Mar 14, 1983 - In R. Weiss, N. Teich, H. Varmus, and J. Coffin. (ed.), The molecular biology of tumor viruses, 2nd ed., part 3. Cold Spring Harbor Laboratory, ...
JOURNAL OF VIROLOGY, Aug. 1983, p. 380-382
Vol. 47, No. 2
0022-538X/83/080380-03$02.00/0 Copyright © 1983, American Society for Microbiology
Involvement of Directly Repeated Sequences in the Generation of Deletions of the Avian Sarcoma Virus src Gene CHARLES A. OMER,'t KATHERINE POGUE-GEILE,'4 RAMAREDDY GUNTAKA,2 KATHERINE A. STASKUS,' AND ANTHONY J. FARAS' Department of Microbiology, University of Minnesota Medical School, Minneapolis, Minnesota 55455,' and Department of Microbiology, Columbia University, New York, New York 100272 Received 14 March 1983/Accepted 12 May 1983
Nucleotide sequence analysis of two molecular clones of transformationdefective avian sarcoma virus indicate that direct repeated sequences of 6 and 20 nucleotides are involved in the formation of the src deletions in these clones. During the replication of avian sarcoma viruses (ASV), transformation-defective variants appear that contain deletions of the transforming gene sequences denoted src (13, 17, 18). These src gene deletions range from those that are 2.0 kilobases in length (5, 13, 15) and appear to have lost most or all of the src gene and are therefore unable to complement point mutations in src (2, 11) to those that are less than 2.0 kilobases in length and are capable of complementing point mutations in the src gene (8, 9, 11). Moreover, the latter deleted transformation-defective ASV are apparently able to recombine with the cellular homolog of src to produce transformation-competent virus (8, 9, 11, 13). In this report, we present nucleotide sequencing data from two
molecular clones of transformation-defective ASV that indicate the involvement of direct repeated sequences 6 to 20 nucleotides long in the formation of these src deletions. DNA sequence analysis was performed on two Prague C (PrC) strains of ASV with src deletions, and the resulting nucleotide sequence information was compared with that for the nondefective PrC strain of ASV. The two src gene deletion sequences were from molecularly cloned circular viral DNAs designated pATV6 and pATV9 as described previously (10). Restriction endonuclease mapping studies indicated that pATV6 and pATV9 contained src gene deletions of approximately 1,700 and 2,000 nucleotides, respectively. Nucleotide sequence analysis of these two clones was performed from a Sacl restriction endonuclease site at the C terminus of the envelope (env) gene across the src gene deletion and into the large terminal repeat sequence (Fig. 1). The resulting DNA sequences were compared with the nucleotide t Present address: Department of Genetics, Stanford University, Stanford, CA 94305.
t Present address: Department of Microbiology, University of Chicago, Chicago, IL 60637.
sequence of the transformation-competent PrC ASV genome (16). The deletion in pATV9 occurred at a 13- to 14-nucleotide direct repeat, whereas that of pATV6 was at a 5- to 6-nucleotide direct repeat (Fig. 2). The extent of the deletion in pATV6 was 1,679 nucleotides; the deletion in pATV9 was 2,015 nucleotides. The remainder of the nucleotide sequences between the env gene and the large terminal repeat in these two deleted clones were identical to the nucleotide sequence of the nondefective PrC ASV determined previously, except for an adenine-thymine base pair in the noncoding region between src and the large terminal repeat (position 8958 of PrC ASV) (16) in pATV6, which appears as a guanine-cytosine base pair in the nondefective PrC sequence (16). Both of the deleted ASV analyzed lack the entire amino acid coding sequence for src. When the DNA sequence of the previously described cDNA clone (pSR-2) of the SchmidtRuppin A (SRA) strain of ASV (19) is compared with the sequence of the src gene from a nondefective SRA strain of ASV (4), it appears that the deletion occurred at a direct repeat of 17 to 20 nucleotides, resulting in the removal of 2,007 nucleotides (4, 19). The nucleotide sequence of the region contiguous to the src gene in SRA ASV has been previously shown to contain a 126-nucleotide direct repeat exhibiting 79% homology (4). It was suggested that this large direct repeat might be involved in the formation of the src gene deletions present in the transformation-defective ASV (4). In the case of the SRA cDNA clone containing an src deletion, this does appear to be the case (Fig. lb) since a 17- to 20-nucleotide direct repeat found at the endpoints of the deletion is part of the larger direct repeat. The nucleotide sequences surrounding the src gene in PrC ASV are different from those in SRA ASV. A computer analysis of the nucleotide sequences adjacent to the src 380
NOTES
VOL. 47, 1983 O OD
A) env"' PrC-ASV
0'
NH A
B
-,
A 0 2
PATV6
0
COOH
src
J~~~~0LR ~~~~~~~~9058
@ _
o
pATV9
a
Q'
6
B) SRA-ASV LT R pSR2
C)_ 'x pATV9 |
x
F
x
S
x
epATV6
w LTIR
rc
n
T
r
LTR
100 bp
FIG. 1. The structure of the PrC ASV src gene
region of two src deletions and the method by which they were sequenced. The size and extent of the deletions in clones pATV6 and pATV9 are shown in comparison with the intact PrC ASV src region (A). The size and extent of the deletion in pSR-2, the SRA ASV cDNA clone of Yamamoto et al., are compared with the intact src region of SRA ASV (4, 19) (B). The deleted regions are shown by the solid black boxes. The large terminal repeat of the virus is designated LTR; the transforming protein and the envelope glycoprotein genes are designated src and env, respectively. Also shown are the direct repeats which surround the src gene regions of PrC ASV and SRA ASV. These direct repeats are indicated by the open boxes with A homologous to A', B to B', and C to C'. The numbering of the PrC sequences is that of the complete PrC ASV sequence (16). The scheme used to sequence the deletions in pATV6 and pATV9 is shown in C. The 5'end-labeled fragments (0) and 3'-end-labeled fragments (0) were sequenced by the method of Maxam and Gilbert (12, 14).
381
gene in PrC ASV indicates that a split direct repeat is present (3). Sequences of 74 and 43 base pairs present on the left end of the src gene and separated by 6 base pairs are directly repeated on the right end of the src gene sequence,
separated by 138 nucleotides (Fig. 1). The homology of these directly repeated sequences is 80%. The deletion in pATV9 has its end points in a 16- to 18-nucleotide direct repeat, which is part of these larger directly repeated sequences analogous to the SRA deletion (Fig. la, 2b). The deletion in pATV6, however, is different since it occurs with 5- to 6-nucleotide repeats at its endpoints that are distinct from the larger direct repeats (Fig. la and 2c). Similar short regions of homology occur at many places throughout the src gene. For instance, a computer search of this region revealed the presence of fourteen direct repeats of 20 nucleotides in length exhibiting 80% nucleotide sequence homology. It has been previously demonstrated that direct repeats can be involved in deletion formation in both procaryotes and eucaryotes (1, 6, 7). In a study of the lac region of Escherichia coli, it was shown that a hot spot for deletions occurred at a 14- to 17-nucleotide direct repeat (1). This repeat was the largest direct repeat found in the lac region. Other deletions occurring at lower frequencies were found at shorter direct repeats (1). A similar situation could conceivably be occurring in the src gene deletions of ASV. Most src deletions that have been examined thus far are approximately 2.0 kilobases in length and are probably due to deletions that occur at the long directly repeated sequences that flank the src gene. These would be analagous to the deletions in pATV9 and in the cloned cDNA of Yamamoto et al. (19). The other src gene deletions representing a smaller region of the src gene appear to be due to deletions like the one that occurred in pATV6 at short direct repeats. The deletions of smaller regions are less frequently found than the larger (2.0-kilobase) deletions and tend to be different from each other in size as well. This
a) PrC-ASV - AAAATGTAGTCTT 1672 bp CTGAGTAAGTACG pATV 6 - AAAATGTAAAGTACG
b) PrC-ASV - CAGATATGCTCTTGCATAGGGGGA 2010 bp GAAATACGCTTTTGCATAGGGAGG pATV 9 - CAGATATGCTTTTGCATAGGGAGG
c) SRA-ASV - CATGTATAGGCCCAAAGCGGGGTCA 2002 bp TGTGTTTAGGCGAAAAGCGGGGCTT pSR-2 - CATGTATAGGCGCAAAGCGGGGCTT FIG. 2. DNA sequence at the site of the src deletions and the corresponding sequences in the intact src gene. The DNA sequences determined as shown in Fig. 1C at the deletion points in the src gene are shown for pATV6 (a) and pATV9 (b). They are compared with the corresponding regions from the intact PrC-ASV src gene (16). The DNA sequence from the cDNA clone pSR-2 determined by Yamamoto et al. at the site of deletion is shown and compared with the sequence of the intact SRA ASV src gene (c) (4, 19). The directly repeated sequences from the intact PrC ASV and SRA ASV src genes at the points of deletion are underlined.
382
NOTES
observation is consistent with the contention that the shorter deletions occur at short direct repeats present at multiple sites within the src gene region. A proposed mechanism for deletions facilitated by direct repeats involves slippage of one DNA strand during replication, causing the region between the direct repeats to loop out (1, 6). This results in one of the progeny DNA molecules containing a deletion spanning the region between the direct repeats. Such a mechanism could occur in integrated copies of proviral DNA, thus leading to deleted RNA transcripts being made and packaged into virions. A similar mechanism could also be envisioned to occur during reverse transcription, again resulting in a deleted proviral DNA being integrated into the chromosomes of infected cells and giving rise to deleted virion RNA. This work was supported by Public Health Service grant CA 18303 from the National Institutes of Health and by a grant from the Leukemia Research Fund. We thank Cindy Kosman for typing this manuscript, Dick Brown for his support, and Marc Collett and Tony Purchio for the helpful comments. We also are grateful for the use of the Stanford University computer facilities (SUMEX-AIM). LITERATURE CITED 1. Albertini, A. M., M. Hofer, M. P. Calos, and J. H. Miller. 1982. On the formation of spontaneous deletions: the importance of short sequence homologies in the generation of large deletions. Cell 29:319-328. 2. Bernstein, A., R. MacCormick, and G. S. Martin. 1976. Transformation-defective mutants of avian sarcoma viruses: the genetic relationship between conditional and nonconditional mutants. Virology 70:206-209. 3. Coffin, J. M. 1982. Structure of the retroviral genome, p. 317-318. In R. Weiss, N. Teich, H. Varmus, and J. Coffin (ed.), The molecular biology of tumor viruses, 2nd ed., part 3. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 4. Czernilofsky, A. P., A. D. Levinson, H. E. Varmus, J. M. Bishop, E. Tischer, and H. M. Goodman. 1980. Nucleotide sequence of an avian sarcoma virus oncogene (sre) and proposed amino acid sequence for gene product. Nature (London) 287:198-203. 5. Duesberg, P. H., and P. K. Vogt. 1973. Gel electrophoresis of avian leukosis and sarcoma virus RNA in formamide: comparison with other viral and cellular RNA species. J. Virol. 12:594-599. 6. Efstradiatis, A., J. W. Posakony, T. Maniatis, R. M. Lawn, C. O'Connel, R. A. Spritz, J. K. DeRiel, B. G. Forget, S. M. Weissman, J. L. Slightom, A. E. Blechl, 0.
J. VIROL. Smithies, F. E. Baralle, C. C. Shoulders, and N. J. Proudfoot. 1980. The structure and evolution of the human globin gene family. Cell 21:653-668. 7. Farabaugh, P. J., U. Schmeissner, M. Hofer, and J. H. Miller. 1978. Genetic studies of the lac repressor. VII. On the molecular nature of spontaneous hotspots in the lac I gene of Escherichia coli. J. Mol. Biol. 126:847-857. 8. Fincham, V. J., P. E. Neiman, and J. A. Wyke. 1980. Novel conditional mutants in the src gene of Rous sarcoma virus: isolation and preliminary characterization. Virology 103:99-111. 9. Hanafusa, H., C. C. Halpern, D. L. Buchhagen, and S. Kawai. 1977. Recovery of avian sarcoma virus from tumors induced by transformation-defective mutants. J. Exp. Med. 146:1735-1747. 10. Katz, R. A., C. A. Omer, J. H. Weis, S. A. Mitsialis, A. J. Faras, and R. V. Guntaka. 1982. Restriction endonuclease and nucleotide sequence analyses of molecularly cloned unintegrated avian tumor virus DNA: structure of large terminal repeats in circle junctions. J. Virol. 42:346-351. 11. Kawai, S., P. H. Duesberg, and H. Hanafusa. 1977. Transformation-defective mutants of Rous sarcoma virus with src gene deletions of varying length. J. Virol. 24:910914. 12. Lacy, E., and T. Maniatis. 1980. The nucleotide sequence of a rabbit 3-globin pseudogene. Cell 21:545-553. 13. Lai, M. M. C., S. S. F. Hu, and P. K. Vogt. 1977. Occurence of partial deletion and substitution of the src gene in the RNA genome of ASV. Proc. Natl. Acad. Sci. U.S.A. 74:4781-4785. 14. Maxam, A. M., and W. Gilbert. 1980. Sequencing end labelled DNA with base-specific chemical cleavages. Methods Enzymol. 65:499-560. 15. Neiman, P. E., S. E. Wright, C. McMillin, and D. MacDonnell. 1974. Nucleotide sequence relationships of avian RNA tumor viruses: measurement of the deletion in a transformation-defective mutant of Rous sarcoma virus. J. Virol. 13:837-846. 16. Schwartz, D., R. Tizard, and W. Gilbert. 1982. Complete nucleotide sequence of the PrC strain of Rous sarcoma virus, p. 1338-1348. In R. Weiss, N. Teich, H. Varmus, and J. Coffin (ed.), The molecular biology of tumor viruses, 2nd ed., part 3. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 17. Vogt, P. K. 1971. Spontaneous segregation of nontransforming viruses from cloned sarcoma viruses. Virology 46:939-946. 18. Wang, L.-H., P. Duesberg, K. Beemon, and P. K. Vogt. 1975. Mapping RNase T,-resistant oligonucleotides of avian tumor virus RNAs: sarcoma-specific oligonucleotides are near the poly(A) end and oligonucleotides common to sarcoma and transformation-defective viruses are at the poly(A) end. J. Virol. 16:1051-1070. 19. Yamamoto, T., G. Jay, and I. Pastan. 1980. Unusual features in the nucleotide sequence of a cDNA clone derived from the common region of avian sarcoma virus messenger RNA. Proc. Natl. Acad. Sci. U.S.A. 77:176180.
