expression vectors (shRNA-1 and -2), which target the difference sequences in GEP100. The expression levels of GEP100 of these cells (shRNA-1 and -2) were ⬃20% of control cells (Scrambled shRNA-1 and -2, Fig. 5C). It is important that the TNF-␣-induced apoptosis was suppressed significantly among these GEP100-depressed cells (shRNA-1 and -2) compared with control cells (Scrambled shRNA-1 and –2; P⬍0.05; Fig. 5D).

Apoptotic cells (%)

10 20 30 40 50 60 70

Control GEP100

B

Apoptotic cells (%)

10 20 30 40 50 60 70

Control GEP100 Fig. 2. Effect of expression of GFP-GEP100 on apoptosis. Apoptosis of PMAdifferentiated U937 cells (A) and RAW 264.7 cells (B), transfected with GFP (Control) or GFP-tagged GEP100 (GEP100) plasmid shown in Figure 1, was quantified. Quantification of apoptotic cells is represented as percentage of GFP-positive cells. Data represent the mean ⫾ SE of eight to nine independent experiments.

region of GEP100 are important for inducing apoptosis; however, the Sec7 and PH domains are not involved in the induction of apoptosis. Furthermore, the apoptosis-inducing activities of N-terminal and/or C-terminal fragments of GEP100 were determined. In separate experiments, we confirmed the expression of the Nterminal- and/or C-terminal-containing fragments by Western blotting in transfected cells (data not shown). It is interesting that only the N-terminal (GEP100:1–27, GEP100:1–139, GEP100:1–278, and GEP100:1–398), or C-terminal (GEP100: 743– 841) fragments could not induce the apoptosis, but Nterminal and C-terminal fragment proteins (GEP100:1–139/ 743– 841, GEP100:1–278/743– 841 and GEP100:1–398/743– 841) induced the apoptosis to the levels of that of a full-length GEP100 (Fig. 4). Of importance, the fusion protein containing residues 1–27 and 743– 841 (GEP100:1–27/743– 841) could not induce the apoptosis, although the protein contained the IQ motif. This observation suggests that the N-terminal region (at least 1–139 amino acid sequence) is required for the induction of apoptosis with the combination of the C-terminal fragment. The same results as those with GFP-tagged fragments (Fig. 4) were observed using myc/His-tagged N-terminal (GEP100: 1–139 and GEP100:1–278) and/or C-terminal (GEP100:743– 841) fragment proteins (data not shown).

Suppression of GEP100 by siRNA To further confirm the involvement of GEP100 in apoptosis, we suppressed the expression of endogenous GEP100 by siRNA and examined its effects on the TNF-␣-induced apoptosis.

DISCUSSION We originally found GEP100 as a novel ARF-GEP, which preferentially activated ARF6 among ARFs [1]. In this study,

Fig. 3. Apoptosis-inducing activities of GEP100 deletion mutants. PMAdifferentiated U937 cells were transfected with plasmids for the expression of GFP, GFP-tagged GEP100 (GEP100), or GFP-tagged GEP100 deletion mutants. (A) After 11 h, cells (3⫻105 cell equivalents) were subjected to Western blot analysis, and GFP-tagged proteins were detected using anti-GFP antibody. (B) After 11 h, cells were stained with Hoechst 33342, and apoptosis was evaluated. Data represent the mean ⫾ SE of eight independent experiments.


919

Apoptotic cells (%)

10

GFP

IQ

GEP100

Fig. 4. Apoptosis-inducing activities of N-terminal and/or C-terminal fragments of GEP100. PMA-differentiated U937 cells were transfected with plasmids for the expression of GFP, GFP-tagged GEP100 (GEP100), or N-terminal and/or C-terminal fragments. After 11 h, cells were stained with Hoechst 33342, and apoptosis was evaluated. Data represent the mean ⫾ SE of seven independent experiments.

1

Sec7 PH

27 139 278 398

743

20

30

40

50

60

70

GFP 841

GEP100:1-27 GEP100:1-139 GEP100:1-278 GEP100:1-398 GEP100:743-841 GEP100:1-27 / 743-841 GEP100:1-139 / 743-841 GEP100:1-278 / 743-841 GEP100:1-398 / 743-841

we revealed that overexpression of GEP100 induced apoptosis in PMA-differentiated U937 cells and RAW264.7 cells. In addition, the induction of apoptosis was inhibited by siRNAmediated GEP100 suppression. Thus, GEP100 is likely to participate in the induction of apoptosis in monocytic phagocytes. GEP100 contains several putative, functional domains. The Sec7 domain, which is present in all the ARF-GEPs, is responsible for the acceleration of GTP binding to ARFs [11, 12]. However, the Sec7 domain-deleted mutant induced apoptosis, suggesting that the Sec7 domain is not involved in the GEP100induced apoptosis. Thus, the apoptosis-inducing activity of GEP100 seems to be independent of ARF activation. Further-

more, mutant analysis indicated that N- and C-terminal regions of GEP100 were important for inducing apoptosis. It is notable that GEP100-induced apoptosis was essentially abolished by the deletion of an IQ-like motif. It is important that a mutant protein containing residues 1–139 and 743– 841, but not a mutant protein containing residues 1–27 and 743– 841, induced the apoptosis. Therefore, only the N-terminal, IQ-like motif (residues 14 –24) is not sufficient for the induction of apoptosis, but the sequence containing amino acid residues 28 –139 is also necessary for inducing apoptosis. IQ motif is a sequence, to which calmodulin binds [15]. However, we confirmed that GEP100 did not interact with calmodulin using

Fig. 5. Suppression of endogenous GEP100 by siRNA in U937 cells. U937 cells were transiently transfected with siRNA duplexes (siRNA Duplex-1 and -2) or control siRNA duplex (Control duplex; A and B). Alternatively, U937 cells were stably transfected with shRNA expression vectors (shRNA-1 and -2) or scrambled shRNAs (Scrambled shRNA-1 and –2; C and D). Total cell lysates of transfected cells (7⫻104 cell equivalents for Western blotting; 1.5⫻105 cell equivalents for protein staining) were subjected to SDS-PAGE. GEP100 and GAPDH were detected by Western blotting, and proteins were stained with Coomassie brilliant blue (CBB; A and C). Transfected cells were incubated without (–) or with (⫹) 100 ng/ml TNF-␣ for 6 h, and then apoptosis was evaluated after Hoechst staining (B and D). Data represent the mean ⫾ SD of six to nine independent experiments. *, P ⬍ 0.05.

920



calmodulin-Sepharose beads (data not shown), suggesting that the N-terminal, IQ-like motif in GEP100 does not act as a calmodulin-binding site. It is known that ARF-GEPs and ARFs are involved in various cellular functions such as intracellular trafficking, actin cytoskeletal dynamics, migration phagocytosis, and superoxide production [11, 17–27]. To evaluate the role of GEP100 in apoptosis, we tried to knock down endogenous ARF-GEP100 by the transient transfection with siRNA duplexes and the stable transfection with shRNA expression vectors. Results of the GEP100-silencing experiments indicated that the TNF-␣-induced apoptosis was significantly suppressed among GEP100depressed cells, compared with control cells in transient and stable siRNA transfection systems. These observations apparently suggest that GEP100 is involved in the apoptotic cell death of monocytic phagocytes. In this paper, we suggest that GEP100 is involved in the induction of apoptosis, based on the results of overexpression and silencing of GEP100. In a GEP100-silencing experiment, TNF-␣-induced apoptosis was suppressed among GEP100-depressed cells, suggesting that endogenous GEP100 could be one of the signal molecules in TNF-␣-induced apoptosis pathway or serve as a positive regulator in a TNF-␣-mediated apoptosis. In contrast, overexpressed GEP100 itself is likely to be speculated to drive the cells to be apoptotic, as it induced the apoptosis without external apoptotic stimuli. To elucidate the mechanisms how GEP100 is involved in the induction of apoptosis, GEP100-binding molecules and their role should be clarified in the future.

5. 6.

7. 8. 9.

10.

11. 12. 13. 14. 15. 16. 17. 18.

ACKNOWLEDGMENTS

19. 20.

This study was supported, in part, by a grant from The Institute for Environmental and Gender-Specific Medicine, Juntendo University School of Medicine (Tokyo, Japan). We thank Dr. Martha Vaughan (Pulmonary-Critical Care Medicine Branch, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD) for providing helpful advice.

23.

REFERENCES

24.

1. Someya, A., Sata, M., Takeda, K., Pacheco-Rodriguez, G., Ferrans, V. J., Moss, J., Vaughan, M. (2001) ARF-GEP(100), a guanine nucleotideexchange protein for ADP-ribosylation factor 6. Proc. Natl. Acad. Sci. USA 98, 2413–2418. 2. Morinaga, N., Tsai, S. C., Moss, J., Vaughan, M. (1996) Isolation of a brefeldin A-inhibited guanine nucleotide-exchange protein for ADP ribosylation factor (ARF) 1 and ARF3 that contains a Sec7-like domain. Proc. Natl. Acad. Sci. USA 93, 12856 –12860. 3. Togawa, A., Morinaga, N., Ogasawara, M., Moss, J., Vaughan, M. (1999) Purification and cloning of a brefeldin A-inhibited guanine nucleotideexchange protein for ADP-ribosylation factors. J. Biol. Chem. 274, 12308 –12315. 4. Claude, A., Zhao, B. P., Kuziemsky, C. E., Dahan, S., Berger, S. J., Yan, J. P., Armold, A. D., Sullivan, E. M., Melancon, P. (1999) GBF1: a novel Golgi-associated BFA-resistant guanine nucleotide exchange factor that

21. 22.

25.

26.

27. 28.

displays specificity for ADP-ribosylation factor 5. J. Cell Biol. 146, 71– 84. Moss, J., Vaughan, M. (2002) Cytohesin-1 in 2001. Arch. Biochem. Biophys. 397, 156 –161. Ogasawara, M., Kim, S. C., Adamik, R., Togawa, A., Ferrans, V. J., Takeda, K., Kirby, M., Moss, J., Vaughan, M. (2000) Similarities in function and gene structure of cytohesin-4 and cytohesin-1, guanine nucleotide-exchange proteins for ADP-ribosylation factors. J. Biol. Chem. 275, 3221–3230. Meacci, E., Tsai, S. C., Adamik, R., Moss, J., Vaughan, M. (1997) Cytohesin-1, a cytosolic guanine nucleotide-exchange protein for ADPribosylation factor. Proc. Natl. Acad. Sci. USA 94, 1745–1748. Chardin, P., Paris, S., Antonny, B., Robineau, S., Beraud-Dufour, S., Jackson, C. L., Chabre, M. (1996) A human exchange factor for ARF contains Sec7- and pleckstrin-homology domains. Nature 384, 481– 484. Klarlund, J. K., Guilherme, A., Holik, J. J., Virbasius, J. V., Chawla, A., Czech, M. P. (1997) Signaling by phosphoinositide-3,4,5-trisphosphate through proteins containing pleckstrin and Sec7 homology domains. Science 275, 1927–1930. Franco, M., Peters, P. J., Boretto, J., van Donselaar, E., Neri, A., D’SouzaSchorey, C., Chavrier, P. (1999) EFA6, a sec7 domain-containing exchange factor for ARF6, coordinates membrane recycling and actin cytoskeleton organization. EMBO J. 18, 1480 –1491. Donaldson, J. G., Jackson, C. L. (2000) Regulators and effectors of the ARF GTPases. Curr. Opin. Cell Biol. 12, 475– 482. Jackson, C. L., Casanova, J. E. (2000) Turning on ARF: the Sec7 family of guanine-nucleotide-exchange factors. Trends Cell Biol. 10, 60 – 67. Cox, R., Mason-Gamer, R. J., Jackson, C. L., Segev, N. (2004) Phylogenetic analysis of Sec7-domain-containing Arf nucleotide exchangers. Mol. Biol. Cell 15, 1487–1505. Dunphy, J. L., Moravec, R., Ly, K., Lasell, T. K., Melancon, P., Casanova, J. E. (2006) The Arf6 GEF GEP100/BRAG2 regulates cell adhesion by controlling endocytosis of ␤1 integrins. Curr. Biol. 16, 315–320. Bahler, M., Rhoads, A. (2002) Calmodulin signaling via the IQ motif. FEBS Lett. 513, 107–113. Lemmon, M. A. (2003) Phosphoinositide recognition domains. Traffic 4, 201–213. Donaldson, J. G. (2003) Multiple roles for Arf6: sorting, structuring, and signaling at the plasma membrane. J. Biol. Chem. 278, 41573– 41576. Hunzicker-Dunn, M., Gurevich, V. V., Casanova, J. E., Mukherjee, S. (2002) ARF6: a newly appreciated player in G protein-coupled receptor desensitization. FEBS Lett. 521, 3– 8. Sabe, H. (2003) Requirement for Arf6 in cell adhesion, migration, and cancer cell invasion. J. Biochem. (Tokyo) 134, 485– 489. Moss, J., Vaughan, M. (1995) Structure and function of ARF proteins: activators of cholera toxin and critical components of intracellular vesicular transport processes. J. Biol. Chem. 270, 12327–12330. Moss, J., Vaughan, M. (1998) Molecules in the ARF orbit. J. Biol. Chem. 273, 21431–21434. Nie, Z., Hirsch, D. S., Randazzo, P. A. (2003) Arf and its many interactors. Curr. Opin. Cell Biol. 15, 396 – 404. Criss, A. K., Silva, M., Casanova, J. E., McCormick, B. A. (2001) Regulation of Salmonella-induced neutrophil transmigration by epithelial ADPribosylation factor 6. J. Biol. Chem. 276, 48431– 48439. Epub 2001 Oct. 18. Zhang, Q., Cox, D., Tseng, C. C., Donaldson, J. G., Greenberg, S. (1998) A requirement for ARF6 in Fc␥ receptor-mediated phagocytosis in macrophages. J. Biol. Chem. 273, 19977–19981. Uchida, H., Kondo, A., Yoshimura, Y., Mazaki, Y., Sabe, H. (2001) PAG3/P␣/KIAA0400, a GTPase-activating protein for ADP-ribosylation factor (ARF), regulates ARF6 in Fc␥ receptor-mediated phagocytosis of macrophages. J. Exp. Med. 193, 955–966. Niedergang, F., Colucci-Guyon, E., Dubois, T., Raposo, G., Chavrier, P. (2003) ADP ribosylation factor 6 is activated and controls membrane delivery during phagocytosis in macrophages. J. Cell. Biol. 161, 1143– 50. Epub 2003 Jun 16. Dana, R. R., Eigsti, C., Holmes, K. L., Leto, T. L. (2000) A regulatory role for ADP-ribosylation factor 6 (ARF6) in activation of the phagocyte NADPH oxidase. J. Biol. Chem. 275, 32566 –32571. Tsutsumi-Ishii, Y., Nagaoka, I. (2003) Modulation of human ␤-defensin-2 transcription in pulmonary epithelial cells by lipopolysaccharide-stimulated mononuclear phagocytes via proinflammatory cytokine production. J. Immunol. 170, 4226 – 4236.


921