Iranian Congress Of Clinical Microbiology

0 downloads 47 Views 6MB Size Report
Sabahi Farzaneh. Sadeghi Ebrahim. Saebi Esmaeil. Saffar Mohammad Jafar. Sagheb Mohammad Mehdi. Sajadi mahmoud. Sanaee Dashti Anahita.
1

1

th

7

Iranian Congress Of

Clinical Microbiology October 19-21, 2013

2

In The Name Of ALLAH The All Compassionate, The All Merciful

3

Jesus G.Valenzulela, Ph.D. Chief, Vector Molecular Biology Section Laboratory of Malaria and Vector Research National Institute of Allergy and Infectious Disease, NIH

4

Congress Organizaion President: Abdolvahab Alborzi, MD Professor of Pediatric Infectious disease Scientific Secretary: Parisa Badiee, PhD Medical Mycologist, Professor Alborzi Clinical Microbiology Research Center Executive Secretary: Marzieh Jamalidoust Medical Virologist, PhD Professor Alborzi Clinical Microbiology Research Center

5

Scientific Committee Abdoli Oskoui Shahram

Ghadimi moghadam abdolkarim

Alami Mohammad Hassan

Masoomi Asl Hossein Moatari Afagh

Ghanaii Roxana Alborzi Abdolvahab Amiryan Seyyed Mohammad Hadi

Moghadami Mohsen Ghasemian Safaii Hajiyeh Mohammadi Jasem Ghayoomi Mohammad Ali Moharez Minoo

Askariyan Mehrdad

Gooya Mohammad Mehdi

Ataii Behrooz

Haghkhah Masood

Azarpira Negar

Hajabdolbaghi Mahboobeh

Badali Hamid

Hamedi Abdolkarim

Badiee Parisa

Hashempour Tayebeh

Badri Shideh

Hatam Gholamreza

Motazedian Mohammad Hosein

Bagheri Lankarani Kamran

Hosseini Seyed Younes

Naim Hossein

Bayat Ahmad

Hosseininasab Ali

Nasehi Mahshid

Bazargani Abdolah

Imanieh Mohammad Hadi

Nasimfar Amir

Behzad Behbahani Abbas

Irajian Gholamreza

Nikeghbaliyan Saman

Bolursaz Mohammad Reza

Jamalidoust Marzieh

Nikookar Mohammad Hossein

Bonyadi Behrooz

Kadivar MohammadRahim

Oboodi Barat

Chakrabarti Arunaloke

Kamali Karmila

Owlia Parviz

Chakrabarti Sushmita

Karimi Abdolah

Pakshir Keivan

Davarpanah Mohammad Ali

Karimi Mohammad

Pouladfar Gholamreza

Falahzadeh Mohammad Hossein

Karimi Mohammad Hossein

Pourabbas Bahman

Kesson Alison

Ranjbar Reza

Khashei Mohammad

Rasekhi Alireza

Khorammi Hamidreza

Rasoolinejad Mehrnaz

Khoshdel Abolfazl

Rasouli Manoochehr

Malek Hosseini Ali

Ravanshad Mehrdad

Malekzadeh Reza

Razlansari Ali Akbar

Mardani Masoud

Rezapor Ali

Mohebali Mehdi Mokhtari Azad Talat Mostafavi Naser Motamedifar Mahammad

Farshad Shohreh Feizabadi Mohammad Mehdi Firoozi Roya Froutan Hamid Reza Geramizadeh Bita Ghaderi Abbas Ali

6

Rodgari Amir

Sanaee Dashti Anahita

Soltani Jafar

Sabahi Farzaneh

Sasan Mohammad Saeid

Tabarsi Payam

Sadeghi Ebrahim

Shahriyari Bahador

Tabatabaii Mohammad

Saebi Esmaeil

Shamsizadeh Ahmad

Yaghobi Ramin

Saffar Mohammad Jafar

Sharifzadeh Sedighe

Zareii Mahmoodabadi Ali

Sagheb Mohammad Mehdi

Shekoohi Tahereh

Ziyaeyan Mazyar

Sajadi mahmoud

Sherkat Abbasi Hamid Reza

Zomorodian Kamyar

Executive Committee Ali Moravej

Maneli Aminshahidi

Noredin Rafatpoor

Amin Abbasian

Maral Choopanizadeh

Pors Farhad

Azra Shamsdin

Maryam Sabzehzar

Sadaf Asaei

Farhad Roosta

Marzieh Hosseini

Taft Vahid

Fatemeh Bamiya

Mehdi Kalani

Zahra Jafarpour

Hadis jafarian

Mohammmad Ali Dehyadegari

Zahra Rezaei

Jalal Mardaneh

Mojtaba Anvarinejad

Mandana Namayandeh

Nasrin Aliabadi

We would like to thank Dr.Hassan Khajehei, PhD for linguistic copy editing

And special thanks to: Hadis Jafarian Maral Choopanizadeh Sadaf Asaei Dr. Zahra Jafarpour

7

CONTENTS

Oral Presentation O-1.................................................................................................................................................................................... Evaluation of immune responses to a new multi-epitope HIV-1 vaccine candidate Rahimi R1, Ebtekar M1, Arabi N2, Mahdavi M2 O-2.................................................................................................................................................................................... Effects of ethanol extract of Hypericum perforatumon experimentally induced Candida keratitis in rabbits Abtahi Froushani SA1, Lotfallahzadeh Barzili B2, Khamisabadi M2 O-3.................................................................................................................................................................................... Association of Interleukin-27 gene polymorphisms with brucellosis in Iranian population Asaei S1, Rasouli M1, Moravej A2, Kalani M1, 3 O-4.................................................................................................................................................................................... Evaluation of Th17 and the Serum IL-17A, IL-21, IL-22, IL-23, TGF-β Levels in Helicobacter Pylori-infected Peptic Ulcer and Gastritis Patients Shamsdin SA¹, Alborzi A¹, Rasouli M¹, Kazemi MH², Bagheri Lankrani K³, Fatahi M², kalani M¹ O-5.................................................................................................................................................................................... Isolation of specific single chain antibodies against Influenza virus (H1N1) Nejatollahi F1, Alizadeh S1, Moazen B2 O-6.................................................................................................................................................................................... Association of interleukin 22 (IL-22) gene polymorphisms and Helicobacter pylori related gastero intestinal diseases Choopanizadeh M1, Rasouli M1, Moravej A2, Shamsdin S.A1 O-7.................................................................................................................................................................................... The effect of gamma interferonoverexpression by adenoviral vector on phenotypic and functionalmaturationof murinedendritic cells Mofazzal Jahromi MA1, AzadmaneshK 2, HassanZM1, Moazzeni SM1 O-8.................................................................................................................................................................................... Homology Modeling and Epitope Mapping of the Neuraminidase Molecule of a Newly Emerged H7N9 Influenza Virus Using In Silico Methods PoorinMohammad N1, Ghaedizadeh Sh2, Mohabatkar H1 O-9.................................................................................................................................................................................... A rapid nested PCR and fragment length polymorphism technique for differentiation of pathogenic and nonpathogenic Leptospira spp. in the condemned kidneys in Shiraz abattoir, South of Iran Taghadosi V, Hosseinzadeh S, Shekarforoush SS O-10.................................................................................................................................................................................. Taurine improves the wound healing process in cutaneous Leishmaniasis in mice model, based on stereological parameters Ashkani Esfahani S ˡ, Zarifi Fˡ, Asgari G², Zargari Aˡ, Rafiee S¹, Noorafshan A3 O-11.................................................................................................................................................................................. Improvement on Automatic Diagnosis of Malaria Parasites using Red Blood Cells Mask Malihi L1 , Ansari-Asl K1 , Behbahani A2 O-12.................................................................................................................................................................................. Molecular characterization of sandflies and Leishmania detection in main vector of Zoonotic Cutaneous Leishmaniasis in Abarkouh district of Yazd province, central Iran Najafzadeh N2,Parvizi P1,Taslimaian R1 O-13.................................................................................................................................................................................. Comparison of Echinococcus granulosus somatic antigens from adult worm (originating from culture media and dog intestine) and hydatid cyst for diagnosis of human cystic hydatidosis using western blotting MohammadzadehT, Sadjjadi SM, Shahriari B, Rahimi HR O-14.................................................................................................................................................................................. Evaluating the immunogenicity for plasmids encoding SAG3, SAG1 antigens of Toxoplasma gondii in BALB/c mice Sobati H1,Dalimi A2, Kazami B3,Ghaffarifar F2 O-15.................................................................................................................................................................................. Enteric Coccidiosis: A Diagnosis More Common than We Think Agholi M1, Tagaddosy Z, Hatam GhR2, Motazedian MH2, Naderi Shahabadi Sh2

8

O-16.................................................................................................................................................................................. Real Time RT-PCR study of the possible clinical use of interferons in treatment of Candidiasis and geram negative infections by increasing the beta-defensin 3 gene expression Heshmatazad E1, Zomorodian K2, Rezaei Z1, Shahriari B2, Jalali-Mashayekhi F3, Pakshir K2, Motamedi M2 O-17.................................................................................................................................................................................. Molecular typing of clinical isolates of methicillin resistant Staphylococcus aureus (MRSA) using PCR-RFLP analysis of ccrBgene region Abbasian A2, Moaddeb A1, Bazargani A1, Japooni A2, Rahimi M.J1, Hosseini M2 O-18.................................................................................................................................................................................. Differentiation of modern and ancestral Mycobacterium tuberculosis in northwest region of Iran by screening for the presence of TbD1 Asgharzadeh M1, Samadi Kafil H2, Pour Ostadi M3, Ghorghanlu S4 O-19.................................................................................................................................................................................. Comparison of IS6110-RFLP and MIRU-VNTR methods results in molecular epidemiology studies of Tuberculosis in a regional study in Iran Asgharzadeh M1, Samadi Kafil H2, Pour Ostadi M3, Ghorghanlu S4 O-20.................................................................................................................................................................................. Genotyping of Ethambutol-resistant Mycobacterium tuberculosis isolates using Multiplex Allele-Specific PCR (MASPCR) Bahrami S1, Bahrmand A.R.2, Safarpour E2, Masoumi M2, Saifi M2 O-21.................................................................................................................................................................................. Identification of Rifampin and Isoniazid resistance in Mycobacterium tuberculosis isolate with screening of rpoB, katG, inhA Using High-Resolution Melting Curve Tavakoli Z1*, Nazemi A2, Khataminezhad MR2 O-22.................................................................................................................................................................................. Study of primary and secondary drug resistance of Mycobacterium tuberculosis using economic proportion method during a 2-year period in Tabriz Rafi A, Heidarnazhad H, Amini S, Habibzadeh D, Moaddab SR O-22.................................................................................................................................................................................. High prevalence of metallo-beta-lactamase-producing Acinetobacter baumannii isolated from Intensive Care Unit patients Noori M1, Fallah F1, Hashemi A1, Alimehr Sh2, Maham S2, Goudarzi H1, Aghamohammad Sh1 O-24.................................................................................................................................................................................. Prevalence of TEM-1, SHV-1 genes & the patterns of susceptibility antibiotic among Klebsiella pneumonia ExtendedSpectrum β- lactamases production isolated from cilinical samples obtained from university hospitals of Kerman city, 2011. Moradi M1, Afzali M2, Sobhani Poor MH3, Alizade H4 O-25.................................................................................................................................................................................. Rapid detection of katG ser315thr substitution clinical isolates of mycobacterium tuberculosis by using PCR-RFLP Tayeboon M1, Ahmady A2, Shojapour M3, Arjomandzadegan M2 O-26.................................................................................................................................................................................. Investigation of antibacterial effect of the CM11 peptide on skin infection caused by Methicillin-Resistant Staphylococcus aureu in mice Babavalian H, Moosazadeh Moghaddam M, Latifi A O-27.................................................................................................................................................................................. Evaluation of the frequency of Vancomycin resistant genes in Vancomycin resistant Enterococci isolated from clinical sample of Alzahra hospitals in Isfahan Nikooei M1, Meidani M2,Khorvash F2 O-28.................................................................................................................................................................................. Phagetherapy of Ecoli o157:H7 infection in mouse by special lytic bacteriophages isolated from Tonekabon cows' sewage Derakhshanpour J, Ghahremaninezhud N, Nasrolahi A O-29.................................................................................................................................................................................. Determination of prevalence and antifungal susceptibility patterns of Candida isolates in Milad Hospital Intensive Care Unit, Tehran, Iran Alimehr S1, Vossoghian S1, Fallah F1, Rahbar M2, Mohammadzadeh M3 O-30.................................................................................................................................................................................. Disseminated zygomycosis involving pancreas in a leukemic child Ghadimi Moghadam A1, Alborzi A2, Pouladfar GhR2, Badiee P2 O-31..................................................................................................................................................................................

9

Isolation and Molecular Identification of Aspergillus spp Isolated from ICU, Indoor and Outdoor Environments of Hospitals, Mazandaran, Northern Iran Mahmoudi Gh.1, Nasrollahi Omran A.2, Hedayati MT.3, NazemiA.4 O-32.................................................................................................................................................................................. Expression patterns of Candida albicans agglutinin-like sequence genes in specimens isolated from women with vaginal candidiasis by RT-PCR assay Roudbary M1, Roudbarmohammadi SH1, Bakhshi B2, Farhadi Z3 O-33.................................................................................................................................................................................. Comparative survey between CDR1, CDR2, MDR1 genes in resistant and sensitive to fluconazole Candida albicans by RT REAL-TIME PCR Ariana N, Nasrollahi A, Nazemy A O-34.................................................................................................................................................................................. Histopathological and molecular analysis to detect Aspergillosis and Mucormycosis in sinonasal biopsy specimens Parisa Badiee1, Mohamad Javad Ashraf2, Negar Azarpira2,3, Bijan Khademi4, Mahmood Shishegar4, Elham Abedi2, 2 1 Afsoon Hakimzadeh ,Jafarian H O-35.................................................................................................................................................................................. Investigation of BCR1 gene expression in Candida albicans isolates by RT-PCR technique and its impact on biofilm formation NikoomaneshF, Roudbarmohammadi Sh, Bayat M, Roudbary M O-36.................................................................................................................................................................................. Correlation between Hyperglycemia-induced Oxidative Stress Response with Expression Levels of Hsp16 and CoQ10 in Schizosaccharomyces pombe Jafari Ghods F, Palabiyik B O-37.................................................................................................................................................................................. Effect of vitamins A, K1 and B1onA. parasiticusgrowth, aflatotoxin production and aflR gene expressionby RT-PCR Nazemi L1, Moazeni M1, Rezaie S1, 2 O-38.................................................................................................................................................................................. Identification of Candida species causing RVVC in a gynecology clinic in Urmia, northwestern Iran Diba K., Namaki A., Hanifian H. O-39.................................................................................................................................................................................. Use of padlock probes and rolling circle amplification for rapid identification of Trichophyton species, related to human and animal disorders Shokohi T1,2, Zakeri H1, Badali H1,2, Mayahi S1,2, Didehdar M1, Mosayebi E1 O-40.................................................................................................................................................................................. Candida species isolated from blood culture by BACTEC system Badiee P, Jafarian H, Jafarpour Z, O-41.................................................................................................................................................................................. Investigation of fungal infection in patients undergoing functional endoscopic sinus surgery, Shiraz, Iran Badiee P1, Gandomi B2, Sabz GA2, Jafarian H1 O-42.................................................................................................................................................................................. HBV core protein controlling immune activation increases Adenovirus maintenance in Liver tissue. Pakniat A1, Hosseini S.Y1, Karimi M.H2, Rezaei F1, Geramizadeh B2, Fattahi M.R1, Taghavi S.A1 ,Nejabat M1 O-43.................................................................................................................................................................................. Hepatitis C Virus down regulates IL28 A and B expression Khanlari Z1, Sabahi F2*, Hosseini SY3, Ghaderi M1, Mousavi Nasab SD1 O-44.................................................................................................................................................................................. Evaluation of human herpesvirus-6 and cytomegalovirus infections in pancreas transplant patients Kadkhodaei S1,2 , Yaghobi R1, Kargar M2 , Geramizadeh B1, Azarpira N1 , Nikeghbalian S³, Malek Hosseini SA3 O-45.................................................................................................................................................................................. Recombinant production of flagellin of Salmonella enteritidis Tarahomjoo SH, 1Hashem Nejad K, 1Alebouyeh M, 2Tajbakhsh M 2 O-46.................................................................................................................................................................................. Improving Adenoviral vector persistence in liver tissue through HCV NS3 immune modulator protein Hosseini SY1, Karimi H2, Rezaei F1,4, Pakniat A1, Fattahi MR1, Sabahi F3, Khanlari Z3, Moeini M1 , Kargar M4 O-47.................................................................................................................................................................................. Determining HCV genotypes in Iranian addicts and other high risk groups by Real-Time PCR assay Jamalidoust M, Namayandeh M, Asaei S, Aliabadi N, Ziyaeyan M O-48.................................................................................................................................................................................. Detection of High-Risk Human Papillomavirus (HPV) E6 and E7 Oncogene Transcripts in Cervical Scrapes by qRTPCR and Correlation with the Stage of Disease Zare M 2, BehzadBehbahani A1, Hamedi B3, Kafilzadeh F2, Aboualizadeh F1, Moezi L1, Ranjbaran R1, Amidzadeh Z1,Hassani N2 , Alavi P1,Okhovat M.A

10

O-49.................................................................................................................................................................................. Rapid Detection of HSV Genome in Suspected Patients by Real-time PCR Aliabadi N, Jamalidoust M, Asaei S, Namayandeh M, Ziyaeyan M O50 ................................................................................................................................................................................... Anti Alternative Open Reading Frame Antibody in Different Groups of Patients with HCV Infection Hashempour T1, Alborzi AM2, Ajorloo M2, Bamdad T2, Merat Sh3, Haj-sheykholeslami A3 O-51.................................................................................................................................................................................. Nano-dendrimer containing TSA plasmid of Leishmania major induced immune responses in BALB/c mice Zarrati S1, Tabatabaie F 2, Shafiee Ardestani M3 , Khabaz zade Tehrani N1, Abrehdari Tafreshi Z1 , Pirestani M4 , Mahdavi M5 O-52.................................................................................................................................................................................. Cloning and expression of truncated chlamydial major outer membrane protein in E.coli Bitazar R1, 2, Naserpour Farivar T1,Bagheri R2,Salimi A3, Babaabasi B4 , Hajikhani B2 O-53.................................................................................................................................................................................. Evaluation of adjuvant activity of alum and propranolol on the efficacy of complete Plasmodium berghei blood stage vaccine in Balb/c mice Karamati SA, Mohammadzadeh Hajipirloo H, Shahabi Sh, Hazrati Tappeh K, Bozorgomid A O-54.................................................................................................................................................................................. Laboratory Production and Evaluation of Haemophilus influenzae type b Polysaccharide-KLH carrier protein conjugate as a novel meningitis vaccine candidate Khosrowmanesh Sh1, Shafiee Ardestani M 2 O-55.................................................................................................................................................................................. Immunogenicity of Influenza vaccine in Rheumatoid Arthritis Patients under treatment with immunosuppressive drugs Razavi F1,Baharlou R2 O-56.................................................................................................................................................................................. First report of Clonal evolution Multidrug-Resistant Acinetobacterbaumannii in West of Iran Mohajeri P, Norozi B, Farahani A O-57.................................................................................................................................................................................. Study on antibacterial resistance of coagulase negative Staphylococcus in keratitis infections followed by using soft contact lens in patients admitted to Feiz Hospital- Isfahan, Iran. 1392 Faghrij1, Oryan G2, Sadat HosseiniN3 O-58.................................................................................................................................................................................. Rapid molecular diagnosis of methicillin resistance Staphylococcus aureus (MRSA) isolated from Milad and Moheb hospitals, Iran Gomarian Z1, Shahhosseiny MH2,3, Bayat M 4, Mahmoudi MA3,Nafarieh T5,Rahbar M6 O-59.................................................................................................................................................................................. Cloning of Staphylococcus simulans lysostaphin enzyme gene in Escherichia coli Top10 and Bacillus subtilis WB600 using shuttle expression vector pMR12 Yazdansetad S1, Heidarinezhad H2, Hoseinian H3 , Valikhani M3 (M.Sc), Marvi Moghaddam A3 O-60.................................................................................................................................................................................. Community-acquired methicillin-resistant Staphylococcus aureus nasal colonization prevalence; a prospective study in Iran Shokoohi Sh¹,Sazgar S ¹,Abbasi F²,Hajikhani B¹,Kashi MS¹, Sabeti Sh¹, Sarbakhshi P¹ O-61.................................................................................................................................................................................. Detection of Mycobacterium tuberculosis complex and evaluation of drug resistance to Isoniazid and Rifampin by molecular methods in Shiraz reference laboratory of Tuberculosis.2012-2013 Farzanfar E1.,Sami Kashkooli G1.,Behbahani A2.,Goharnezhad J1.,Kalari M1.,Tavakolian V1.,Rezaei M1.,khavand F1.,Honarvar B1.,Javanmardi S1 O-62.................................................................................................................................................................................. Study cephalosporinacylaseenzymesingram-negative bacteriaisolated from clinical sample FarzanehHosseini1, Abbas Akhavansepahy2, MaedeVarghaei3 O-63.................................................................................................................................................................................. Frequency and expression of mutacin biosynthesis genes in isolates of Streptococcus mutans and the antimicrobial activity of these against Gram-positive bacteria especially Staphylococcus epidermidis as antimicrobial agent Salehizadeh M1, Salehi M2, Falahiyan MR2 O-64.................................................................................................................................................................................. Seasonal prevalence of Campylobacter jejuni and Campylobactercoli in raw milk Using Multiplex PCR assay Ahmadi HedayatiM1, NasiriD2, TavakoliA3,MotaghifarA4, RamazanzadehR1 O-65..................................................................................................................................................................................

11

Prevalence and distribution of Clostridium difficile PCR ribotypes in antibiotic associated diarrhea in hospitalized patients in Shiraz, Iran Farshad Sh, Azami M, Pouladfar GhR, Ziyaeyan M, Aminshahidi M, Alborzi A O-66.................................................................................................................................................................................. Evaluation of LAMP and PCR techniques in Staphylococcus aureus sinusitis detection Rabiei Nematabad M1, 2, ShahhosseinyMH2, 3, FarhadiM4, Alireza Mohebbi AR4, Mahmoudi MA 2, BayatM5 O-67.................................................................................................................................................................................. Detection of LeptospiraFrom Urine and Blood and Recognise Genotype That By PCR-RFLP Method AdhamiN1, RajabniaR2, Ferdosi E, Ghadami E, Kheirandish A O-68.................................................................................................................................................................................. Molecular serologic parasitologic assess of ocular toxoplasmosis in patients referred to ophthalmology centers of Farabi, Labbafinejad and Imam Hossein Hospitals, Tehran, Iran Saber V1, Seyed Tabaei1,Haghighi1, Tabatabaei A2 O-69.................................................................................................................................................................................. Study of survival and activity of lux marked Escherichia coli SM10S1 under different antibacterial treatments in lettuce Zahedi Zohrabad A, Mashreghi M, Bahreini M O-70.................................................................................................................................................................................. Phylogenetic group determination of fecal Escherichia coli isolated from human in Shiraz, Southern Iran Derakhshandeh A1, Firouzi R1, Motamedifar M2, Motamedi A1, Bahadori M1, Naziri Z1 O-71.................................................................................................................................................................................. Comparison of molecular and culture based methods for the detection of Mycobacterium tuberculosis and drug sensitivity in Shiraz tuberculosis research center, Iran Honarvar B1, Emami A2 , Moghadami M3, Sami KashkooliG4, Kalari M4, RezaeiM4,Tavakolian V4, Farzanfar E4, Behzad BehbahaniA5, GoharnejadJ4, Roudgari A4, Afsar KazerooniP6, KhavandegaranF4, ShafieianSh4 O-72.................................................................................................................................................................................. Nosocomial Infections and Antibiotic Administration in Pediatric department, Imam Reza Hospital Mashhad, Iran Hamedi A1, Amirian MH2, Kouzegaran S2, Talebkhah Z1 O-73.................................................................................................................................................................................. Emergence of Carbapenemase-producing Enterobacteriaceae isolates in Tehran Hospitals Shahcheraghi F1, Nobari S1, Rahmati Ghezelgeh F 1, Valizadeh B2 O-74.................................................................................................................................................................................. Antimicrobial susceptibility and genetic characterization of Metallo-β-Lactamase Producing Pseudomonas aeruinosa Strains Isolated from Ghotbeddin Burn Hospital, Shiraz, Iran Anvarinejad M1, Japoni A1,Giammanco GM 2,Dehyadegari MA1, Rafaatpour N 1, Alipour E1 O-75.................................................................................................................................................................................. Non tuberculous Mycobacteria isolated from tuberculosis patients in Golestan province, North of IRAN Shafipour M1, Ghane M2, Rahimi Alang S 3, Livani S4, Javid N4, Shakeri F4, Allah Ghaemi E5 O-76.................................................................................................................................................................................. Detection of biofilm formation among the clinical isolates of Staphylococcus aureus Shahbazi M1,2, Ghasemi Y1, Haghkhah M2 O-77.................................................................................................................................................................................. Assessment of water container of incubators of newborn wards in hospitals of Guilan province for determination of the frequency of mip gene in contained legionella pneumophila Ahmadi Jalali Moghadam M1,3, Honarmand H1, Asfaram Meshginshahr S 2, Soltani Tehrani B1, Nojavan M 3 O-78.................................................................................................................................................................................. Development of a Reverse Microplate Hybridization Assay for Rapid Detection of Isoniazid Resistant of Mycobacterium Tuberculosis in Clinical Samples Hassani N2, Behzad Behbahani A1, Kargar M2, Honarvar B4 , Aboualizadeh F1, Moezi L1, Ranjbaran R1, Farzanfar E3, Sami Kashkoli G3, Zare M1, Alavi P1 O-79.................................................................................................................................................................................. Bacteriologic Study of blood cultures and their antibiotic Susceptibility among Children and Neonates with suspected septicaemia in Abadan, southern Iran Jomezadeh N 1, Babamoradi Sh 2, Motlagh ME 1, Torabizadeh M 3 O-80.................................................................................................................................................................................. Comparing the synergic effects of Chlorohexidine 0.2 % and Cetylpiridinium 0.05 % with Chlorohexidine0.2%, Cetylpiridinium0.05% and persica in reducing the microbial flora of mouth Hashemian F, Hosseynidost R, yarahmadi N. O-81.................................................................................................................................................................................. The impact of the use of probiotics on diarrhea in patients undergoing pelvic radiotherapy Mansouri Tehrani H, Rabbani Khorasgani M O-82..................................................................................................................................................................................

12

Investigation of the bacterial effect on carcino embryonic antigen release from colorectal cell lines Naghibalhossaini F, Sayyadi Kh, Eftekhar E O-83.................................................................................................................................................................................. Lack of association between Helicobacterpylori infection and lipidsinhealthy population Rasmi Y¹,, Zeynalzadeh J ², Kademy E2, Majidinia M1, Mohammadzad MS4, Khosravifar F2 O-84.................................................................................................................................................................................. Prevalence of brucellosis in Urmia Aghakhani N, Eghtedar S, Soltani B, Gharabagh N,Rahbar N, Ayromloo M, Nikoonejad MR O-85.................................................................................................................................................................................. High prevalence of latent tuberculosis infection among 920 liver transplant candidates, southern Iran 2000-2012 Pouladfar GhR1, Adelian R1, Malek-Hosseini SA2, Dehghani SM2, Gholami S2

O-86.................................................................................................................................................................................. Estimation of group B streptococcus colonization in high risk neonates using two methods: PCR and Standard culture Shirvani F, Radfar M, Lakestan D O-87.................................................................................................................................................................................. Genotyping of Helicobacter pylori cagA gene by restriction fragment length polymorphism Farshad Sh1, Moaddeb A2, Firozi R2, Fattahi MR3, Derakhshandeh A2 O-88.................................................................................................................................................................................. Herpes zoster induced mandibular osteomyelitis in the immunocompromised patients Dehghani Nazhvani A, Tabrizi R

InvitedLecture Conducting Clinical Trials in Sepsis ............................................................................................................................. Shide Badri, MD Novel Vaccination Strategies and Technologies .......................................................................................................... Hussein Y. Naim, Ph.D. Influenza in Sydney children: Incidence, Diagnosis and Treatment .......................................................................... Presenter: Professor Alison M. Kesson Novel diagnostic techniques for systemic fungal infections ........................................................................................ Arunaloke Chakrabarti Outbreaks of Crimean-Congo Hemorrhagic Fever (CCHF) in razavi khorasan-2012 ............................................. Amirian MH Altered Antibody Profiles against Common Infectious Agents in Chronic Diseases ................................................. Peter D. Burbelo, Kathryn H. Ching, Caryn G. Morse, Ilias Alevizos, Ahmad Bayat*,Jeffrey I. Cohen,Mir A. Ali,Amit Kapoor,Sarah K. Browne, Steven M. Holland,Joseph A. Kovacs, Michael J. Iadarola Infections in Solid Organ Transplantation ................................................................................................................... Gholamreza Pouladfar Cholera in Iran during 2013 .......................................................................................................................................... Hossein Masoumi Asl, Mohammad Mehdi Gouya, Moharram Mafi Infection Control, Yet Neglected ................................................................................................................................... Anahita Sanaei1, Farinaz Farhoudi2

Poster Presentation P-1 .................................................................................................................................................................................... Prevalent agents of gastroenteritis in patients admitted to Imam Khomeini Hospital in the city of Ilam (2012-2013) Ghafurian S, Mohebi R , Shavalipour A , Kazemian H, Ghazanfari M, Mahdian F, Eshrati V P-2 ....................................................................................................................................................................................

13

Production of polyhydroxybutyrate polymer for nano encapsulation and use of medicine Hoseinabadi A 1, Taran M P-3 .................................................................................................................................................................................... Antibiotic resistance and Biofilm formation of gram negative bacteria isolated from skin wound infections in Kerman Hospitals, Kerman, Southern Iran Azemat Eslamtalab E1, KazemiPour N 2, Naghavi NS1 P-4 .................................................................................................................................................................................... Study on Shigella flexneri prevalence in children with diarrhea at Tehran Mofid children's Hospital Peikeghbal E 1, Zolfaghari MR 1, Nicmanesh B 2 , Bakhtiari R, Soltan Dallal MM 3.4 P-5 .................................................................................................................................................................................... Comparison of four methods of DNA extraction from gram-negative and gram-positive agents Shahbazi B, RamazanzadehR, Ahmadi HedayatiM, DareshiriMH, LavakhamsehH P-6 .................................................................................................................................................................................... Evaluation of the spice contamination in the Kermanshah city in 1391 Namki B, Sadat Emami S, MontazeriR P-7 .................................................................................................................................................................................... Prevalence and complications of rectovaginal colonization with group B Streptococci during pregnancy Namavar Jahromi B, Poorarian S, Poorbarfehee S P-8 .................................................................................................................................................................................... Molecular epidemiology of OXA-Carbapenemase-producing Acinetobacter baumannii in Kermanshah Hospitals by pulsed field gel electrophoresis (2010-11) Mohajeri P, Farahani A P-9 .................................................................................................................................................................................... Molecular investigation of Ehrlichiosis in tick infested household dogs, ownership risks Motaghipisheh Sh1, Akhtardanesh B2, Ghanbarpour R3, Mahmoudi T4 P -10 ................................................................................................................................................................................. Etiology and antimicrobial resistance in sternal wound infections following bypass surgery in Shahid Chamran Hospital– Isfahan, Iran 1388 – 1390. Faghri J1, MollakoochakianMJ2, Sadat Hosseini N3, OryanG4 P-11 .................................................................................................................................................................................. Microbial contamination of urine cultures in patients referred to Zare Hospital in Sari City Razaviyan J1, Hadavi R1, Rudbari M2, Rostami E3, Esmaieli Reykande S4 P-12 .................................................................................................................................................................................. Microbial contamination of the wound cultures in burned patients Farokhi F1, Esmaieli Reykande S2, Hadavi R3, Rostami E4, Rudbari M5, Razaviyan J3 P-13 .................................................................................................................................................................................. Comparative analysis of prevalence of thermophilic Campylobacter spp. in cattle and sheep fecal samples using conventional cultivation method and polymerase chain reaction (PCR) in Shiraz, Iran Shirzad Aski H1, Khoshbakht R2, Tabatabaei M1, keshavarzi H3 P-14 .................................................................................................................................................................................. Occurrence of virulence markers and strain diversity of thermophilic Campylobacters isolated from cattle and sheep faecal samples in Shiraz, Iran Khoshbakht R1, Shirzad Aski H2, Tabatabaei M2, keshavarzi H3 P-15 .................................................................................................................................................................................. Distribution of nine virulence-associated genes in Campylobacter jujeni and C. coli isolated from broiler faeces in Shiraz, southern Iran Khoshbakht R 1, Tabatabaei M2, shirzad aski H2, Hosseinzadeh S3, Shekarforoush SS3 P-16 .................................................................................................................................................................................. Occurrence of emergent Arcobacter spp. in slaughtered clinically healthy cattle and sheep by conventional cultivation method and polymerase chain reaction (PCR) in Iran Shirzad Aski H1, Tabatabaei M1, Khoshbakht R2, keshavarzi H3 P-17 .................................................................................................................................................................................. Identification of different types of Clostridium botulinum in various food stuffs using multiplex PCR Sadeghi Sarvestani M.V1, Hosseinzadeh S1, Poormontaseri M1, Fazeli M2 P-18 .................................................................................................................................................................................. Helicobacter pylori infection in recurrent abdominal pain: a case control study Ali-Mohammadiasl H, Fouladi N, Ahmad alipur Sh P-19 .................................................................................................................................................................................. Correlation between age and hospitalization type among β-Lactam resistant E. coli isolated from diarrheal cases in Shahrekord KaboutariJ1,Hossien Kaboli H1, Habibian DehkordiS1, SharifiH2

14

P-20 .................................................................................................................................................................................. Prevalence of E.coli serotypes O26, O91 in diarrheal cases from Shahrekord, Iran Kaboutari J1, KaboliH1, Habibian DehkordiS1, SharifiH2 P-21 .................................................................................................................................................................................. Evaluation of H. pylori infective effect on the prevalence of Giardiasis in Ilam Kazemian H1,Mohebi R1 ,Ghafurian S1 ,Kardan J2 ,Hidary H2 ,Shavalipour A1, Asadolahi P1, Amini V1 P-22 .................................................................................................................................................................................. Design of a TaqMan Real-time PCR assay based on pla and caf1 genes of Yersinia pestis Majidzadeh- A K1, 2, Soleimani M1, 3, Kabiri Kh3 P-23 .................................................................................................................................................................................. Bacterial pathogens and their antibacterial sensitivity profiles of urinary tract infections in Namazi Hospital, Shiraz, Iran, 2012-2013 Sedigh Ebrahim Sarie H1, Mansury D1, HashemizadehZ2, MotamedifarM1, 3, Rokni HosseiniS.Mh1 P-24 .................................................................................................................................................................................. The effect of chloroform extracts of german chamomile on Escherichia coli infected mice Sedigh Ebrahim Sarai H1, MansuryD1, Motamedifar M1, 2 P-25 .................................................................................................................................................................................. Study on prfA gene in Listeria monocytogenes isolated from meat products and clinicalsamples Norrozi J1, Siasie Torrbati E2, Baharvand R3 P-26 .................................................................................................................................................................................. Bacteriophage: A tool to biofilm inhibition and removal Azizian R1 , Azizi Jalilian F2, Karimi S3, Sadeghifard N4, Mousavi Nasab S.D5, Askari H6, Nasser A7

P-27 ............................................................................................................................................................................... Study of ESR/ WBC/ neutrophil in patients with U.T.I referred to Shahid Iranpoor Hospital, Omidiyeh, Iran Tahannejad Z, Jalaliyan Larki N, Sarkaki A, Samie M, Mehdinejad M P-28 .................................................................................................................................................................................. Development of a TaqMan Real-time PCR assay for detection and quantization of Neisseria meningitides Soleimani M1, 2, Majidzadeh K2, 3, Ghadimi Z1 P-29 .................................................................................................................................................................................. Evaluation of different primers for the detection of Brucella in human and animal serum samples by PCR method Zamanian M, Hashemi Tabar G.R, Rad M, Haghparast A. Jahani E. P-30 .................................................................................................................................................................................. Antimicrobial and antifungal activities and chemical composition of essential oil of leaves of Salvia chorassanica Bunge. Motavalizadehkakhky A1, Ebrahimi Z1, Golshan E2 P-31 .................................................................................................................................................................................. Isolation and identification of Arcobacter butzelri from poultry meat in Tonekabon, Pourabbasgholi Z1,Ghane M1, Ghiyamirad M2 P-32 .................................................................................................................................................................................. Inhibition of colicinogenic E.coli on enterohemorrhagic E.coli O157:H7 isolated from calves Shirazi Z1, Tahamtan Y2 P-33 .................................................................................................................................................................................. Prevalence and associated factors for Ureaplasma urealyticum among abortion cases referred to medical center of Tehran by PCR in 2012 Zahirnia Z1 , Eslami G1, Taheripanah R2, Goudarzi H1, Taheri S1, Fallah F1, Dadashi M 1 P-34 .................................................................................................................................................................................. Evaluation of the prevalence of infection with Mycoplasma genitalium in spontaneous abortion, referred to Shahid Beheshti Medical Centers by PCR method in 1391 Zahirnia Z1 , Eslami G1, Taheripanah R2, Goudarzi H1, Taheri S1, Fallah F1, Dadashi M1 P-35 .................................................................................................................................................................................. Assessment of antimicrobial effects of Aloe Vera and Punicagranatum on two pathogenic bacteria in vitro Gray Z1, OlseghiM.H1, Tabarraei A2, Radaee N1, Esalimi R1, Azimi H1, mozafarighadicolaee E1 P-36 .................................................................................................................................................................................. Evaluation of correlation oipA gene in helicobacter pylori with gastric cancer in Azerbayjan Sardari Z, Jabbar pour bonyadi M, Ajamian F, Safar alizadeh R, Vaziri H P-37 .................................................................................................................................................................................. Isolation of Aeromonas, uncommon cause of human infection, from burn patients (GhotbeddinShirazihospital-Shiraz, Iran) Mahmoodi Zh1, Hadi N2, Emami A3 P-38 ..................................................................................................................................................................................

15

Antibacterial activity of essential oil of leaves of Nepetabinaludensison some pathogenic bacteria Ghasemian S1, Motavalizadehkakhky A.R2 P-39 .................................................................................................................................................................................. Prevalence of antibiotic-associated hemorrhagic colitis caused by cytotoxin-producing Klebsiella oxytoca and investigation of ESBLs Mousavi S.F1, Alikhani M.Y2, Shahcheraghi F1,Moghadam M1, Khodaparast S2 P-40 .................................................................................................................................................................................. Antimicrobial resistance patterns among brucella spp. isolated from aborted lamb fetuses Zare S, Firouzi R, Derakhshandeh A P-41 .................................................................................................................................................................................. Correlation of allelic iceA1 and iceA2 with gastric cancer in Azerbayjan Salmani S, Safar alizadeh R, Jabbar pour bonyadi M, Ajamian F, Vaziri H P-42 .................................................................................................................................................................................. Prevalence of multiple antibiotic-resistant Acinetobacter spp (MDR) in Ghaem Hospitalin Mashhad, in 2012 and 2013 Hajimiri S1, Faghihe F1, Rashidi F2, Ghazvini K1, Sadeghian A1 P-43 .................................................................................................................................................................................. The prevalence of bacterial urinary tract infection in diabetic patients referred to Darab diabetic clinic, 2012 Madavani K1, Rahimi Ghiasi M2 P-44 .................................................................................................................................................................................. Epidemiological study of Tuberculosis in human and livestock population of Lorestan, Iran, (1386-1390) Rezaei F1, Shahrokhi S.R2, Mohebi E2, Ghanimatdan M2, Kordestani H2, Baharan O2 P-45 .................................................................................................................................................................................. The effect of Pharmacological and Non-pharmacological mechanisms against biofilm formation by Pseudomonas.auroginosa Abbasi S P-46 .................................................................................................................................................................................. The effect of Zataria multifloraand Peganum harmala on ESBL strains of Pseudomonas. aeruginosa of patients admitted to the Al-Zahra hospital in Esfahan in 1391 Abbasi S P-47 .................................................................................................................................................................................. The pattern of Antibiotic resistance Vibrio cholera isolated from patients with diarrhea, in selected centers in Isfahan Abbasi S P-48 .................................................................................................................................................................................. Detection of respiratory tract infection agents including Streptococcus pneumonia, Staphylococcus aureus, and Klebsiella pneumonia and mycobacterium tuberculosis in one set PCR Rami A1, Kazemi-Lomedasht F2, Pourshafie M.R1 P-49 .................................................................................................................................................................................. Isolation and identification of soil chitinolytic Bacilli in Gorgan area and its Antifungal effects evaluation EiriA1, Nasrollahi A 2, Haji Mohammadi E3 P-50 .................................................................................................................................................................................. Evaluation of possible contamination of 50 students’ used toothbrushes Maghsodi R, kazemi vardanjani A, sharifi A, ganji F, Khaledi M P-51 .................................................................................................................................................................................. Molecular characterization and antibiotic susceptibility profile of community acquired Staphylococcus aureus strains isolated from the carriers’ noses Japoni-Nejad A 1, Kazemian H2, Ghaznavi-Rad E2 P-52 .................................................................................................................................................................................. Investigation of Salmonella spp. contamination in Ducks and Turkeys eggs, consumed in Fars province Ghorbani ranjbaryA, Davary SM, Ghorbani Ranjbary N, Barzegar M, Jome zade MJ P-53 .................................................................................................................................................................................. Serogrouping and drug resistance analysis of Salmonella spp. isolates from Broiler flocks Ghorbani ranjbary A1, ghorbani ranjbary N1, 3 ghorbani ranjbary Z2 P-54 .................................................................................................................................................................................. Mycoplasma genitalium infection in women with cervicitis in Kermanshah Akya A1, Mansur Altaha S2, Ahmadi K2, Salimi A2 P-55 .................................................................................................................................................................................. Optimization ofPCRwithdifferentprimersfor the detection ofBrucella fromsera withDNAisolation byusingtheboiling method Zamanian M, Hashemi Tabar G.R, Rad M, Haghparast A. P-56 .................................................................................................................................................................................. Phenotypic reviews of spread spectrum beta-lactamase and metalobeta lactamase enzyme frequencies in Pseudomonas aeruginosa isolated from burn wounds in Shahid Sadoughi burn hospital in Yazd Akhavan TaftiF, Zandi H, Mousavi SM, Mir Vakii M

16

P-57 .................................................................................................................................................................................. Seroprevalence of Bordetella pertussis antibody in pregnant women Hashemi SH, Zamani M, Mamani M, Nadi E, Torkaman Asadi F, Javedanpoor R. P-58 .................................................................................................................................................................................. Seroepidemiology of Helicobacter pylori antibodies in students of Golestan University of Medical Sciences, 1391 Azadi F1, Hedayat Mofidi M2, ArabAzadeh A2, HedayatMofidi H. S2, Gholamreza R1,Ghasemi-Kebria F1 P-59 .................................................................................................................................................................................. Mutations in the 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in patients with gastrointestinal disorders in Isfahan city, central Iran Khademi F1, Faghri J1, Poursina F1 , Ghasemian Safaei H1 P-60 ................................................................................................................................................................................ The spectrum of bacterial infection in neonates with suspected sepsis Dehghan F1, Shafii A1, Zolghadri N3 P-60 ................................................................................................................................................................................ The spectrum of bacterial infection in neonates with suspected sepsis Dehghan F1, Shafii A1, Zolghadri N3 P-62 .................................................................................................................................................................................. Infective endocarditis among intravenous drug users Abbasi A¹, Besharat M² P-63 .................................................................................................................................................................................. Iatrogenic Botulism; complication of Botulinum toxin injection for treatment of hyperhydrosis Abbasi F¹, VahdaniP ² P-64 .................................................................................................................................................................................. Tubercolosis Spondylitis (Pott’s disease) in Iran, evaluation of 40 cases AbbasiF¹, Besharat M ² P-65 .................................................................................................................................................................................. Designing TaqManReal-time PCR for rapid detection of Streptococcus pneumoniae Aghamiri F1, Soleimani M2, Majidzadeh K3, Mohseni AH4 P-66 .................................................................................................................................................................................. In vivo bactericidal study of melittin derived from honey bee in mouse peritoneum cavity Pooshang Bagheri K, Momenzadeh M, Shahbazzadeh D

P-67 .................................................................................................................................................................................. Microbiological pattern and antibiotic susceptibility of agents isolated from nosocomial infections, staff and equipment of Surgery section and ICU of Imam khomaini hospital, Ilam Pakzad I1.4,Akaram Nejad Z2.3, Khodayari F2.3, Azizian R1.4,Bimanand L1.4 ,Azizi Jalilian F4, Taherikalani M4, Hamidi M6 P-68 .................................................................................................................................................................................. Antimicrobial activity in enzymatic hydrolysates of hen egg- white Hajipour L1, Aminlari M1, 2 P-69 .................................................................................................................................................................................. Prevalence of Atypical Mycobacteria in Shiraz Tuberculosis reference laboratory affiliated to Shiraz University of medical sciences (2012-2013) Rezaei M1, Emami A1, Sami kashkooli G1,Tavakolian V1, Kalari M1,Honarvar B2, Farahbakhsh A3, Goharnezhad J1, Shafiyan Sh1, Farzanfar E1, khosravani M3. P-70 .................................................................................................................................................................................. The Identification and antimicrobial resistance of Pseudomonas aeruginosa in burn patients referring to Emam Mousa Kazem Hospital– Isfahan Moghoofee M, Fazeli H, Ghasemian H P-71 .................................................................................................................................................................................. Prevalence of hand and nasal carriage of Staphylococcus aureus among hospital staff and antibiotic resistance pattern in educational centers of Sari. 2012-2013 Ahanjan M, Abdollahei S, Abdoli H, Mohammad nejad FZ P-72 .................................................................................................................................................................................. Evaluation the prevalence of extended-spectrum beta lactamaz type 1 at acinetobacter isolations from clinical specimen at educational hospitals of Sari city 1392 Ahanjan M, KholdiS P-73 .................................................................................................................................................................................. Bacteruria associated with nephrolithiasis: pre-operative evaluation of 8375 patients candidate for percutaneous nephrolithotomy (PCNL) Hosseini MM, Irani D, Aminsharifi AR, Ghahramani L, Eslah A, Yousefi A , Inaloo R,

17

Abbasi MZ P-74 .................................................................................................................................................................................. Co-existence of methicillin resistance and adherence genes in Staphylococcus aureus ValikhaniM1, Arbab Soleimani N1, Tajbakhsh E2 P-75 .................................................................................................................................................................................. A Study of nosocomial infections caused by urinary tract infection in comparison with urinary tract infection of outpatients in Shahid Faghihi Hospital in Shiraz from 2012 to 2013 Motevasel M1, OkhovatM.A1, SalehzadehF2, MobarhanfardA2, YarmohammadiA3 P-76 .................................................................................................................................................................................. Comparison of wound infection in hospitalized patients and outpatients in Shahid Faghihi Hospital in Shiraz from 2012 to 2013 Motevasel M1, OkhovatM.A1, Salehzadeh F2, MobarhanfardA2, KhosraviA2 P-77 .................................................................................................................................................................................. The study of preservative effects, antibacterial and antioxidant activity of Silybum Marianum on rainbow trout (Oncorhynchus mykiss) in vitro Mirzaei M1, Mohammad Taghipour L1, ShiraziG2, Mollasoltani F3 P-78 .................................................................................................................................................................................. The effect of saponin extract on lipase activity of Pseudomonas aeruginosa BehzadifarM, Abdi-aliA, Saboora A P-79 .................................................................................................................................................................................. Designing a new primer pairs for identification of most Brucella spp. by PCR assay Mohammadi M P-80 .................................................................................................................................................................................. Phylogenic typing of Escherichia coli isolates caused urinary tract infection in Jahrom Ranjbar M1, SolhjooK2, KargarM3, ParastanR4, Mojahedi JahromiS4, DarugheF4 P-81 .................................................................................................................................................................................. Diagnosis of Legionella pneumophila in stagnant water of Tehran with loop mediated isothermal amplification (LAMP) Malek Mohammadi M1, 2, Shahhosseiny MH2, 3, MassahiS2, Rabiei NematabadM2, Rahbar M4 P-82 .................................................................................................................................................................................. Molecular detection of metallo-β-lactamase gene blaVIM-1 in Imipenem-resistant Pseudomonas aeruginosa strains isolated from hospitalized patients in main Isfahan Hospital centers Faghri J, Safaei H Gh, Sedighi M P-83 .................................................................................................................................................................................. Epidemiologic assessment of infections in adult trauma intensive care units Masjedi M1, Feizi M2, Sabetian G1, Roodgari A2

P-84 .................................................................................................................................................................................. Comparison of tip-alpha gene expression of Helicobacter pylori in strains isolated from patients with gastritis and gastric cancer with use Real Time RT PCR Ahmadi HedayatiM1, EslamiG2, DabiriH2 , RamazanzadehR1 , NoshakMA1 P-85 .................................................................................................................................................................................. Survey of H.pylori genes expression close to in vivo conditions Ahmadi Hedayati M P-86 .................................................................................................................................................................................. Detection of sensitivity of direct smear method in diagnosis of tuberculosis in reference tuberculosis laboratory affiliated to Shiraz University of medical sciences (2012) Kalari M1, Tavakolian V1, Sami Kashkooli G1, Emami A1, Honarvar B2, Goharnezhad J1, JavanmardiS1, Rezaei M1, Farzanfar E1, Razeghi S1, Farahbakhsh A3, Khosravani M3 P-87 .................................................................................................................................................................................. Las/I gene of quorum sensing system in Pseudomonas aeruginosa as a suitable target for design a high specificityand sensitivity PCR detection kit Aghamollaei H1, Azizi Barjini K2, Moosazadeh MogaddamM1 P-88 .................................................................................................................................................................................. Bacterial contamination of raw milk with E.coli in Tabriz area, East Azerbaijan, Iran EsmaeilluM1, BahadoriA1, Attarhosseani2, BahadoriF3, Hossein pourfeiziZ1, Hasanfamian M1 P-89 .................................................................................................................................................................................. Attenuation of Pathogenicity through Interfering With Bacterial Quorum Sensing Makhfian M1, Hassanzadeh N1, Larijani L2 P-90 ..................................................................................................................................................................................

18

A study on Antibiotics Resistance Patterns of Main Bacteria Isolated from Surgical rooms, Intensive Care Units (ICU and NICU) and Burn wards in Hamadan Education Hospitals Momeni M, Yousefi R, Alikhani MY P-91 .................................................................................................................................................................................. The extraction and purification of an antimicrobial substance produced by Bacillus pumilus isolated from frog skin (Bufo) Noparvar Kh, Ebrahimipour Gh.H,Moradi A P-92 .................................................................................................................................................................................. Frequency of the pathogenic Campylobacter in this of the various types of fishes of Caspian Sea using PCR Technique Poplawski W, Ghane M, GoleyjaniMoghadam R P-93 .................................................................................................................................................................................. Evaluation of Coagulase Gene Polymorphism in Staphylococcus aureus Isolated from Healthy Carriers. Rafiei A1, Zarrini GH2, Mobayen H3 P-94 .................................................................................................................................................................................. A SYBR green Real-Time PCR assay for the specific detection of Salmonella spp. in dairy farm environmental samples Safari A, Khalvati B, Banihashemi M, Ghasemi Y P-95 .................................................................................................................................................................................. The determination of antibiotic resistance patterns of the Escherichia coli isolates from urinary tract infections in Sabzevar, Iran Jahani E1, GhanbarpourR1, Khoshgoftar J1, Zamanian M2, AlizadeH3 P-96 .................................................................................................................................................................................. Phylotyping of Escherichia coli isolates possess beta-lactamase genes from UTI cases in Sabzevar city, Iran JahaniE1, Ghanbarpour R1, Zamanian M2, AlizadeH3, Khoshgoftar J1 P-97 .................................................................................................................................................................................. Detection of Mycoplasma Hominis and Ureaplasma Urealyticum by Culture and Polymerase Chain Reaction (PCR) Procedures in Women with septic Abortion Goudarzi E 1, vande yousefi J 2, Goudarzi L 3 P-98 .................................................................................................................................................................................. Antimicrobial Activity of Essential Oil of Flower of Dittrichia Graveolens (L.) Greuter from Iran Golshani E 1, Motavalizadehkakhky AR 2, Babazadeh MA 3, Ebrahimi Z2 P-99 .................................................................................................................................................................................. Kawasaki Disease, a Previously Unreported Cause of Leukemoid Reaction Pouladfar GHR, Nasimfar A P-100 Isolation and differential diagnosis of Vibrio cholerae O1andO139strains from Iranian Kurdistan border towns Shahbazi B, Ramazanzadeh R, Ahmadi Hedayati M, Mohammad Ali Noshak MA, LavakhamseH P-101 ............................................................................................................................................................................... Pulmonary and latent tuberculosis screening in opiate drug users: an essential and neglected approach for harm reduction facilities HonarvarB1, Bagheri Lankarani K1, Odoomi N2, Roudgari A3, MoghadamiM4, Afsar KazerooniP4, Khavandegaran F5, Hassanabadi AR4

P-102 ................................................................................................................................................................................ Mycobacterium aurum keratitis: an unusual etiology of a sight-threatening infection-A Case report study HonarvarB1, Movahedan H2, MahmoodiM1, SheikholeslamiFM3, FarniaP4, ShafieianSh5 P-103 ................................................................................................................................................................................ Erythromycin production with native nitrogen source such as soy bean – meal and rapeseed – meal by Saccharopolyspora erythraea with microbial fermentation method Abgoon P, Attar H P-104 ................................................................................................................................................................................ Epidemiology of brucellosis (Malta fever) in the population covered by medical and health services In Alborz Province 1391 Barati H, ShakuriH, Farhoodi LatranJ P-105 ................................................................................................................................................................................ Prevalence of agr specificity groups among staphylococcus aureus isolates from Hospitals in Tehran Zerehsaz J1, Najar PeerayehSh2 P-106 ................................................................................................................................................................................ Prevalence of toxic shock syndrome Toxin 1 (TSST-1)-producing strains of Staphylococcus aureus isolates from university hospitals in Tehran Zerehsaz J1, Najar Peerayeh Sh2

19

P-107 ................................................................................................................................................................................ Pulicaria vulgaris gaertn; new plant with antituberculosis effects Sharifi Rad J1,2, Hoseini Alfatemi M3, Sharifi Rad M 4,5 P-108 ................................................................................................................................................................................ Removal of lead using biosurfactant producer Pseudomonas aeruginosa Tabatabaee Nasr H.S1, Zargar S J2, Shakerifard P 3,Mazaheri Assadi M4 P-109 ................................................................................................................................................................................ Production of cellulose from native bacteria isolates in Iran Taheri R1, Ajoudanifar H1, Parstoo Pour A2, Yazdansetad S3 P-110 ................................................................................................................................................................................ Antimicrobial activity of new synthesized 4-Hydroxypyridine-4-one compounds Sabet R1, Fassihi A2 P-111 ................................................................................................................................................................................ Screening and characterization of amylase producing bacteria in Binalood soils, Iran Ghazi Birjandi R, Shahnavaz B, Bahreini M, Makhdoumi-Kakhki A, Mahjoobin Tehran M P-112 ................................................................................................................................................................................ Characterization of Exiguobacterium isolates from the Parand area, Tehran-Iran. Heidari R ¹, ShahbaniZahiri H², Akbari Nakhjavani S¹, Akbari Ghomi M¹ P-113 ................................................................................................................................................................................ Efficacy of Pistacia atlantica on Helicobacter pylori Infection RobatiR1,VazirzadehM2 P-114 ................................................................................................................................................................................ Evaluation of the efficiency of Urea as an economical nitrogen sourcein erythromycin production by Saccharopolyspora erythraea byfermentation method Khatiri Z, Attar H, Akbarzadeh S P-115 ................................................................................................................................................................................ Comparison between antibacterial effect of Qurecus brantii extracts and common antibiotics against Pseudomonas aeruginosa isolates from burn wounds Seyyedi Z.S, Kashef N P-116 ................................................................................................................................................................................ Investigation of fibrinolytic enzyme activity in Bacillus thuringiensis Amini Z, Jamaluddin H P-117 ................................................................................................................................................................................ Decreased motility rates and normal morphology of spermatozoa from infertile men by Klebsiella pneumonia Rastgou Z 1, Khoramabadi N 2 ,Mohabati Mobarez A 2, Movahedin M 3 P-118 ................................................................................................................................................................................ Isolation and identification of bacteria on surface and viscera of scorpion species in khuzestan, south western Iran Arabsadeghabadi Z1, Motamedi H2, Vazirianzadeh B3, Nasirabadi N4, Asmar A5 P-119 ................................................................................................................................................................................ Prevalence of class D beta-lactamase Gene in Oxacillin resistant Pseudomonas aeruginosa strains isolated from patients Golshani Z, Dawoodi V, Jafari R P-120 ................................................................................................................................................................................ Detection of antibiotic resistance and prevalence of klebsiella pneumonia carring metallo-beta-lactamases (MBLs) strains isolated from hospitalized patients in Shiraz hospitals, Shiraz, Iran, 2012-2013. Kooti S1, Mansury D1, Taheripour Sisakht M1, Motamedifar M2

P-121 ................................................................................................................................................................................ Investigating antagonistic effect of different kinds of lactobacillus (Plantarum, Paracasei, acidophilus, Delbruki) on drug resistant earuginosa Pseudomonas Josag S1, Razavi S.H2, Farajnia S3, Tanomana A4 P-122 ................................................................................................................................................................................ Antibiotic resistance in UPEC isolated from urinary tract infections outpatients in Kermanshah Jalilian S1, Farahani A1, Mohajeri P2 P-123 ................................................................................................................................................................................ Lactobacillus urinary infection in women in Yazd ardakan, Iran Heydari M.R1, Heydari S2, Derakhshande A3 P-124 ................................................................................................................................................................................ Inhibitory effect of olive oil on Helicobacter pylori infection Rezaei Kallaj S1, Assmar M1, Sharifi Kiasaraie M2, Massiha A1, Akbari Shahabi Sh1

20

P-125 ................................................................................................................................................................................ Antimicrobial resistance of Escherichia coli isolated from human Derakhshandeh A1, Firouzi R1, Motamedifar M2, Heidari S1, Naziri Z1 P-126 ................................................................................................................................................................................ Antibacterial activity of ethanolic extract of Cucurbitaceae Citrulus Colocy this against pathogenic bacteria isolated from Urinary tract infections Rezatofighi S.E, Mirzarazi M, Abolhassan Beygi N, Syyednejad S.M P-127 ................................................................................................................................................................................ Diagnosis of Burdetella pertusis and parapertusis from collecting sample hospitals Qazvin province in 3 times and comparison between them Mojabi H, Dargahi H, Seafollazade E, safavieh M P-128 ................................................................................................................................................................................ Prevalence of adhesion gene rrgA among Streptococcus pneumonia isolated from children under 6 years of age in Tehran by PCR Mousavi S.F1, Abdollahi S1, 2, Siadat S.D1, Shapoury R2, Jalali P3, Nobari S1 P-129 ................................................................................................................................................................................ Microbiological quality evaluation of traditional ice cream in Tehran Golghin SH1, Shojaeian A2, Khorsand I3, Yalfani R4 P-130 ................................................................................................................................................................................ Effect of Thymus vulgaris and Rosmarinus officinalis essential oils on Aeromonas hydrophila and Yesinia ruckeri from rainbow trout farms Mousavi SH, Ghodratnama M, Soltani M P-131 ................................................................................................................................................................................ Actinomyces and Nocardia infections in chronic granulomatous disease Bassiri-Jahromi Sh, Doostkam A P-132 ................................................................................................................................................................................ Bacterial Decontamination of water by Electrical Discharge Plasma Fotovat Eskandari A, Ghomi HR, NavabSafa N, Mirpour Sh P-133 ................................................................................................................................................................................ In-vitro study of antibacterial activity of Vipera latifii venom toward Staphylococcus aureus Moridi KIA A1, Zargan J 1, Goodarzi H-R2, Sobati H1 P-134 ................................................................................................................................................................................ Study of type 4 fimberia in association with genomic island PAPI-1 and biofilm formation in Pseudomonas aeruginosaenvironmental isolates SalimiChirani A1, Dabiri H1, Doostdar F1, Fallah F1, Attaran N2, Ebrahimpourkoumleh M3, Nikookar I3,Goudarzi H1 P-135 ................................................................................................................................................................................ Cytotoxicity of new anti tuberculosis N-aryl-1,4-dihydropyridine-3,5-dicarboxamides on HELA, RAJI, KG-1a and MOUSE LYMPHOCYTE primary Cell lines Hadizadeh F1, Zand Haghighi M2, Ghazvini K2, Derakhshan M2, Meshkat Z2 P-136 ................................................................................................................................................................................ Prevalence of brucellosis in farm animals in southwest of Iran, 2012. Gharib Mombeni E 1, Beladi Mousavi M1, Gharib Mombeini M 2, Kenarkohi M 3 P-137 ................................................................................................................................................................................ Phenotypic detection of MBL producing Acinetobacter baumannii isolates from a teaching hospitals in Shiraz, Iran Nakhzari Moghadam M1, Sedigh ebrahim saraie H1, Mousavi Same M1, Motamedifar M1, 2 B-198 ................................................................................................................................................................................ Spa- typing of Staphylococcus aureus isolated from children with adenoid hypertrophy Yazdanpanah M1, Khoramrooz S.S2 ,Emaneini M3 , Jabalameli F3 , Aligholi M3 P-139 ................................................................................................................................................................................ Study of cell morphology of XDR Mycobacterum tuberculosis isolates grown onhigh dose of ofloxacin Transmission Electron Microscopy Arjomandzadegan M1, Hoseini H1, Sadrnia M.2, Titov LP3

P-140 ................................................................................................................................................................................ The Frequency of CagA EPIYA-C Phosphorylation Sites in H. pylori Isolates among Patients with Upper Gastrointestinal Diseases, Shiraz, Iran, 2013 Haddadi MH1, Bazargani A1, Bagheri Lankarani K2, Moini M2, Emami A1, Khashei R1, Alizadeh M2, Rahimi A2 P-141 ................................................................................................................................................................................ Quantitative evaluation of gut bifidobacteria and its association with type 2 diabetes Nazemi M1, Salehi R2, Amini M3 P-142 ................................................................................................................................................................................

21

Use of native nitrogen source (whey powder) in erythromycin production with microbial fermentation by Saccharopolyspora erythraea Firoozbakht M1, Attar H2 P-143 ................................................................................................................................................................................ Antibacterial effect of 3 different extracts of Rutagraveolens on 8 pathogenic bacteria Ahmadi Jalali Moghadam M1, Honarmand H1, SaeidiniaA2, Falah-DelavarS 2 P-144 ................................................................................................................................................................................ Frequency of legionella pneumophila in tap water of hospitals of Guilan province, Ahmadi Jalali MoghadamM1, 3, Honarmand H1, Asfaram Meshginshahr S2, SoltaniTehraniB1, Nojavan M3 P-145 ................................................................................................................................................................................ Genotyping of Pseudomonas aeruginosa, isolated from pediatric patients with cystic fibrosis and the environment of Hospital Ghazi M1,Goudarzi H1, Khanbabaee Gh2, Fallah F3, Azargashb E4, Goudarzi M1, Mahmoudi Sh5, Shirazi H6 P-146 ................................................................................................................................................................................ Survey of methicillin resistant Staphylococci in veterinary health care personnel Najafifar A, Askari Badouei M, Khaksar E P-147 ................................................................................................................................................................................ Metronidazole and vancomycin resistance in strains of Clostridium difficile isolated from patients with diarrhea Goudarzi M1,2, Goudarzi H2, Alebouyeh M1 , Azimi Rad M1, Ghazi M2, Zali M.R1, Aslani M.1,3, P-148 ................................................................................................................................................................................ Comparison of theSalmonellaisolates from domestic animals and poultry, by ERIC PCR and Antibiotic Resistance Analysis Ghavidel M1, Rad M 1, Seifi H 1, Moradi Bidhendi S 2,Bassami M.R. 1 P-149 ................................................................................................................................................................................ Study on Bacterial Contamination and Antibiogram of Staphylococcus Aureus Isolates from Automated Teller Machines in Shahrekord, central Iran. Moshtaghi H, Parsa M, Dokhtfaraj M P-150 ................................................................................................................................................................................ Identification of capsulation locus in H influenzae b isolates and its relationship to capsular polysaccharide production Mojgani N1, Banabazi M.H2, Khoshnood S1 P-151 ................................................................................................................................................................................ An efficient method for production, isolation and purification of PRP in Haemophilus influenzae type b for scale-up in vaccine production. Mojgani N1, Carbis R2, Khoshnood S1 P-152 ................................................................................................................................................................................ Effect of bacteriocin-producing Lactobacilli isolated from Kerman Local yoghurt on clinical Listeria monocytogenes, Kerman, south eastern Iran Rokhtabnak N1, Khaleghi M1, Farahmand A2 P-153 ................................................................................................................................................................................ The effect of nano-curcumin on Pseudomonas aeruginosa, Staphylococcus aureus and Escherichia coli and skin burn rat model Ghaderi N1, Ansari E1, Esazadeh Kh1, ShoaeHasani A2 P-154 ................................................................................................................................................................................ Evaluation of antibacterial activity of the hydroalcoholic extracts of the stem bark of Juglans regia Linn on methicillin resistant staphyllococcus aureus (MRSA) Moori bakhtiari N1, Jamshidian J2, Khalafi E3 P-155 ................................................................................................................................................................................ Prevalence of Escherichia coli O157:H7 in milk of dairy cattle in Khuzestan, Iran by culture and multiplex PCR Moori bakhtiari N1, Farahmandfar M2 P-156 ................................................................................................................................................................................ Genotypic evaluation of methicillin resistant staphylococcus aureus (MRSA) by PCR Mooribakhtiari N P-157 ................................................................................................................................................................................ Evaluation of genomic island PAPI-1 frequency and Biofilm formation in pseudomonas aeruginosa associated with burncarehospital- Guilan waste-water systems Attaran N1, Goudarzi H2, Dabiri H2, Doustdar F2, Salimi Chirani A2, Ebrahimpour Koumleh M3, Nikookar I3 P-158 ................................................................................................................................................................................ Importance of salmonella in food stuffs Aghakhani N,Ghaemi EA P-159 ................................................................................................................................................................................ Isolation and identification of Acinetobacter baumannii causing ventilator-associated pneumonia from patients admitted in the intensive care unit of a shahid Rajai hospital of Tonekabon

22

Ghaffari H , Ghane M, Poya M , Kouchaki M.R, Porjafari M, Dalir yonesi M P-160 ................................................................................................................................................................................ Distribution of exoU as a potent effector protein of type III secretion system of pseudomonas aeruginosa isolated in hospital associated environmental samples Abdanan Kord Y1, Goudarzi H2, Dabiri H2, Salimi Chirani A2, Monireh Ebrahimpour Koumleh M3, Nikookar I3 P-161 ................................................................................................................................................................................ A/C, B/O and T replicon typing in Urophatogenic Escherichia coli by PCR Esmaeili Z, NazemiA, Mirinargesi M P-162 ................................................................................................................................................................................ Assessment of coagulase gene polymorphisms of Staphylococcus aureus isolated from healthy carriers Rafiei A1, Zarrini G.R2, Mobaien H3 P-163 ................................................................................................................................................................................ 3 month old baby suffering from acute type B botulism due to consumption manna hedysarum NasiriO1,AslaniMM1, Shooraj F1, MasomiASLH2, Shahcheraghi F1 P-164 ................................................................................................................................................................................ Detection of the iss gene among fecal Escherichia coli isolatedfrom human in Shiraz Derakhshandeh A1, Firouzi R1, Motamedifar M3, Bahadori M1, Motamedi A1 P-165 ................................................................................................................................................................................ Isolation of Streptobacillusmoniliformis from the Nasopharynx of referred Rats in Kerman Moghadaszadeh M , Akhtardanesh B, Rohani H, Abbasi SH P-166 ................................................................................................................................................................................ A case of Acinetobacter Baumannii ventriculitis in patient with head trauma HejazianE, Tabari M P-167 ................................................................................................................................................................................ Investigations of antimicrobial activity ofsix extracts from Iranian medicinal plants on plank tonic growth, biofilm formation and biofilm disruption against Staphylococcus aureus Tasallot maraghi E1*, Kashef N1, Gohari A2 P-168 ................................................................................................................................................................................ Detection of Legionella pneumophilain Cooling Water Systems of Hospitals and Nursing Homes as Immunocompromised cases of Kerman City, Iran by Semi-Nested PCR. Ahmadinejad M1, Shakibaie M.R2, Shams K3, Khalili M4 P-169 ................................................................................................................................................................................ Surveying prevention of nosocomial infections among nurses in educational hospitals of Urmia Nader Aghakhani, Samereh Eghtedar, Medine Jasemi, Narges Rahbar P-170 ................................................................................................................................................................................ ESBL mediated resistance in Pseudomonas aeruginosa,Zare Hospital,Sari,Iran Arab N1, Ahanjan M2, Rafie A3 P-171 ................................................................................................................................................................................ Occupational exposure of Shiraz dental students to patients’ blood and body fluid ShaghaghianS1, GolkariA1, PardisS2 P-172 ................................................................................................................................................................................ Nosocomial infection in a radiology department: cassettes and needs for digitizing Abdollahi H1, Izadi A2, Moghadamian M1 P-173 ................................................................................................................................................................................ Mithochondrial cytochrome b gene; a molecular marker for Leishmania characterization and identification of zoonotic cutaneous leishmaniasis in suspected patients in Khuzestan province Ghaemmaghami PS1, 2, Parvizi P1, Spotin A1, 3, Zolfaghari MR2 P-174 ................................................................................................................................................................................ Prevalence of Helicobacter pylori in patients with stomach disorders in Shiraz, Iran Moaddeb A1, Farshad Sh2, Firozi R1, Fattahi M3, Derakhshandeh A1, Amin Shahidi M2 P-175 ................................................................................................................................................................................ Prevalence of multi drug resistant Acinetobacter baumannii in hospitalized patients in Namazi hospital, Shiraz Ghasemi H, Tahmasebi H P-176 ................................................................................................................................................................................ Prevalence of Taenia saginata (parasitic zoonoses) in cow carcasses in masjed-soleymsn slaughter house, southern Iran Soleymani P, Taghavi Moghadam A, Kavosh F, Ghaemmaghami Sh P-177 ................................................................................................................................................................................ An investigation of camel pox outbreaks in two provinces of Iran Esmaeili H P-178 ................................................................................................................................................................................ Occurrence of Aeromonas spp in random fish, shrimp and meat samples Shiraz, Iran

23

Hadi N1, Mahmoodi Zh2, Emami A3 P-179 ................................................................................................................................................................................ Detection of Yersinia and Salmonella spp. in apparently healthy cats and dogs in Tehran, Iran Hashemi Sh, Mahzounieh M, Ghorbani M P-180 ................................................................................................................................................................................ Study of the epidemiological aspects of Pedicolusisor potential vectors of Epidemic typhus in Shoushtar district (Khouzestan province) during 2008-2012 Kangari Sh1, Behbehani A2 P-181 ................................................................................................................................................................................ Demodicosis prevalence among the Persian squirrel in Shahrekord Karimi Ghahfarrokhi E1, Akbarian A1 P-182 ................................................................................................................................................................................ Optimization ofPCRwithdifferentprimersfor the detection ofBrucella fromsera withDNAisolation usingtheboiling method Zamanian M, Hashemi Tabar GR, Rad M, Haghparast A P-183 ................................................................................................................................................................................ Molecular and phylogenic analysis of gene encoding protein F of Newcastle virus isolated from migratory birds Bushehr, southern Iran Nazari MB1,Mehrabanpour MJ2,Rahimian A2,Khoobyar S3 P-184 ................................................................................................................................................................................ Study of soil parasite in public parks of southern Fars province Zareie M1, Oliaee A2 P-185 ................................................................................................................................................................................ A Study on the rodents, fauna and the ZCL reservoir host in Zarqan County, Fars Province, Iran, 2012 Azizi K 1, Amin M1, Kalantari M 2, Dabaghmanesh T 1, Najafi ME 3. P-186 ................................................................................................................................................................................ Epidemiologic status of the patients with Crimean Congo Hemorrhagic Fever and its associated risk factors Badee Nezhad A1,Keshavrz Lohrasb2, Shahijani AM2, Keshavrz Vaez Zadeh L2 P-187 ................................................................................................................................................................................ Clinical manifestations, laboratory findings and therapeutic regimen in childhood brucellosis in Children Medical Center during 2002 to 2010 Pourakbari B1,Fanni F2, Mahmoudi Sh1, Shahbaznejad L1, 2, Mamishi S1, 2 P-189 ................................................................................................................................................................................ A Case of avian chlamydiosis In African Gray Parrot HadadmarandiMR1, MadaniSA 2, Shayegh H 3 P-190 ................................................................................................................................................................................ Characterization of Escherichia coli strains isolated from chickens with colisepticemia in Tabriz, Iran Nofouzi K1, Yarizadeh Sh2, Rezayi D2, Farsad Akhtar N3, Tahapour K1, Amini E1, Yusefi K1 P-191 ................................................................................................................................................................................ Detection of Mycobacterium from fresh water ornamental fishes by culture and molecular methods Akbari Sh1,2, Mosavari N2, Mohammad Taheri M2, Shakibamehr N2 P-192 ................................................................................................................................................................................ Probability of Mycobacterium bovis infections in suspected results of PPD test in Kermanshah suburb Solgi M1, Nikousefat Z1, Javdani M1, Haratian A2 P-193 ................................................................................................................................................................................ Comparison of histopathological lesion caused by strain of Burkholderia mallei isolated from tiger and production strain in experimental infection of guinea pig. Eslampanah M, Hablolvarid M.H, Mosavari N, P-194 ................................................................................................................................................................................ Methicillin-resistant Staphylococcus aureus among food animals and Slaughterhouse staff Shabani M1, Kavous S1, Akbar K2, Ryhaneh R2, saadat S3 P-195 ................................................................................................................................................................................ Comparison of Serological testsiELISA with Rose Bengalfor the Detection of Brucellosis AhuranM1, Hashemitabar GhR1, Saadat S2, Mardaneh J3 P-196 ................................................................................................................................................................................ EpidemiologyofCutaneous leishmaniasis (CL) inareascovered by thehealthcenter No. 2 of Isfahan from1386 to 1391 Ahmadian M , Talaei M, Hosseinzadeh M , Nejati H P-197 ................................................................................................................................................................................ Subtyping of Salmonella isolates by molecular method of Pulsed Field Gel Electrophoresis Golab N 1, Khaki P 2, Norbakhsh F 1 P-198 ................................................................................................................................................................................

24

Exposure to Alternaria alternata in Karun’s Riverside Parks, a New Threat for Asthmatic Patients in Ahvaz Osdaghi E. P-199 ................................................................................................................................................................................ Comparison between phenotypic characterization and semi-nested PCR for the identification of Candida Species in clinical isolates Sadeghi-Nejad B1, Samarbaf-Zadeh A.R2, Salehi Z3 P-200 ................................................................................................................................................................................ The importance of fungal sinusitis in diabetic patients Sadeghinejad B1, Nikakglagh S 2 P-201 ................................................................................................................................................................................ Occurrence of Ochratoxin A and Aflatoxin M1 in human breast milk in Sari, Iran Afshar P1, Shokrzadeh M2, Kalhori Sh1 P-202 ................................................................................................................................................................................ Comparison of antifungal effects of Althaea officinalisand Syzygium aromaticum aqueous extracts Sadeghi dehsahraiiH1, Habibian S, Ebrahimi A3 P-203 ................................................................................................................................................................................ Inhibitory effects of aqueous and etanolic Allium Jesdianum extracts on growth of Trichophyton mentagrophytes Nasiri Z1, Madani M1, Shahani poor K1 P-204 Onychomycosis Due to Fusarium sp. in Patients with squamous cell Carcinoma Hadizadeh S1, AyatollahiMousavi SA1, Esfandiarpour I2, SalariS1, Shokri H3 P-205 ................................................................................................................................................................................ Effect of silver nanoparticles on the growth of Aspergillus parasiticus and aflatoxin B2 production Pourtalebi S¹, Ayatollahi Mousavi S.A¹ P-206 ................................................................................................................................................................................ Identification of Candida Species isolated from oral colonization in Iranian HIV-positive patients, by PCR-RFLP method Ayatollahi Mousavi SA1, Salari S1, Rezaie S2, Hadizadeh S1 P-207 ................................................................................................................................................................................ Evaluation of airborne fungal elements in intensive care units (ICU , N.I.C.U, Operating rooms and transplant unit) in Hamedan Hospitals in 2012 Abolfathi R1, Ebrahimian Sh 2, JavadNasiri Kashani M 3, Zainii F4 P-208 ................................................................................................................................................................................ A case report of disseminated nocardiosis caused by Nocardiabrasiliensis. Gerami Shoar M1, Mardani M2, Badali H3, Khodavaisy S1, 4 P-209 ................................................................................................................................................................................ Bacterial agents and antibiogram on clinical samples in patients in shahid Beheshti hospital in Babol 1391 year Amooghli Tabari M P-210 ................................................................................................................................................................................ Mucormycosis Presenting as Acute Otitis Media Mamani M1, Hashemi SH1, Torkaman Asadi F1 P-211 ................................................................................................................................................................................ Fungal Contamination of Wheat Flour in High Risk Area of Esophageal Cancer, Golestan Province Ghasemi-Kebria F1, 2, Joshaghani H1, Taheri N.S1, Semnani SH1, Roshandel GH1. P-212 ................................................................................................................................................................................ Mucormycosis; Clinical Manifestation, Diagnosis and Management AbbasiF¹, Mardani M², Yadegarynia D ², Aghahasani M ², GholaminSH² P-213 Prevalence of Superficial and Cutaneous Mycoses among Student Residents in Semnan University of Medical Sciences Dormitory in 2011 Tabasi M1, Eskandarion M.R 2, Amrollahi H P-214 ................................................................................................................................................................................ In vitro Antifungal Activity of Essential Oil from Pimpinella anisum L. and Comparison with Synthetic anethole on Aspergillus flavus Moghtader M1,Farahmand A1 P-215 ................................................................................................................................................................................ Essential oil composition and antifungal effect of Achillea nobilis L. on the growth of Aspergillus flavus Moghtader M1, SalariH2 P-216 ................................................................................................................................................................................ Identification of Candida Species isolated from women with vaginal candidiasis admitted to gynecology clinics Tehran, Iran, by PCR-RFLP Method

25

Roudbary M1, Roudbarmohammadi Sh1, Bakhshi B2, Farhadi Z3, Nikoomanesh F1 P-217 ................................................................................................................................................................................ Isolation of Cryptococcus gattii from Eucalyptus trees in Shiraz Pakshir K1, 2, Mahmoodi M2, Zomorodian K1, 2, Gharavi A1, Fakhim H2 P-218 ................................................................................................................................................................................ Aspergillosis as fungal brain granuloma in an immunocompetent patient Azarpira N1, 2, Yazdanpanah Sh1, Safarian A3 P-219 ................................................................................................................................................................................ Mycetoma caused by Exophiala jeanselmei. A case report Khodavaisy S1, Badali H2, DE Hoog GS3

P-220 ................................................................................................................................................................................ Isolation of Cryptococcus species from pigeon dropping in Shiraz Pakshir K 1,2, Fakhim H 2, Zomorodian K 1,2, Gharavi A 1, Mahmoodi M2 P-221 ................................................................................................................................................................................ Comparison of antifungal effects of Althaea officinalisand Syzygium aromaticum aqueous extracts Sadeghi-Dehsahraii H1, Habibian-Dehkordi S2, Ebrahimi-Kahrisangi A3 P-222 ................................................................................................................................................................................ Environmental study of azole-resistant Aspergillus fumigatuswith TR34/L98H mutations in the cyp51A gene in Iran Badali H1, Mousavi B, Vaezi A P-223 ................................................................................................................................................................................ Evaluating the adherence of clinical isolates of Candida albicans and Candida glabrata in comparison with standard isolates on vagina and intestine cell lines. Hasanpour Z1, Bayat M2, Roudbarmohammadi SH3, Roudbary M3 P-224 ................................................................................................................................................................................ Antifungal effect of dry and Caspian regions Fig leaves extract on Candida albicans in lab BabakhaniB 1, Sefidgar A 2, Jafarnejad Moziraji Z 1 P-225 ................................................................................................................................................................................ In vitro study on antifungal effects of Thymus vulgaris (thym), Rhus coriria (sumac) and Allium sativum (garlic) Firouzi R1, Derakhshandeh A1, Jafari kamangar S2, Ranjbar kohan N2, Afsar M2, Mootabi Alavi 2 P-226 ................................................................................................................................................................................ Skin wound healing activity in Aspergillus flavus infected wound of methanoli Extract Protoparmeliopsis muralis in wistar rats Rashki S1, Valadbeigi T2 P-227 ................................................................................................................................................................................ Fungal infection and increased mortality in patients with chronic granulomatous disease Bassiri-Jahromi Sh¹, Doostkam A² P-228 ................................................................................................................................................................................ Species delineation of Aspergillus species as increasing causative agents of onychomycosis Nouripour_sisakht S1, Mirhendi H1,Ahmadi B1, Shidfar M1, Grami-shoar M1,Hosienpur L1, zareiFJalali-zand N1 P-229 ................................................................................................................................................................................ Study of pistachio contamination, the aflatoxin-producing fungus in the city of Damghan MomeniT1, Ajoudani far H2, Hashmi moghadamH3 P-230 ................................................................................................................................................................................ In vitro antifungal activity of Commmunis L.ssp hemisphaerica Juniperus on different candida species Fakheri T1, Katiraee F2, Mahmoudi R3, Valizadeh S1 P-231 ................................................................................................................................................................................ In-Vitro Inhibitory Effect of Scrophularia striata Methanolic Extracton Candida spp. Ahmadi M ¹‚ Madani M ² ‚ Mohammadi sichani M ³ P-232 ................................................................................................................................................................................ Endocarditis due to a co-infection of Candida albicans and Candida tropicalis in a drug abuser Nabili M1,2, Hashemi Fesharaki S.H1,Haghani I1, Laal Kargar M1, Jacques F. Meis3,4, Badali H1 P-233 ................................................................................................................................................................................ Study of fungus frequency causes of dermatophytosisin wrestling andbody building halls of, Chaloos, northern Iran, 2012 ............................................................................................................................................................................. Kouchaki M.R1, Dalir yonesi M1, porjafari M1, Ghaffari H1, Mohammad ghayyomi jaze P-234 ................................................................................................................................................................................ Inhibitory Effect of Vitamin C on Aspergillus parasiticus Growth and Aflatoxin Gene Expression Akbari M1,Moazeni M1, Rezaie S1, 2 P-235 ................................................................................................................................................................................

26

Extracellular Production of Silver Nan particles Using Three Common Species of Dermatophytes: Trichophyton rubrum, Trichophyton mentagrophytes and Microsporum canis Moazeni M1, Rashidi N2, Shahverdi A.R3, Noorbakhsh F4, Rezaie S1 P-236 ................................................................................................................................................................................ Evaluation of in vitro antifungal susceptibility testing of clinical Candida species by use of E- test method Aslani N, Mousavi B, Badali H P-237 ................................................................................................................................................................................ The Study of Heterotrophic and Crude Oil Utilizing Fungi Abundance from Khuzestan Oil Regions with Different Oil Contaminations Dawoodi V, Golshani Z P-238 ................................................................................................................................................................................ Evaluation and comparison of soil fungi ability in biodegradation of crude oil from Ahvaz and Haftkel oil regions Dawoodi V, Golshani Z P-239 ................................................................................................................................................................................ Dramatic response to potassium Iodide in a child with Basidiobolus ranarum involving multiorgan Pouladfar GhR, Nasimfar A, Jafarpour Z

P-240 ................................................................................................................................................................................ Prevalence of mucocutaneous Candida colonization in immunocompromised patients Badiee P, Jafarian H, Jafarpour Z P-241 ................................................................................................................................................................................ Invasive Candidiasis in pediatric patients with hematologic malignancies Hashemizadeh Z, Badiee P P-242 ................................................................................................................................................................................ Development and evaluation of immuno chromatographic test strip for rapid detection of salmonella typhimurium in milk .................................................................................................................................................................................. Allahyari H, Ghassemi S, Validi M P-243 ................................................................................................................................................................................ Survey of yeast phagocytosis by neutrophils treated with rat mesenchymal stem cells supernatant Delirezh N, Hammoun navard S P-244 ................................................................................................................................................................................ Development of Lymphocyte Proliferation Method for Study on Cell-Immunity Following Rubella Infection Jafari E1 , Mohammadi A2 , Arabzadeh AM1 , Esna-Ashari F2 , Sedigh ZA2 , Jahani F2 , Shahbazi R2 , Taleb-Shoshtari M2 , Sheikh-Mohammadi N2 , Najafi A2 , Sadeghi V2 , Pourabdollahi M2. P-245 ................................................................................................................................................................................ HBV viral load in HIV/HBV patients: The impact of HIV-coninfection on plasma HBV-DNA load in patients with chronic HBV infection KhoubyariM1, BaharlouR2, Ahmadi A2 P-246 ................................................................................................................................................................................ Association of the costimulatory molecule gene (CTLA-4, CD82, PD-1 and ICOS) polymorphisms with CMV and HCV infections in kidney transplant patients Niknam A, Karimi MH, Yaghobi R, Iravani Saadi M, Geramizadeh B P-247 ................................................................................................................................................................................ Anti-inflammatory, antioxidative capacity and interactive antimicrobial activity of Hypericum perforatum essential oils Abtahi Froushani SM 1, Khamisabadi M 2, Lotfallahzadehbarzili B 2 P-248 ................................................................................................................................................................................ MICA*008 Allele: A genetic predisposition for resistance against Chlamydia trachomatis infection Moazenchi M.1, Totonchi M.1, Salman Yazdi R.2, Asadpor U.1, Mohseni Meybodi MA.3, Ahmadipanah M.1,Hoseinifar H.1,Sadighi Gilani MA.2,Gourabi H.1, Mohseni Meybodi A.1 P-249 ................................................................................................................................................................................ Frequency of anti toxocara antibodies in schoolchildren with chronic cough and eosinophilia in rural area of the Shiraz, Iran in 2011 and 2012. Ghorbani ranjbary A 1, Varzandian S2 P-250 ................................................................................................................................................................................ Effect of rat mesenchymal stem cells on yeast phagocytosis by neutrophils HammounnavardS, Delirezh N P-251 ................................................................................................................................................................................ Serum procalcitonin level and other biological markers in children with bacterial or aseptic meningitis Sherkatolabbasieh HR1, Zare M.E2, 3,Nasir Kansestani A2, 3,Mahruei A3,4shafiezadeh Sh5, Mohsenzadeh A1, Taee N 1 P-252 ................................................................................................................................................................................

27

Prevalence of Yersinia Yop-specific IgA antibodies in Iranian healthy blood donors and association of seropositivity with related blood culture Dabir MoggadamA ,Timori NaghadehH P-253 ................................................................................................................................................................................ The association of interleukin-13 gene polymorphism with kala-azar patients Moazamian E1, Rasouli M2, Asaei S2 P-254 ................................................................................................................................................................................ Single chain antibodies to glycoprotein 55 of human cytomegalovirus for treatment or diagnosis Moazen B1, 2, Ebrahimi E1, 2 P-255 ................................................................................................................................................................................ Investigation of the role of different types of donors with the IL-17, IL-21, and IL-23R polymorphisms in liver transplant recipients Hejr S1, Karimi M.H2, Kamali-Sarvestani E3, Yaghobi R2, Geramizadeh B2, Nikeghbalian S2, Malek-Hosseini S.A2 P-256 ................................................................................................................................................................................ Optimization of in vitro Immune Response between Specific anti Helicobacter pylori antibodies produced in rabbits and H pylori conserved antigens Zahednamazi F, Falsafi T P-257 ................................................................................................................................................................................ Immunomodulating and protective effects of cyclophosphamide on the mice infected with Candida albicans Anvarinejad M1, Japoni A1, Mehrabani D2, Dehyadegari MA1 P-258 ................................................................................................................................................................................ The effects of Honey on the release of cytokines from macrophage Moazen B1,Nejatollahi F2 P-259 ................................................................................................................................................................................ Antimicrobial susceptibility pattern of Escherichia coli isolated from patients referred to hospitals in Isfahan, center of Iran Sharifzadeh A1, Salehi M2 P-260 ................................................................................................................................................................................ Study on causal Correlation of Epstein Barr virus infection with multiple sclerosis in northern Iran Honarmand H1, Ahmadi Jalali Moghadam M2, Hatamian H3, Roudbary A3 P-261 ................................................................................................................................................................................ Helicobacter pylori infection as a potential protective factor against classic multiple sclerosis in northern Iran Ahmadi Jalali Moghadam M1, Honarmand H2, Hatamian H3, Roudbary A3 P-262 ................................................................................................................................................................................ Study of the Relationships between polymorphisms of the costimulatory genes: CTLA-4, PD-1, CD28, and ICOS with CMV, HBV and HCV infection in Allogenic and Autologous recipients of bone marrow IravaniSaadi MY, Yaghobi R, Karimi MH, Niknam A,Geramizadeh B P-263 ................................................................................................................................................................................ Anti-inflammatory, antioxidative capacity and interactive antimicrobial activity of Hypericum perforatum essential oils Abtahi Froushani S.M 1, Khamisabadi M2, Lotfallahzadehbarzili B2 P-264 ................................................................................................................................................................................ Production of a fusion protein as a candidate vaccine against two bacterial toxins FatiNajafi M1, Shaban M2 , Bahreyni M3 , GordNoshahri N3 P-265 ................................................................................................................................................................................ Identification of antigenic regions by using bioinformatics and molecular biology methods Fathi Nagafi M1, Gord Noshahri N 2, Makhdoumi-Kakhki A2, Shaban M2 P-266 ................................................................................................................................................................................ Frequency of Cutaneous Leishmaniasis in Shush (Khuzestan Province, southern Iran) in the year 2010-2012 BuhamdanyI1, Behbahani A2 P-267 ................................................................................................................................................................................ A Scientometric Analysis of Research on amebiasis in Iran Motazedian H, Armand B, Sedaghat B, Norouzi Y P-268 ................................................................................................................................................................................ Seroprevalence of canine visceral leishmaniasis in southeast Iran Akhtardanesh B1 ,Mostafavi M 2,Sharifi I B 2,Mahmoodi T 1 P-269 ................................................................................................................................................................................ Incidence of head lice infestation in Marand city elementary school students during 1390 and 1391 Sodaei Zenoozagh H, Mahmoodi A , Jeddi A, Aslrahimi V, Barani A P-270 ................................................................................................................................................................................ Camel trypanosomosis (surra) in some provinces of Iran Esmaeili H

28

P-271 ................................................................................................................................................................................ Evaluating the effects of Blueberry extract on Trichomonas vaginalis in vitro Baharvandi Z1, Sadraei J 2 P-272 ................................................................................................................................................................................ Therapeutic effect of methalonic Pomegrante (punica grinatum L.) extract on Leishmania Major lesions in Balb/C mice VS Glucantim Abedi S, rezayatmand Z, karimian N, Izadi Sh P-273 ................................................................................................................................................................................ The parasitic contamination of raw vegetables consumed in Zahedan, Iran Ebrahimzadeh A1, Jamshidi A1, Mohammadi S1 P-274 ................................................................................................................................................................................ Seroprevalence of Toxoplasmosis among pregnant women referred to the reference laboratory of Zahedan, Iran Ebrahimzadeh A1, Mohammadi S2, Salimi Khorashad A1, Jamshidi A1 P-275 ................................................................................................................................................................................ Epidemiological study of Hydatidosis in Human and Livestock population of Lorestan (1386-1390) Rezaei F1, Shahrokhi SR2, Mehdiabadi R2, Karamian A2, MGhanimatdan M2, Kordestani H2, Baharan O2 P-276 ................................................................................................................................................................................ A survey on Lymnaea stagnalissnails infection to trematoda larval of Shahrekord city springs, central Iran Rivaz Sh1, Karimi Ghr1, Nasiri V1, Azizi Hr2, Pirali Kh2, Abdi goudarzi M1, Paykari H1, Motamedi Ghr1 P-277 ................................................................................................................................................................................ Study on some epidemiological parameters of the referrals with cutaneous Leishmaniasis to Ramshir health center (Khuzestan province, southern Iran) during 2010-2012 Badri S1, Behbahani A2 P-278 ................................................................................................................................................................................ Report of cutaneous leishmaniasis in patients admitted to the Sina hospital - Tabriz during 2011-2013 Nemati Haravan Ti ،Fatollahzadeh M،Aboualsoltani N، mahami Oskoui M

P-279 ................................................................................................................................................................................ Identification of Phlebotomine sand flies based on morphological characters and preparation of microscopic slides in Beiza district, southern Iran Azizi K 1, Badzohre A 2 P-280 ................................................................................................................................................................................ Prevalence of Cryptosporidium spp. in children with diarrhea, hospitalized in Kerman Afzalipour Hospital Hosseininasab A 1, Zia-Ali A 2, Zia-Ali N 3, Farahmandinia Z 4 P-281 Effects of Saturejakhuzestanica Essential Oil on Leishmaniainfantum in vitro Sadeghi SH¹, Asmar M1, Farahmand M2, Rabie A1 P-282 ................................................................................................................................................................................ Prevalence of Toxocara Spp. eggs in Public Parks in Shiraz and rural area of Shiraz, Iran 2012. Ghorbani ranjbary A1, Ghorbani ranjbary N1, 2, Ghorbani ranjbary Z2 P -283 ............................................................................................................................................................................... Evaluation of frequency of Giardia Lambilia sub species by PCR-RFLP in hospitalized children, stool specimens in Urmia Mutahhari hospital Manafi Gh، Hazrati tappeh Kh,Asgharzadeh M P-284 ................................................................................................................................................................................ Identification and Genetic Variation of Fasciola Species from Tabriz, NorthWestern Iran Shahbazi A1 , Hamidi F2 , Ghabouli Mehrabani N2 , Akbari Moghaddam M2 , Izadi Sh3 , Ghazanchaii A2 , Jalali N3 , Bazmani A1 P-285 ................................................................................................................................................................................ Consideration of intestinal parasite in day-care centre children in karaj city, Iran, 2012 Hajialiani F, Tahvildar Biderouni F, Abadi A, Einipour S ............................................................................................. P-286 ................................................................................................................................................................................ Prevalence of Enterobius vermicularis among Preschool Children in Karaj providence in 2012 Hajialiani F, TahvildarBidrouni F , Abadi A, Einipour S P-287 ................................................................................................................................................................................ Occurrence of Acanthamoeba spp. in cancer patients undergoing chemotherapy in Tehran, Iran Memari F, Niyyati M , Haghighi A, Lasjerdi,ZaynabJoneydi Z, Mafi M P-288 ................................................................................................................................................................................ Hematological parameters in patients admitted with malaria in Nemazee hospital Bodaghkhan F,1 Ramzi M,2 vazirian SR,3 Fakhraee F1

29

P-289 ................................................................................................................................................................................ Determining seroprevelence of Toxoplasma gondii in girls referred to counseling centers before marriage in the city of Yasouj in the year 1391 Ghorbani A1 , Hadi Niya A2 , Khatayi Gh3 , Mohammadi R4 , Malekzadeh J4 , Gorjipour K5 , Moshfe AA6 , Keshtkari A7 P-290 ................................................................................................................................................................................ Temporal changes and mapping Leishmaniasis in military units of I.R.I.Army Barati M, Salahi-Moghaddam A, Dabbagh Moghaddam A, Khoshdel A.R, Hosseini Shokouh, S. J, Totonchian M. P-291 ................................................................................................................................................................................ CutaneousLeishmaniasis in thereferrals to the West Health Center of the city of Ahvaz, (Khuzestan province, southern Iran) in the year 2012 salamat zadeh M1, Behbahani A2 , Shams Soulary S3 P-292 ................................................................................................................................................................................ A retrospective study on the Cutaneous Leishmaniasis in the referred patients to the health centre of the city of Masjed Soleyman (Khuzestan Province, southern Iran) in the years2011 and 2012 ShahbaziSaife Abad M1, Behbahani A2, Javadi N3 P-293 ................................................................................................................................................................................ Seroprevalence of toxoplasmosis in mentally retarded patients in Iranian rehabilitation centers Ezatpour B1 , Zibaie M2 , Rahmati H 3, Pournia Y4 , Azami M 5, Ebrahimzadeh F6, Azadpour M1, Jamshidian Ghalesefidi M7 P-294 ................................................................................................................................................................................ Report of a heavy infestation by ticks from hedgehog (Hemiechinus auritus) with paralysis symptoms from NagafAbad, central Iran Pirali-Kheirabadi kh1, Salimi, M2 , Rashid-Zadeh H2 P-295 ................................................................................................................................................................................ Seroprevalence of Toxoplasmosis in women’s in Marand area, Iran A.Bahadori A 1 , Esmaeillu M 2 ,Attarhosseani M 3 , Bahadori F 4 , Hossein pourfeizi Z 5 , Soroush MH 6 , Hasanfamian M7 P-296 ................................................................................................................................................................................ Morphological characterization and determination complete sequence of ITS2 region of Ostertagia occidantalis in sheep and goat isolate in Iran Saboor- darbandi, M1, Meshgi, B2, Jalousian, F2 P-297 ................................................................................................................................................................................ Epidemiology of Hydatid cyst in East Azerbaijan province during 2009-2011 Ghabouli Mehrabani N1, kousha A2, Hamidi F1, khalili M1, Mohammadzadeh M 2, alizadeh S2 P-298 ................................................................................................................................................................................ Study of Sarcocyst infection in beef in Amol Slaughterhouses by Digestion method (J P Dubbey 1980). Vahedi Nouri N P-299 ................................................................................................................................................................................ Infection with the nymphal stage of the Linguatula serrata in Lymph node of goat in Amol Slaughterhouses, northern Iran. Vahedi Nouri N P-300 ................................................................................................................................................................................ Comparative Inhibitory effects of Artemether And Sulfadiazine Inhibitors on intracellular Toxoplasma gondii replication in vitro MikaeilooH1, Ghaffarifar1F, Dalimi Asl1A P-301 ................................................................................................................................................................................ Prevalence of Enterobiasis among 5-7 year pupils in Tabriz kindergartens, northern Iran, in 2013. Bazmani A, Bafandeh M, Rahnema V, Aghaei E, Rezaeian R, Amiri M, Molana M.S. P-302 ................................................................................................................................................................................ Molecular cloning of Fusion of GP96 and Leishmania infantum Kinetoplastid membrane protein 11 in pEGFP-N1 expression vector as a DNA vaccine candidate against visceral Leishmaniasis Nasiri V1, Dalimi A.H1, Ghafarifar F1, Bolhassani A2 P-303 ................................................................................................................................................................................ Cloning of Leishmania infantum KMP-11 - GP96 Fusion in plexsy-neo vector for use in Leishmania tarentolae as a live recombinant vaccine against visceral Leishmaniasis Nasiri V1, Dalimi A.H1, Ghafarifar F1, Bolhassani A2 P-304................................................................................................................................................................................. Standard preparation Leishmania with design and development of Real Time PCR method for monitoring and diagnosis of parasite quantification Fekri Soofiabadi M1 , Dabiri Sh2, Fotouhi Ardakani R3, Amirpour Rostami S4, sharifi I5 P-305 ................................................................................................................................................................................ Codon Optimization of L3Nie.o1gene from Strongyloidesstercoralisin order to increase its expression level in recombinant E.coli

30

Ramtin M1, Mohsenpour M2 P-306 ................................................................................................................................................................................ Operated hydatidisis cases in Emam Reza general hospital, Tabriz, northern Iran, in 2011-2012 Hajizadeh M1, Mir najde gerami S2, bayaz B3, Poor Asghari B3, Nemati T 1 P-307 ................................................................................................................................................................................ Prevalence of intestinal parasites in patients referred to Sina Hospital – Tabriz during 2010-2013 Fatollahzadeh M، Nemati Haravani T،Mahami Oskoui M، Aboualsoltani N P-308 ................................................................................................................................................................................ Epidemiology of head lice (pediculosis) attending health centers in Ilam province in2010-2012 Azizi K1, Ebrahimi M2, Neydavoodi M3, Darabi M4, Jalilian A5 P-309 ................................................................................................................................................................................ Seroepidemiological study of human hydatidosisusing ELISA in Arak- Markazi Province in 2012 Asgari M1,Mohebi M 1,2, Kia E 1,2, Farahnak A 1, Aryaeipour M1, Asadian S1, Rokini M.B1,2 P-310 ................................................................................................................................................................................ Hydatidosis in Slaughtered Animals in Isfahan, central part of Iran Azami M1, Anvarinejad M1, Ezatpour B2, Alirezaei M3 P-311 ................................................................................................................................................................................ Evaluation of CoproAg ELISA assay for the diagnosis of Echinococcosis Aghaie S, Hoseini SH, Jalousian F P-312 .................................................................................................................................................................................................................. Seroprevalence of Human Fascioliasis in Meshkin-Shahr District, Ardabil Province, Northwestern Iran in 2012 Asadian S1, Asghari M1, Mohebali M1,2, Mahmoudi M3, Eshrat Beigom Kia E1,2, Mojgan Aryaeipour M1, Bagher Rokni M1,2 P-313 ................................................................................................................................................................................ Sequencing and Detection of Leishmania major in Phlebotomine sandflies, vectors of Cutaneous Leishmaniasisamong human, Khuzestan province, southern Iran Taslimian R1, 2, Parvizi P1, Esmaeili A.H3 P-314 ................................................................................................................................................................................ Genetic diversity comparison of Trichomonas vaginalis clinical isolates by PCR–RFLP of the actin gene in southern Iran TavakoliR, Babaei Z, Ziaali N P-315 ................................................................................................................................................................................ Metabolomics based investigation on metacyclogenesis of Leishmania majorFriedlin strain Ghorbani HR , Arjmand M, Khalili GH , Najafi A , Hajhoseini R , Akbari Z , Zangeneh Z ,Zamnai Z P-316 ................................................................................................................................................................................ Prevalence of Giardia lamblia people referred to the clinic laboratory of Khan zenyan city, Fars, southern Iran Foroodi, H.R1, Malekpur, H1, Najafi, M2, Rezaei, A.A3

P-317 ................................................................................................................................................................................ In vitro Anti cystic activity of Peel of Punic Granatume extracts against Giardia lamblia Saleh R1,Malekpur H1, Foroodi H.R1, Kowsari N1, Nuri S2 P-318 ................................................................................................................................................................................ A Survey on rate of Infection caused by LiverHelminthes and EconomicLosses in Sheep Slaughtered in Lordegandistrict, central Iran Sadeghi-dehsahraiiH1, Pirali-kheirabadi Kh2 P-319 ................................................................................................................................................................................ Cytochorom b and Elongation factor -1α, two molecular markers for identification and typing of proven and potential vectors of Zoonotic cutaneous leishmaniasis Ebrahimi S1, 2, Parvizi P1, Belgheiszadeh H3 P-320 ................................................................................................................................................................................ A Survey of Prevalence Intestinal Protozoan Infections among Gastroentritis Patients Referred to Emam Khomeini Hospital During one year(1391) in Saghez(kurdistan province), western Iran Zangiband P1, Sedighi P2, Mohammadi M2 , Hosseini H2 P-321 ............................................................................................................................................................................... Effect of Nigella sativa and Satureiahortensis essential oils on promastigot form of Leishmania major Pirali Kheirabadi K, Dehghani Samani A, Milad Adel P-322 ................................................................................................................................................................................ Seroprevalence of canine visceral leishmaniasis in southeast of Iran Akhtardanesh B1,Mostafavi M 2,Sharifi I B 2,Mahmoodi T1 P-323 ................................................................................................................................................................................ Incidence of head lice infestation in Marand city elementary school students during 1390 and 1391 Sodaei Zenoozagh H , Mahmoodi A , Jeddi A, Aslrahimi V, Barani A

31

P-324 ................................................................................................................................................................................ Comparison of two combinations of aluminum and Nanoadjvant PMMA with DNA vaccine containing the gene of Toxoplasma gondii SAG3 to assess immunogenicity and survival against Toxoplasma infection in an animal model Sobati H1, Dalimi A2, Kazami B3,Ghaffarifar F2 P-325 ................................................................................................................................................................................ Stress tolerance responses of silver carp (Hypophthalmichthys molitrix) larvae to some potential probiotics isolated from beluga (Huso huso) Khosravi Katuli Kh1, Jafarian H2, Abdollahi D2, Tavana S2, Heidarieh M3, Sheikhzadeh4, Hassan Heidarieh N5 P-326 ................................................................................................................................................................................ Trichomonas vaginalis in Referal patients to gynocologic clinic In Kowsar hospital of Qazvin city, central Iran Rezaee M, Mosavian F , Mohamadzade OM ,Elhamkia M,mojabi H P-327 ................................................................................................................................................................................ Prevalence and pathological description of heavy infestation by Echinococcus granulosus larvae in sheep and goats Farjani Kish GH1, Mohammadi Nejad S1, Mootabi Alavi A2 P-328 ................................................................................................................................................................................ The possible association between Schistosoma parasitic ova and mesenteric ischaemia after cardiac surgery Behbahani A1, Datta S1, Behbahani A2 P-329 ................................................................................................................................................................................ Geneticdiversity of RPOIILS genefrom Leishmania major Eslami G, Salehi R,Khosravi Sh P-330 ................................................................................................................................................................................ Effective geographical and population factors in occurrence of visceral leishmaniasis (VL) in endemic foci in Fars province, southern Iran Ghatee MA1, Haghdoost AA 2, Sharifi I3, Taabody Z3, Zahra Kanannejad Z4, Hatam Gh5, Abdollahipanah A6 P-331 ................................................................................................................................................................................ Prevalence of intestinal parasite in the patients referred to the Imam Jafar sadegh hospital in Hashtgerd in the year 2012-2013 Karimazar M., Atashbaste M., SoleimanFallah M., Soltani A., Keshavarz M.,Najjari M., Bahrami A.,jabbari M. P-332 ................................................................................................................................................................................ Hydatid cyst formation in rats Moazeni M, MotabiAlavi A, Shayegh H P-333 ................................................................................................................................................................................ Nosodemiological attributes of Kala-Azar disease among hospitalized children in Firuzabad, Fars province, southern Iran,during 2004-2012 Shahriari-Namadi M, Moemenbellah-Fard MD P-334 ................................................................................................................................................................................ Potentially pathogenic free living amoebae isolated from swimming pools Mafi M, Niyyat M, Haghighi A, Salehi N, Lasjerdi Z P-335 ................................................................................................................................................................................ Contamination of recreational water sources to Acanthamoeba spp. in Tehran, Iran Mafi M, Niyyati M, Haghighi A, Lasjerdi Z, Salehi N

P-336 ................................................................................................................................................................................ Frequency of Cutaneous Leishmaniasis in the city of Abadan (Khuzestan Province, southern Iran) in the years 2011 and 2012 Moradidasht Gh1 , Behbahani A2 P-337 ................................................................................................................................................................................ Epidemiologic study of Cutaneous Leishmaniasis in the county of Dashti (Bushehr Province, southern Iran) in the years 2010 and 2011 Behbahani A1 , Moghateli M2 P-338 ................................................................................................................................................................................ Frequency of Cutaneous Leishmaniasis in the county of Shadegan (Khuzestan Province, southern Iran) in the years 2010 to 2012 Shaverdi M1, Behbahani A2 P-339 ................................................................................................................................................................................ Sulfonamide immobilized surfactant modified zeolite as an antibacterial agent Mazaheri H, Nizam Nik Malek NA, Amini Z P-340 ................................................................................................................................................................................ Investigation of tetracycline resistance genes in Campylobacter jejuni and C. coli isolated from poultry carcasses with new evidence of tet(A) resistance gene in Campylobacter spp. Shirzad Aski H1, Tabatabaei M1, Khoshbakht R2, Abdi Hacheso B3

32

P-341 ................................................................................................................................................................................ Antibacterial activity of Vipera raddei kurdistanica venom toward Staphylococcus aureus Kolivand E1, Sobati H1, Goodarzi H-R2, Zargan J1 P-342 ................................................................................................................................................................................ Evaluation of antimicrobial activity of anovel endodonticnano-irrigant in comparison with sodium hypochlorite and chlorhexidine digluconate Gholami A1, Abbaszadegan S2, Nabavizadeh A2, Saliminasab2 M, Ghasemi Y1 P-343 ................................................................................................................................................................................ Effect of Iron and Silver nano particles on Streptoccus iniae (zoonoses of Human &Fish) Zahedi tabarestani A1 ,Yousefian M2 , Pourgholam R1, Safari R1 P-344 ................................................................................................................................................................................ Antibacterial Susceptibility pattern of clinical isolates of Pseudomonasaeruginosa obtained from Shiraz Teaching Hospitals Khashei R1, Yousefi-Avarvand A2, Ansari N2, Khademi F2 P-345 ................................................................................................................................................................................ Nosocomial infections Surveillancein madani hospital of khoramabadfrom March 2012 to 2013, Iran Mohsenzadeh, Ahmadipour Sh, Sherkathoabbaci HR P-346 ................................................................................................................................................................................ Study of prevalence and antimicrobial susceptibility of microorganism isolated from throat of healthy staff of Madani pediatric Hospital of Khoramabad, Iran Mohsenzadeh A, Ahmadipour SH, Razlansari A, Samavati S P-347 ................................................................................................................................................................................ Emergence and spread of multi drug resistant Acinetobacterspp in Nemazee hospital Vazin A1, Anvarinegad M2, Davarpanah M, Mahmoudi H1 P-348 ................................................................................................................................................................................ Antibiotic resistance patterns of Escherichia coli isolated from urine samples of infants and children admitted to SanandajBeasat hospital in 1391, Iran Ramazanzadeh R1, Hooshyar A, Mohammadzadeh A3, Darehshiri M.H2, Hoseini A4 P-349 ................................................................................................................................................................................ Antibacterial properties of Dendrimers Hayati B, Shahbazi B, Ahmadi Hedayati M, Ramazanzadeh R, Noshak M.A P-350 ................................................................................................................................................................................ Molecular analysis of class I integron gene in Staphylococcus strains isolated from clinical samples Veise P1, RamazanZade R 2, Dailami Khiababi Z1 , Derakhshi B3 P-351 ................................................................................................................................................................................ Prevalence of quinolone resistance mutation of gyrA gene in clinical isolates of Acinetobacter baumannii Vakili B 1, Fazeli H2, Khorvash F 3, Khaleghi M 4 P-352 ................................................................................................................................................................................ Fluoroquinolone resistance in E. coli isolated from ready for slaughter broiler chickens in Fars province Abdi-Hachesoo B1, Asasi K 1, Sharifiyazdi H 2 P-353 ................................................................................................................................................................................ Molecular Perspective of Drug Resistance in Mycobacterium tuberculosis Bazrafshan B1, Ahani Azari A2 P-354 ................................................................................................................................................................................ Frequency Of ESBL Production and Comparison of Antibiotic Susceptibility Patterns between ESBL Producing and none ESBL Producing Clinical Isolates of Klebsiellapneumoniae in Shahrekord, central Iran KianiAbari P, Zamanzad B P-355 ................................................................................................................................................................................ Evaluation of Antimicrobial Resistance of Acinetobacterbaumannii from ICU of Shariati Hospital, Isfahan, Iran Behshood P1, Ghajavand H2, Vazirzade J2 P-356 ................................................................................................................................................................................ Antibiotic resistance profile of Salmonella spp isolated from ruminants in industrial Slaughterhouses located in East Azerbaijan Province, North Western Iran Ghorbani Choboghlo H1, Zare P2, Maftuni K2, Razzagi S1, Nikaen D1 P-357 ................................................................................................................................................................................ Prevalence and Pattern of Multidrug-Resistance in Isolated Pseudomonas aeruginosa from pulmonary secretion culture of hospitalized patients Khorram Abad Shohadaye Ashayer hospital, Iran Azizi H 1, Saleh F2,3, Soleiman nejad S3, Azizi M4 P-358 ................................................................................................................................................................................ The role of the education of personal hygiene and hygienic package in the prevention of flu-like illness in Mashhadi pilgrims to the Hajj in Saudi Arabia 2012

33

Yaghoubian H, Aelami MH, Khajedaluee M,AmelJamedar S P-359 ................................................................................................................................................................................ Phenotypic and molecular characterization of CTX-M extended -spectrum - lactamase produced by Escherichia coli isolates in Shiraz, Iran Zamani Kh, Emami A, Bazargani A, Moattari A P-360 ................................................................................................................................................................................ Nasal carriage of Staphylococcus aureus and mupirocin resistance among Shiraz medical students Khashei R, Zamani Kh, Kaveh M P-361 ................................................................................................................................................................................ The pattern of antibiotic resistance in gram-negative bacilli isolated from urine of patients admitted to hospital Fatima Zahra in Najaf Abad, 1391 till July 1392, Iran Vafapour R P-362 ................................................................................................................................................................................ Phototoxicity of TBO against Pseudomonas aeruginosa biofilms treated with N-acetylcystein Afifi Rad R, Kashef N P-363 ................................................................................................................................................................................ Characterization of bioactive compounds produced by Actinomyces isolated from soil Baseri M1, Zarei Z 2 P-364 ................................................................................................................................................................................ Comparison of microorganism's positive culture (wound: culture& smear, Blood/culture (B/C bactec)) In patients hospitalized in the women burn department of Mashhad Imam Reza Hospital in the first quarter of 1391, Iran Bonakdaran Z1, Mahdiani A2, Rashchi M3 P-365 ................................................................................................................................................................................ Antimicrobial Activity of Thyme Ethanolic and Methanolic Extract on S. mutans PTCC 1683 and S. salivarius PTCC 1448 .................................................................................................................................................................................. Mirpour M1, Gholizadeh Siahmazgi Z2 P-366 ................................................................................................................................................................................ Antibacterial effect of ethanol extract of Saturejabachtiarica on Salmonella typhimurium and Pseudomonas aeruginosa in red meat Habibian dehkordi S1, Gholipoor shahraki S2, Mohamadi E3 P-367 ................................................................................................................................................................................ Inducible Clindamycin Resistance in Methicillin Resistance Staphylococcus areus Strains: Detection by D-zone Test Saadat S1, Solhjoo K2, Mardaneh J3 , Shabani M2 P-368 ................................................................................................................................................................................ Effects of two different biocides against Acinetobacter baumannii biofilm Hendiani S, Abdi-Ali A, Mohammadi P P-369 ................................................................................................................................................................................ Evaluation of enterococci carring vanA gene in poultry meat samples by PCR Ameri S1, Hosseini Doust R1, Mohabati MobarezA 2 P-370 ................................................................................................................................................................................ Evaluation type of infections in hospitalized burned patients in Ghotbeddin Shirazi burn center (1392) DashtizadehY1, RostampourS 2,MotaghiB1, Zardosht M, EmamiA3,4, MoattariA4, NajafipourS5, Gorzin AA4 P-371 ................................................................................................................................................................................ Optimization of electrophoresis method for enhancing sensitivity in rapid detection bacterial agent and drug resistance in some infectious diseases Falahat S, Ahmadi A, TaiebonM, Arjmandzadegan M P-372 ................................................................................................................................................................................ Effect of the Carvacrol on the Salmonella Enterica PTCC 1709 and Escherichia Coli ATCC: 10536 Noroozi S1, Assmar M2, Amirmozafari N2, Rafatjo A3, Naseri Z4

P-373 ................................................................................................................................................................................ Epidemiological and clinical aspects and treatment cost of infectious diseases in injection drug users admitted in a referral hospital in Hamedan, central Iran Hashemi SH, EsnaAshari F, Mamani M, Faghih N, Yadollahi L P-374 ................................................................................................................................................................................ Determination of drug susceptibility of Mycobacterium tuberculosis strains to Pyazinamide Moaddab S.R 1, Farajnia S 2, Gerami A3 P-375 ................................................................................................................................................................................ In vitro susceptibility study of 90 Mycobacterium tuberculosis strains to clarithromycin

34

Moaddab SR, Rafi A P-376 ................................................................................................................................................................................ Antibacterial effects of N. oleander ethanolic and methanolic extracts against Pseudomonas aeruginosa, Klebsiella pneumonia and S.typhi Mirpour M1, Assmar M1, Jahanpoor N1, Ghaemi N2, jahanpour SH 3, AkbariShahabi SH 4, Raufi N1 P-377 ................................................................................................................................................................................ Screening for antibacterial activity of peptide fractions derived from Iranian scorpion Hemiscorpius lepturus Radbakhsh Sh1, Shahbazzadeh D2, Mahmoodzadeh A2, Pooshang Bagheri K2 P-378 ................................................................................................................................................................................ Antibacterial activity Invitro and Invivo study of Saturejakhuzestanica J. essential oil and carvacrol against standard strain of Listeria monocytogenes Akbari-Shahabi Sh1, Assmar M2, Ghaemi N3, Massiha AR2, khanpoor M2 P-379 ................................................................................................................................................................................ Antimicrobial resistance of Esherchia coli isolated from of Zahedan Hospitals and detection of TEM gene in clinical samples Jahani S1, Shahrekizahedani Sh2, Forouzandeh S1 P-380 ................................................................................................................................................................................ Melting curve analyze for detection of Beijing and non-Beijing genotypes of Mycobacterium tuberculosis Tavakoly Z, Nazemy A, Khataminezhad MR P-381 ................................................................................................................................................................................ Antibacterial Activity of Ethanol extracts of Artemisia against coagulase-negative staphylococci GholamiZarandi A, Khaleghi M, Khodami M, Hoseini E P-382 ................................................................................................................................................................................ Antibacterial effect of Artemisia extracts against Staphylococcus aureus isolated from clinical samples Gholami Zarandi A, Khaleghi M, Khodami M, Hosseini ES P-383 ................................................................................................................................................................................ Antimicrobial Susceptibility Pattern of the Isolated Bacteria from Urine Cultures of Patients Referred to Afzalipoor Hospital, Kerman, Iran Jafari E, Poormasoomi L P-384 ................................................................................................................................................................................ The prevalence and the antibiotic susceptibility pattern of bacterial agents isolated from patients with urinary tract infections admitted into the Clinic of Kermanshah University of medical sciences in 2012 Rashiditabar E1, Akya A2, Sohrabi N1 P-385 ................................................................................................................................................................................ Prevalence of oxa-10 gene in isolates of Pseudomonas aeruginosa isolated from burns infections in Ghotbeddin Hospital Shiraz, Nazari Alam A1, Bazargani A2, Motamedifar M2, Sarvari J2, Khoshkharam H2, Yosefi M1 P-386 ................................................................................................................................................................................ Evaluating different methods of DNAextraction from Giardia Lamblia cysts by PCR Manafi GhR, Hazratitappehand Kh, Asgharzadeh M P-387 ................................................................................................................................................................................ Antibacterial effect of Green Tea extract on Enterococcus faecalis and Streptococcus mutans isolated from Dental Plaque Ranjbar F1, Dadashi M2, Eslami G2, Taheri S2, Ayatollahi M3Azargashb E4 P-388 ................................................................................................................................................................................ Determining Antibiotic Resistance of Pseudomonas Isolated from Motahari and Peymanie hospitals in Jahrom Raoofi R1, Rahmanian K2, Mosadeghi M P-389 ................................................................................................................................................................................ Diversity of vacA Genes of Helicobacter pylori Isolated from Antral Biopsies of Patients in Shiraz, Iran Moaddeb A1, Farshad Sh2, Firozi R1, Fattahi MR3, Derakhshandeh A1 P-390 ................................................................................................................................................................................ Evaluation of Antibacterial resistance pattern of infections in Ghotbedin Shirazi Burn center (1392) Motaghi B1, DashtizadehY1, Rostampour S2, Zardosht M, Emami A3,4, Moattari A4, Najafipour S5, Gorzin A4 P-391 ................................................................................................................................................................................ Frequency of rifampicin and isoniazid resistance genes of M. tuberculosis isolates from sputum of patients with Tuberculosis in Guilan, Iran Amadzadeh F1, Nikokar I2, Ghasamei Y2, Amirmozafari N1 , Mashanea S3 , Fahezei M1 P-393 ................................................................................................................................................................................ Antibacterial effects of Vipera albicornuta venom against Staphylococcus aureus (pathogenic bacteria) Gholami F1, Zargan J1, Goodarzi H-R2, Sobati H1 P-394 ................................................................................................................................................................................

35

Evaluation of antibiotic resistance of Acinetobacter baumanii and non-baumanii in Iran Abbasi F¹, Khalili-azad M²,Asadi S², Yadegarynia D², Gholamin Sh², GachkarL² P-395 ................................................................................................................................................................................ Antimicrobial preservatives in cosmetic industries Rahmani F1, Fooladi AA2. P-396 ................................................................................................................................................................................ The pattern of antibiotic resistance in Klebsiella pneumonia and Escherichia coli from samples sent to the Central Laboratory of Qaem Hospital of Mashhad in 2012 and 2013. Faghihe F1, HajimiriS1, FarzanehRashidi F2, GhazviniK3, SadeghianA3 P-397 ................................................................................................................................................................................ Identification and antifungal sensitivity of opportunistic yeasts isolated from clinical specimens at the nephrology ward of an educational hospital Diba K, Shahnazi E, Alizadeh H, Jabbari D P-398 ................................................................................................................................................................................ Resistance Level to Vancomycin in Staphylococci aureus in Motahari and Peymanie Hospitals in Jahrom, Southern Iran Raoofi R1, Rahmanian K2, Mosadeghi M3 P-399 ................................................................................................................................................................................ Study of Bacteria isolated from urinary tract infection and determination of the antibiotic susceptibility patterns of the gram negative bacteria in 2013 Angoti G1, Goudarzi H 2, HajizadehM3, Gholinejad Z 4, Tabatabaii Z 5 P-400 ................................................................................................................................................................................ Evaluation of the prevalence of Clostridium difficile-associated diarrhea (CDAD) among hospitalized patients in Valiasr Hospital of Arak, Iran Zarinfar N1, Sharafkhah M2, Chehrei A3, Shirani BidabadiM4 P-401 ................................................................................................................................................................................ Survey of efficacy and functional impact of disinfectant agent on computer keyboards in Fatemiyeh and Amiralmomenin Hospitals of Semnan city, Iran TabasiM1, MoradiB2 P-402 ................................................................................................................................................................................ Production and evaluation of anti-Streptococcus Mutans Immunoglobulin Y isolated from serum and eggs laid Sharifzadeh A1, Bagherian M 2 P-403 ................................................................................................................................................................................ Point- prevalence study of health care associated infections in Emam Reza Hospital, Mashhad, Iran Aelami MH, Naderi HR, Mostafavi I, KhosraviN, Amirian H P-404 ................................................................................................................................................................................ A density functional study on Penicillin modified by carbon Nano tube Dehqanian M1, ParsaeiA2, AfzalE2, AlborziA2 P-405 ................................................................................................................................................................................ R-factor transfer from Escherichia coli isolated from patients referring to Hospitals in Isfahan, Center of Iran Sharifzadeh A1, SalehiM2 P-406 ................................................................................................................................................................................ Transfer of drug resistance factors among Escherichia coli isolated from chicken farms in the central province of Iran Sharifzadeh A1, Salehi M2 P-407 ................................................................................................................................................................................ Preparation and analysis of Rosa damascena essential oil composition and antimicrobial activity assessment of its fractions MoeinMR1,2, Zomorodian K3, PakshirK3, AlmasiM4, Zarshenas MM 4, 5 P-408 ................................................................................................................................................................................ Consideration and comparison of antibacterial susceptibility for bacteria causing peritonitis Attarpour Yazdi MM P-409 ................................................................................................................................................................................ Prevalence of isolated bacteria on blood culture and its antimicrobial susceptibility pattern in the patients referred to Shahid Taleghani Hospital in Chalous, Iran Kouchaki MR, porjafari M, Daliryonesi M, Ghaffari P-410 ................................................................................................................................................................................ Antibiotic sensitivity pattern of Staphylococcus aureus from clinical isolates in Tabriz Teyhoo M1, Mozafari NoorA2, Mobaiyen H3, Moaddab SR4

36

P-411 ................................................................................................................................................................................ The prevalence of antibiotic resistance and detection of mecA genes of Methicillin-Resistant Staphylococcus aureus isolated from hospitals in Tabriz -Iran by PCR TeyhooM1*, Mozafari NoorA2, Mobaiyen H3, MoaddabSR4 P-412 ................................................................................................................................................................................ Prevalence of clinical isolates of Escherichia coli and Klebsiella pneumoniae producing extended-spectrum betalactamase (ESBL) in Shiraz Teaching Hospitals KhasheiR, TaheripourM, KhorshidifarM1, SedighH1 P-413 ................................................................................................................................................................................ Antimicrobial resistance pattern of Enterococci isolated from clinical samples in West Azerbaijan Hassan M1, Lotfipour F2 P-414 ................................................................................................................................................................................ Differentiation Of Beijing and Non-Beijing Strains Of Mycobacterium Tuberculosis By MAS-PCR TayeboonM1, Arjomandzadegan M1 P-415 ................................................................................................................................................................................ Molecular study on Extended Spectrum β lactamase producing pseudomonas sp isolated from hospitals in Shiraz Kownani M, baserisalehi M P-416 ................................................................................................................................................................................ Phenotypic and molecular survey of carbapenem resistant among E.coli strains isolated from patients of IMAM KHOMAINI, SINA and MOTEHARI hospitals, Tehran, Iran Elahi N1, Hakemi Vala M2, Bagheri Bejestani F2 P-417 ................................................................................................................................................................................ Antibiotic Resistance Pattern of Class 1 and 2 Integrons in Haemophilus influenzaisolated from Clinical Isolates of Iran Boroumand M1, Siadat SD2, Irani Sh1, Bouzari S3 P-418 ................................................................................................................................................................................ Determine of the frequencyandantibiotic susceptibility rateof bacteriaisolatedfrom patients admittedto the Chalous Shahid Taleghani hospital laboratory Porjafari M, Kouchaki MR, Dalir yonesi M, Ghaffari H, GhaneM, Ghayyomi jaze M P-419 ................................................................................................................................................................................ Antimicrobial effect of Citrus aurantium extractonEnterococcus faecalisand Klebsiella pneumoniaeisolated from Urinary Tract Infection Dadashi M1, Eslami G1, Goudarzi H1, Fallah F2, Taheri S1, Zahirnia Z1 P-420 ................................................................................................................................................................................ Prevalence of Staphylococcus aureus isolated from endotracheal tubes of patients in Loghman Hospital, Tehran, Iran Dadashi M1, Eslami G1, Goudarzi H1, Fallah F2, Taheri S1, Zahirnia Z1 P-421 ................................................................................................................................................................................ Antibiotic resistance pattern of Escherichia coli isolates caused urinary tract infection in Jahrom, Southern Iran Ranjbar M1 , Solhjoo K2, Kargar M3, Parastan R 4, Mojahedi Jahromi S4 , Darughe F4 P-422 ................................................................................................................................................................................ Antimicrobial Resistance Patterns of Pseudomonas aeruginosa clinical isolates in yazd city, Iran kiani M, Astani A, Zandi H, Musavi M P-423 ................................................................................................................................................................................ Prevalence of Metallo-β-Lactamases-producing Klebsiellapneumoniae strains in patients referred to Hamadan university of Medical Sciences hospitals Noshak MA1, Yousefi Mashof R2, Ahmadi Hedayati M1, Ramazanzadeh R1 P-424 ................................................................................................................................................................................ Phenotypic determination of the biofilm-forming ability of Methicillin-resistant Staphylococcus aureus isolates from clinical specimens in two hospitals, Shiraz, Iran Zalipoor M1, Sedigh Ebrahim Saraie H1, Khashei R1, Motamedifar M1,2 P-425 ................................................................................................................................................................................ Investigation of resistance genes among ciprofloxacin resistant Enterococcus faecalis isolates from clinical specimens Moeenian M1, Saifi M2, Pourshafie M2, Eidi A1 P-426 ................................................................................................................................................................................ Antibacterial effects of a new class of piperazinylquinolone derivatives on Bacillus cereus group Ramezani M1,Ramezani M3, Riahi-Madvar A2,Darehkordi A3 P-427 ................................................................................................................................................................................ The prevalence and antimicrobial susceptibility of bacteria isolated from endotracheal tubes of patients in Imam Reza Hospital, Tehran, Iran Lashgari N1, Goudarzi E 2, Goudarzi L3 , Gohary Moghadam K4 , Nasirian R1

37

P-428 ................................................................................................................................................................................ Prevalence of VIM-2 Type metallo-β-lactamase gene in Pseudomonas aeruginosa from clinical isolates in Fars Nasiri N1, Solhjoo K2, Kargar M1, Chobineh D 3, Saadat S1 P-429 ................................................................................................................................................................................ ESBl- Ecoli prevalence among urinary tract infected pregnant women samples as well as Antibiotic Resistance pattern: october2011-october2012 Hamidipour N1, Zarei Z2, Azarafrooz L2 P-430 ................................................................................................................................................................................ Detection of sul2 gene in Escherichia coli isolated from patients with UTI attended to clinical centers in Khoy city Norouzi J, Akhavan sepahy A, Bazzazzadeh N ............................................................................................................... P-431 ................................................................................................................................................................................ Frequency distribution of carbapenem resistant Acinetobacter isolated from the hospitalized patients in sadoughi hospital of Isfahan (2012-2013) Zare V1, Ataee R.A2, Khaleghi A 3, Mehrabi Tavana A4 P-432 ................................................................................................................................................................................ Detection of toxic shock syndrome toxin-1 gene among methicillin sensitive Staphylococcus aureus isolates from Shiraz, Iran SedighEbrahim Saraie H1 , Zalipoor M1, Hosseini Alfatemi M1 , Motamedifar M1,2, Yousefi-Avarvand A1 P-433 ................................................................................................................................................................................ Hand hygiene compliance among health care workers in Emam Reza hospital, Mashhad, Iran Amirian H, Aelami MH, Mostafavi I, Rokni Z, Amirian MH P-434 ................................................................................................................................................................................ Comparison of urinary tract infections and antibiotic sensitivity pattern in outpatient ward of Imam Reza laboratory of Tabriz in 1389 and 1390. TayebiKhosroshahi H1, Habibi Asl B2, Vaez H 2,3, Alizadeh M4, Navapur M1, Nouruzi A1, Varshouchi M1 P-435 ................................................................................................................................................................................ Comparison of urinary tract infections and antibiotic sensitivity pattern in hospitalized and outpatient ward of Imam Reza laboratory of Tabriz in 1389 and 1390 Vaez H1,2, Habibi Asl B1, Alizadeh M3, Navapur M3, Tayebi Khosroshahi H4, Nouruzi A4, Varshouchi M4 P-436 ................................................................................................................................................................................ Evaluation of Class II integron in enterobacteriaceae isolated from clinical specimens Zandi H1, Eslami G2, Navidifar T1, Kiani Harchegani M1 P-437 ................................................................................................................................................................................ Evaluation of Metallo-beta-Lactamase production in Paseudomonas aeruginosa strains isolated from clinical specimens by phenotypic and molecular methods in Yazd-Iran Zandi H1, Eslami G2, Gholamrezaee M3 P-438 ................................................................................................................................................................................ Association between mexB Gene and antibiotic resistance pattern in Pseudomonas aeruginosa Hekmat doost M, Salehi M P-439 ................................................................................................................................................................................ Investigating the prescription pattern of prophylaxis antibiotic before and during midwifery surgeries in Tabriz AlZahra Medical and Teaching center, spring 2012 Naghili B1, Milanian zad R2 P-440 ................................................................................................................................................................................ Resistance to carbapenems antibiotics among Klebsiella pneumoniae isolated from blood cultures in Namazi hospital (shiraz-Iran) 2010-2013, using disk diffusion and Modified Hodge Test Pouladfar Gh, Abbasian A, Pourabbas B , Dehyadegari M.A , Anvarinejad M, Aminshahidi M, Hoseini M Professor Alborzi Clinical Microbiology Research Center, Shiraz University of Medical Sciences P-441 ................................................................................................................................................................................ The pediatric and neonatal antimicrobial surveillance in Besat Hospital, Sanandaj in 2011 and 2012: based on the antibiotic resistance and prescribing in European children (ARPEC) project. Soltani J1, Jafarpour Z2, Soleimani N1, Nahedi S1, Khosravi F1 P-442 ................................................................................................................................................................................ High frequency of Vancomycin-resistant Enterococcus Fecal colonization in transplant Patients hospitalized in southern Iran 2013 Hosseini M, Pooladfar Gh, Amin shahidi M P-443 ................................................................................................................................................................................ The pediatric antimicrobial point prevalence survey in medical and surgical wards of a Tertiary Hospital, Southern Iran in 2011 and 2012 Pouladfar GhR, Jafarpour Z P-444 ................................................................................................................................................................................

38

The neonatal antimicrobial point prevalence survey in a Tertiary Hospital, Southern Iran in 2011 and 2012: based on the antibiotic resistance and prescribing in European Children (ARPEC) Project. Jafarpour Z, Pouladfar GHR P-445 ................................................................................................................................................................................ Low Prevalence of Multidrug-resistant and Extended-spectrum Beta-lactamase-producing Salmonella Species Isolated from Bloodstream at Namazi Hospital, Shiraz, Iran 2008-2013 Pouladfar GHR, Anvarinejad M, Pourabbas B, Aminshahidi M, Hoseini M, Rafatpour N, Dehyadegari MA P-446 ................................................................................................................................................................................ In silico selection of the best immunogenic region of Acineto bacter baumannii FepA as a vaccine candidate Bazmara H, Rasooli I P-447 ................................................................................................................................................................................ Creating human ScFv antibody library next to tetanus toxin Rouhani Nejad H, Bazzaz M, Fallah Zadeh R, Fallah Mehrabadi J P-448 ................................................................................................................................................................................ PCR‐RFLP Method for Determination of HinfI restriction pattern of Haemophilus influenzae sppompP5 in clinical isolates with the aim of vaccine design Samari Z P-449 ................................................................................................................................................................................ Determination of nucleotide sequence of variable region ofompP5 in clinical isolates of Haemophilus influenza spp with the aim of vaccine design Samari Z, Irani S P-450 ................................................................................................................................................................................ Comparison between active and passive immunization with flagellin-based subunit vaccine from Pseudomonas aeruginosa in the burned-mouse model Faezi S1, Shahcheraghi F 1, Behrouz B 2, Nikokar I3, Mahdavi M4, Ian Alan Holder 5 P-451 ................................................................................................................................................................................ Stability studies on the vaccine diluent used at Razi vaccine and serum research institute Khoshnood S , Mojghani N P-452 ................................................................................................................................................................................ Neutralizing antibody response against inactivated FMDV type O/IRN/2010 vaccine by electron beam in BALB/C mice MotamediSedeh F1, Chahardoli Sh2, Mahravani H3, Harzand Ni2, Sotoodeh M3 P-453 ................................................................................................................................................................................ Investigation of pregnant mothers, attitude, knowledge and practice regarding vaccination in Chaloos city in 1392 KashiG,Bichea p P-454 ................................................................................................................................................................................ Prediction of interspecies relationship property to be a Vaccine Candidate of Segment 4 protein of Influenza A virus from Iran Shafaati M.R1, Yazdansetad S2, Shafaati M3, Khadem N1 P-455 ................................................................................................................................................................................ A new conjugated vaccine made by oligopolysaccharide of Salmonella Paratyphi A and Diphtheria toxoid, can increase the IgG and IgM antibody levels against Salmonella paratyphi A in mice Mohseni Meybodi MA.1, Rahnema M.2, Shapoury R. P-456 ................................................................................................................................................................................ Immunogenicityof Influenza Vaccine in HIV-Patients Akbari M1, Baharlou R2, RazaviF2 P-457 ................................................................................................................................................................................ Effect of Gamma –irradiation on of Foot and Mouth Disease Virus type Asia1 MotamediSedeh F1, Javadi M2, Mahravani H3, Harzandi N2, Sotoodeh M3 P-458 ................................................................................................................................................................................ In silico analysis of L1 and L2 proteins of human papilloma viruses: designing a universal vaccine for HPVs Ghorbanhosseini N1, Rahimi A2, Rezaei M3, Mahdavi M4 P-459 ................................................................................................................................................................................ Immuno-reactivity of nano-vaccine from Leishmania major TSA recombinant protein formulated in chitosan KhabazZadeTehrani N1, TabatabaieF2, Imanifooladi A.A3, Mahdavi M4 P-460 ................................................................................................................................................................................ Epidemiologic review of side effect from vaccination in vaccinated people by Karaj health center (NO.2) during years of 1390-1391(2012-2013) Khani Y, Kabir K, Rasi M, Mollajan A P-461 ................................................................................................................................................................................ Designing and constructing a DNA vaccine encoding TB10.4 gene of Mycobacterium tuberculosis Samira Rashidian1, Zahra Meshkat1, Ali Sadeghian1, SaeidAmel Jamehdar2,

39

P-462 ................................................................................................................................................................................ Methylation status of E6 Promoter in high-risk and low risk HPV Zafari E1, Soleimanjahi H1, MirabSamiee S2, HadiRazavinikoo S.M1 P-463 ................................................................................................................................................................................ Investigation of human papillomavirus genotypes associated with breast cancer in Iran Nahavandi Araghi A3, Rassi H 1,Tabaraie B4, Hashemi M5, Salehi B 1,Mohammadian T2 P-464 ................................................................................................................................................................................ The frequency of Enterovirus71 in children with aseptic meningitis in Tehran Rahimi P1, Roohandeh A2, Sohrabi A3,4, Mobasheri M5, Azadmanesh K4, Shahoseini Z4, Motamedi Rad M4 P-465 ................................................................................................................................................................................ Device designation for pathogen reduction in human plasma Elikaei A1, Hosseini SM 1, Latifi H2, Sharifi Z3, Nikbakht H2, Mirshafiee H1, Asadollahi A2 P-466 ................................................................................................................................................................................ A survey on Epstein- Barr virus infection in patients with leukemia/ lymphoma and anemia Dehghani Samani A, Dehghani Samani A, Mahzoonieh M.R P-467 ................................................................................................................................................................................ Prevalence of human T Lymphotropic virus type I (HTLV-I) in patients with coronary artery disease Behboudi B1, Meshkat Z2, Gayour Mobarhan M3,Jashnsaz A4 P-468 ................................................................................................................................................................................ Hepatitis B virus infection in patients with coronary artery disease Behboudi B1, Meshkat Z2, Gayour Mobarhan M3, Jashnsaz A4 P-469 ................................................................................................................................................................................ Spontaneous clearance of HCV infection is associatedwith+A2109G IFN-γ gene polymorphisms in Fars Province, Southern Iran Sarvari J1, Moattari A1, Pirboonyeh N1, Hossini Y2, Moeini M2, fattahi M.R2 P-470 ................................................................................................................................................................................ Isolation and Cloning of human St6galnac5 (siat7e) from cancer cells for MDCK cell suspending Akbari KH1,2, Mohamadpour A3, Fotouhi F2, Mazaheri V2, Kamali R2, Saleh M2, Tabatabaian M2, TavasotiKheiri M2, Farahmand B2 P-471 ................................................................................................................................................................................ The frequency of HPV-16 and HPV-18 in 20-35 years old women’s Pap smear samples, referred to the pathological laboratories in Rasht city by Real-Time PCR Hamidkholgh KH1, Hamidkholgh GH2 P-472 ................................................................................................................................................................................ Assessment of minimum vaccination coverage of Measles using the time series SIR epidemic model in Iran Ahmadi A 1, Mosavi Nasab S.D2, Babanejad M3, 4, Azizian R4.5, Hamidi M6 P-473 ................................................................................................................................................................................ Comparison of molecular and serological methods for the detection of Hepatitis C virus among transplant patients in Shiraz, southern Iran FeyznezhadR1, BehzadiMA2, 3, YaghobiR4, ZiyaeyanM2 P-474 ................................................................................................................................................................................ Hepatitis C virus genotyping among liver, kidney and bone marrow transplant patients in Shiraz, southern Iran, using real-time PCR assay Feyznezhad R1, Behzadi M.A2, 3, Yaghobi R4, Ziyaeyan M2 P-475 ................................................................................................................................................................................ Isolation and identification of inclusion body hepatitis virus Farzin HR1, Famil Ghadakchi Z2, Toroghi R1 P-476 ................................................................................................................................................................................ Isolation of vp1 gene of foot and Mouth Disease Virus type O/IRN/2010 and transformation in pTZ57R/T vector MotamediSede F1, Khalilzadegan S2, Asad pour L2, Mahravani H3 P-477 ................................................................................................................................................................................ Detection of Swine influenza H1N1 and H3N2 Viruses using RT-PCR assay during 2009 pandemic influenza from Iran Zhand S1, Tabarraei A1,Moradi A1,Fotouhi F2,Javid N1, Bazori M1,Hajimohammadi E1,Ghaemi A1, 3 P-478 ................................................................................................................................................................................ No correlation between CCR5-Δ32 mutation and hepatitis B virus infection outcome Jalali S1,Sharifi Z2, Sanati MH1, 3, Shahzadeh Fazeli A1, 4, Bagheri Mansoori MH1 P-479 ................................................................................................................................................................................ CCR5-59353C/T single nucleotide polymorphism in Iranian HBV infected patients Jalali S1, Sharifi Z2, Sanati MH 1, 3, Shahzadeh Fazeli A1, 4, Bagheri Mansoori MH1 P-480 ................................................................................................................................................................................

40

Evaluation of susceptibility HIV-1proviral DNAdetection inthe whole Bloodof patients or suspicious individualsby Real-Time PCR Khalatbari Mohseni S, Nazemi A ,Khataminezhad M P-481 ................................................................................................................................................................................ Development and performance appraisal and expert system for predicting HCV genotype using a virtual restriction map and artificial neural network Nasereslami S1, Nasereslami F2 P-482 ................................................................................................................................................................................ Antiviral activity of Matricariarecutita L., Allium ascalonicumL.againstAvian Influenzavirus Rezatofighi S.E1, Rafiei S1, Seyyednejad S.M1, Mahmoud Saleh F1, Talazadeh F2 P-483 ................................................................................................................................................................................ Sequence analysis of N gene in measles virus AIK-C strain used for vaccine production at Razi institute khoshnood S , Aghaei por KH, Mojghani N P-484 ................................................................................................................................................................................ Relationship betweenEpstein-Barrvirus infection and lymphoproliferative disorders Hashemi SH, Abbasi M, Hajilooi M, Poorolajal J, Lakzadeh L P-485 ................................................................................................................................................................................ Hepatitis proteins, new tools to overcome Adenoviral vector stormy immune response? Hosseini SY1, Karimi M.H2, Rezaei F1, Pakniat E1, Fattahi M.R1, Ardebili M1 P-486 ................................................................................................................................................................................ Epidemiological Survey on HIV/AIDS in East Azerbaijan, Iran Haghgoo SM1, Joula H1, Mohammadzadeh R1, Sabour S2, Yousefi R3, Ghahramani GH3, Rahimi A4

P-487 ................................................................................................................................................................................ Molecular analysis of the viral agents causing muzzle crust in small ruminants of Shiraz, Iran Davari SA1, Sayyari M 1, MohammadiA1 P-488 ................................................................................................................................................................................ ThecausalrelationtionshipbetweenrespiratoryviralinfectionsandexacerbationsofCOPDinIranianpopulation:aCaseControlStudy 1 2 3 4 Hosseini SS ,Ghasemian E ,Jamaati H ,Tabaraie B P-489 ................................................................................................................................................................................ Comparative Study of Cytomegalovirus (Cmv) Antigenemia Assay, Polymerase Chain Reaction, Serology in the Early Diagnosis and Monitoring of Cmv Infection After Bone marrow Transplantation Emami SS1, Nategh R2, Tabatabaie H3 P-490 ................................................................................................................................................................................ Seroprevalence of Cytomegalovirus IgM and IGg antibody in Hormozgan juvenile by Enzyme- linked immunosorbent assay Emami SS1, Nategh R2, Tabatabaie H3 P-491 ................................................................................................................................................................................ Sero-prevalence of hepatitis A and E virus infections among healthy population in Shiraz, southern Iran Asaei S, Ziyaeyan M P-492 ................................................................................................................................................................................ Rapid detection of foot-and-mouth disease virus by Real-time PCR Ahmadi Vasmehjani A, Baharlou R P-493 ................................................................................................................................................................................ Genotyping of hepatitis C in Peripheral blood mononuclear cells as reservoir in HCV mixed infection Ahmadi Vasmehjani A, Baharlou R, Karamzadeh A P-494 ................................................................................................................................................................................ Hepatitis A infection in patients with chronic viral liver disease: a seroprevalence study in Jahrom, southern Iran AhmadiVasmehjani A, Baharlou R, Karamzadeh A P-495 ............................................................................................................................................................................... Prokaryotic expression of influenza virus hemagglutinin stalk domain (HA2) for universal subunit vaccine production Akbari A2, Fotouhi F1, Jalili N2,.Saleh M1,Akbari Kh3,Torabi A1, Kianmehr Z1, Farahmand B1 P-496 ................................................................................................................................................................................ Prevalence of Foot and Mouth Disease Virus (FMDV) in Carcasses Referred to Khorasan Razavi Industrial Abattoir by Real-time quantitative PCR (q-PCR) Haghparast, A1,2,3 , Zibaii, S4, Rahman Mashhadi, M1, Sadrnia F1, Torabi, M5, Rashtibaf, M5 P-497 ................................................................................................................................................................................

41

First report of bovine herpesvirus 5 in Iranian Bulls’ Semen Samples Sharifzadeh A1, NamaziM.J2, Taktaz T3 P-498 ................................................................................................................................................................................ Prevalence of adenovirus in respiratory discharges of patients with acute respiratory discomforts in Gorgan Rostamzadeh S1, Khodabakhshi B1,2, Moradi A1,2, Javid N3, Joshghani Hr1,Roshandel Gr1, Ghasemi-Kebria F1 P-499 ................................................................................................................................................................................ Th17 Response in HCV/HIV-coinfected Patients Razavi F1, Baharlou R2 P-500 ................................................................................................................................................................................ Co-infection of cytomegalovirus and Epstein-Barr virus; rare presentation in infectious mononucleosis Abbasi F¹, Korooni S² P-501 ................................................................................................................................................................................ Prevalence of Influenza A/H1N1 (pdm09) virus in south of Iran by Real time –PCR Khodadad N, Tavakkoli Garmaseh F, Emami A, Moattari A P-502 ................................................................................................................................................................................ Rapid detection of Rotavirus in fecal specimens by PCR during acute gastroenteritis among under 6 year children Haratian K1, Mohseni Meybodi A2, Fallah P1 P-503 ................................................................................................................................................................................ Redox-Regulated Replication of Respiratory syncytial virus affected by Buthionine sulfoximine Haratian K1, Anahita Mohseni Meybod2, Fallah P1 P-504 ................................................................................................................................................................................ The prevalence of EBV in Hodgkin's Lymphoma and its correlation with histological subtypes Mozafari L1, Najafipour S2, Meshkibaf MH3, Moravej A2 P-505 ................................................................................................................................................................................ Study of association of EBV with Hodgkin's Lymphoma in children under 14 yearsby insitu hybridization Mozafari L1, Najafipour S2, Meshkibaf MH3, Moravej A2

P-506 ................................................................................................................................................................................ Cloning and expression of the Vascular Endothelial Growth Factor (VEGF) gene from an Orf virus isolate, Ahvaz, southern Iran Beladi Mousavi M 1, Seyfi Abad Shapouri MR 2, Haji Kolaei MR3 P-507 ................................................................................................................................................................................ Evaluation of a PCR-ELISA system, for the Semi quantitative detection of congenital cytomegalovirus infection in infants Talkhabifard M1, Javid N1, Moradi A1, Ghaemi A2, Tabarraei A2 P-508 ................................................................................................................................................................................ Incorporation of Aluminum Hydroxide and CpG ODN Motifs into Influenza Vaccine Formulation improves protective immunity against influenza virus challenge Chalavi M2,Jamali A1,Abdoli A1,Shapori R2,Tavasotikheyri M1,Akbari KH1,Biglari P1, Rahmatollahi HR1, Torabi A1 , Sadati SF P-509 ................................................................................................................................................................................ Analysis of acyclovir resistance mutations in human herpes virus 1 based on thymidine kinase gene using bioinformatics tools Behzadi MA1, 2, Feyznezhad R3, Ziyaeyan M1 P-510 ................................................................................................................................................................................ Phylogenic analysis of human and avian influenza A virusesneuraminidase, isolated from Iran during 1999 to 2012, with focus onresistance mutations to the NA inhibitors Oseltamivir and Zanamivir Behzadi MA1, 2, Feyznezhad R3, Ziyaeyan M1 P-511 ................................................................................................................................................................................ IL-10 -819 polymorphism is not associated with the outcome of hepatitis B virus infection in Iranian population Bagheri Mansoori MH1,2 , Sharifi Z2, Sanati MH1,3, Shahzadeh Fazeli A1,4, Jalali Khouzani S1,2 P-512 ................................................................................................................................................................................ Study of abortion caused by Cytomegalovirus (CMV)with emphasis on the most important diagnostic methods and effects of recurrent abortions Shahbazi P1, Shadmehri M2, Alem M2, Barzegar D P-513 ................................................................................................................................................................................ Diagnosis of herpes simplex virus-1 keratitis using Loop-Mediate Isothermal Amplification method Tarighati M1,Karbasizade V2, Moghim Sh3 P-514 ................................................................................................................................................................................ Co-infection of HCMV and EBV in Periodontal Pocket Wall

42

Karandish M¹, Khosropanah H¹, Ziaeyan M2 P-515 ................................................................................................................................................................................ Drug-related mutation in Hepatitis B Virus (HBV) reverse transcriptase in patients with partial response to adefovir Mahabadi M4, Norouzi M1, Alavian SM2, Samimirad K3, Mokhtari Azad T1, Saberfar E4, Mahmoodi M5, Jazayeri SM1 P-516 ................................................................................................................................................................................ Anti herpes effect of three plant species of Iran on HSV-1 multiplication Farahani M P-517 ................................................................................................................................................................................ Characteristics and probable risk factors of HCV RIBA positive blood donors of Yazd city Vaziri M P-518 ................................................................................................................................................................................ The Th Cytokines and hepatitis C viral infection in liver transplant patients Ebadi M P-519 ................................................................................................................................................................................ Engineered cell lines for detection of viruses, a new technique in virology Ghasemi F1, Alem M2, Shadmehri M2, Barzegar D P-520 ................................................................................................................................................................................ Immunochromatography assay for quick recognition of Adenovirus, Rotavirus and Norovirus among diarrhea samples collected from infants in Iran SharifiRad J1, 2, Hoseini Alfatemi M3 P-521 ................................................................................................................................................................................ Epstein-Bar virus and pterygium Kelishadi M1, Kelishadi M2, Moradi A1, Javid N1, ShakeriF1,Tabarraei A1 P-522 ................................................................................................................................................................................ Co-infection of adenovirus and pandemic influenza in Golestan province (1389-1391) Javid N, Moradi A, Nazari Z, Bazouri M, Tabarraei A P-523 ................................................................................................................................................................................ Prokaryotic expression of influenza A (H1N1) hemagglutinin small subunit-3M2e chimeric protein for Subunit vaccine development Jalili N2, Fotouhi F1,Hashemi M2,Saleh M1, Akbari A 1, Akbari KH1, Kianmehr Z1, Torabi A1, Ghahremani M1,Mohammadpour A1, Farahmand B1

P-524 ................................................................................................................................................................................ Utilization of Lambda bacteriophage as an Apoptin effective delivery platform to the BT-474 human breast carcinoma tumor Ghaderi N1, Esazadeh Kh2, Shoa Hasani A3 P-525 ................................................................................................................................................................................ The initial viral load in HCV patients who are newly alert their infections by Real–Time PCR assay Aliabadi N, Jamalidoust M, Asaei S, Namayandeh M, Ziyaeyan M P-526 ................................................................................................................................................................................ Frequency of Cytomegalovirus Infection among patients with Inflammatory Bowel Disease in Iran Balaii H, Alebouyeh M, Malekpour H, Azimirad M, Molaei M, Naderi N, Asadzadeh H, Zali MR P-527 ................................................................................................................................................................................ Human Papillomavirus genotype distribution in vulvar cancer in Mashhad, Northeast Iran Mokari Golkhatmi A1, Jamehdar SA2, Hasanzadeh M3, Kadkhodaian S3, Shandiz FH4, Masoud Ghane1, Nomani H2 P-528 ................................................................................................................................................................................ Prevalence and risk factors of Herpes Simplex Virus Type-2 among women in Northeast of Iran, Mashhad Jamehdar S.A1, Hasanzadeh M2, Aelami M.H3, Yarpour F4, Nomani H4 P-529 ................................................................................................................................................................................ The role of the education of personal hygiene and hygienic package in the prevention of flu-like illness in Mashhadi pilgrims to the Hajj in Saudi Arabia 2012 Yaghoubian H1, Aelami MH2, Khajedaluee M3,Amel Jamedar S4 P-530 ................................................................................................................................................................................ EBV DNemia monitoring by quantitative PCR assay in Iranian liver organ recipients and following associated clinical consequences ............................................................................... Jamalidoust M1, 2, Ziyaeyan M1, Namayandeh M1, Asaei S1, Aliabadi N1

43

44

Oral Presentation

45

O-1 Evaluation of immune responses to a new multi-epitope HIV-1 vaccine candidate Rahimi R1, Ebtekar M1, Arabi N2, Mahdavi M2 1

Department of Immunology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran 2 Department of Virology, Pasteur Institute of Iran, Tehran, Iran Introduction and Objectives: Multi-epitope vaccines offer several potential advantages in case of mutable divergent pathogens such as HIV-1. In this study, a multiepitopic recombinant protein containing various HIV-1 antigens was expressed in E. coli BL21D3 and its immunogenicity was evaluated. Materials and Methods: HIVtop4 sequence (Gag158-186, Pol150-190, ENV296-323, ENV577-610, Tat1-20 and Tat44-61) was designed based on computer analysis, cloned into pET23a plasmid. Expression was induced in BL21 E. coli cells by addition of IPTG and purified by IMAC and confirmed against in western-blotting. Groups of BALB/c mice (n=6) were immunized subcutaneously with 20 g of candidate vaccine adjuvanted in Complete Freund‟s, Montanide ISI-70 and Alum. Lymphocyte proliferation was measured with Brdu, IL-4 and IFN- cytokine with ELISA, total antibody and IgG1, IgG2a isotypes with indirect ELISA methods. Results: Immunization led to a significant increase in the proliferative responses of lymphocytes, IFN-γ cytokine and total antibody titer in comparison with that in the control groups. Vaccine formulation in alum adjuvant resulted in the highest humoral response and formulation in Freund‟s adjuvant resulted in highest level of lymphocyte proliferation and IFN- release. Conclusion: We concluded that, env, pol, gag with adjuvants (Montanide, Alum and CFA) can be considered as a candidate vaccine against the HIV virus. Key Words: HIV-I, Multi epitopic vaccine

46

O-2 Effects of ethanol extract of Hypericum perforatumon experimentally induced Candida keratitis in rabbits

Abtahi Froushani SA1, Lotfallahzadeh Barzili B2, Khamisabadi M2

1

Assistant Professor of Immunology, Department of Microbiology, Veterinary Faculty, Urmia University, Urmia, Iran. 2

Student of Urmia University, Faculty of veterinary medicine, Urmia, Iran

Introduction and Objectives: Hypericum perforatum is a sprawling, leafy herb that grows in open, disturbed areas throughout much of the world’s temperate regions, such as Iran, and is used in folk medicine to treat a variety of internal and external ailments. The present study was set out to investigate the effects of Ethanol Extract of Hypericum perforatumon the experimentally induced Candidial keratitis in rabbits. Materials and Methods: The alcoholic extract of H. perforatum was prepared by 80% ethyl alcohol. After suppressing the immune system of 24 male rabbits, experimental Candida albicans keratitis was induced in the animals under local anesthesia and sterile conditions. The animals were later divided into four groups including the control or glycerin group and a nystatin and two 250 and 500μg/ml Ethanol Extract of H. perforatumgroups. Treatment continued for 21 days and after sacrificing the animals by humane methods, histopathological samples of the rabbits‟ eyes were prepared. Results: Keratitis was developed in the eyes of all rabbits a week after the yeast inoculation. In the control group in which animals received glycerin, keratitis persisted until day 21. Clinical signs of keratitis disappeared in the Nystatin and 500μg/ml Ethanol Extract of H. perforatumgroups after 14 and 21 days, respectively. The clinical signs of keratitis partially ameliorated in the animals receiving 250μg/ml Ethanol Extract of H. perforatum. Histopathological examination revealed no differences between groups receiving nystatin or 500μg/ml Ethanol Extract of H.perforatum. Conclusion: It is concluded that, H. perforatum essential oils could completely treat Candida albicans keratitis in 500 μg/ml concentrations. This extract can be used as a safe antifungal agent against Candida albicans and it is a good substitute for synthetic antifungal agents like nystatin. Keywords: Candida albicans, H. perforatum essential oils, keratitis, nystatin, rabbit.

47

O-3 Association of Interleukin-27 gene polymorphisms with brucellosis in Iranian population Asaei S1, Rasouli M1, Moravej A2, Kalani M1, 3 1

Department of Immunology, Prof. Alborzi Clinical Microbiology Research Center, Shiraz University of Medical Sciences, Shiraz, Fars, Iran 2

Departments of Immunology, Fasa University of Medical Sciences, Fasa, Fars, Iran

3

Departments of Immunology, Shiraz University of Medical Sciences, Shiraz, Fars, Iran

Introduction and Objectives: Human Brucellosis is considered as one of the most widespread zoonotic diseases caused by Gram negative facultative intracellular coccobacilli of the genus Brucella. IL-127 is a pleothropic cytokine that recently is shown to play an important role in the development of innate and adaptive immunity. Considering the important role of IL-27 in the defense against Brucella, the aim of this study was to investigate the associations between the single nucleotide polymorphism of IL-27 gene variant and susceptibility/resistance to brucellosis. Materials and Methods: The study groups included 196 persons suffering from Brucella infection and the control group consisted of 82 healthy animal husbandmen from the same geographical area as the patients. IL-27 at positions (-964 A/G, 2905 T/G, 4730 T/C) were analyzed by polymerase chain reaction- restricted fragment length polymorphism. Results: The results showed that the frequency of TG genotype at position 2905 was significantly higher in controls compared with patients (p=0.0002) and the frequency of CCgenotype at position 4730 was significantly higher in patients compared with controls. Data showed that the distribution of double haplotypes ATT/AGT, GTC/GGT and ATT/GTT (positions 964, 2905 and 4730) were significantly higher in the control compared with that in the patients (P=0.00003). Conclusion: Based on the present finding, this study suggests that the heritage of TG genotype at position 2905 and CC genotype position 4730 may be considered as a genetic factor for resistance and susceptibility to brucellosis, respectively. Keywords: Interleukin-27, genetic polymorphisms, Brucella, Iran

48

O-4 Evaluation of Th17 and the Serum IL-17A, IL-21, IL-22, IL-23, TGF-β Levels in Helicobacter Pylori-infected Peptic Ulcer and Gastritis Patients Shamsdin SA¹, Alborzi A¹, Rasouli M¹, Kazemi MH², Bagheri Lankrani K³, Fatahi M², kalani M¹ 1

Department of prof.Alborzi Clinical Microbiology Research Center, Shiraz University of Medical Sciences 2

Department of Gastroenterohepatology Research Center, Shiraz University of Medical Sciences 3

Department of Health Policy Research Center, Shiraz University of Medical Sciences

Introduction and Objectives: Infections by Helicobacter can cause the stimulation of sophisticated immune response in mucosal immunity. Among different lymphocytes, Th17 plays an important role in defense against H.pylori and causes inflammatory response. H.pylori may cause gastritis and peptic ulcer because of increased activation of Th17 and changes of cytokines such as IL-17A, IL-21, IL-22, IL-23 and TGF-β. To find the relationship between Th17 and IL-17A, IL-21, IL-22, IL-23, TGF-β in the patients suffering from H.pylori infection with signs including gastritis, and peptic ulcer. Materials and Methods: Totally, 36 samples from patients with gastrointestinal problems were collected.The percentage of Th17 was measured by flowcytometr. Also, the levels of IL-17A, IL-21, IL-22, IL-23, and TGF-β were measured by ELISA. Results: Patients were divided into three group’s Peptic ulcer, gastritis, and normalwith the age range of 17 -84 years. The percentage of Th17 in the patients with peptic ulcer and gastritis was significantlymore than the normal counterparts (p≤0.001). The serum levels of IL-17A andIL-23 in peptic ulcer and gastritis groups were significantlyhigher compared to the levels in the normal population (p=0.02) (p=0.04). Changes in levels of IL-21 and IL-22 in peptic ulcer and gastritis groups were low.TGF-β levels in peptic ulcer, and gastritis groups were found to be significantly higher than that in normal population (p≤0.01). Conclusion: Based on the obtained results, we can conclude that Th17 and the associated cytokines such as IL-21, IL-23, IL-22, IL-17A and TGF- β can play a critical role in peptic ulcer and gastritis in the individuals infected with H. pylori.

49

Key word: Th17, IL-17A, IL-21, IL-22, IL-23, TGF-β, H.pylori

50

O-5 Isolation of specific single chain antibodies against Influenza virus (H1N1) Nejatollahi F1, Alizadeh S1, Moazen B2 1

Department of Immunology, Shiraz University of Medical Sciences, Shiraz, Iran

2

Student Research Committee, Shiraz University of Medical Sciences, Shiraz, Iran.

Introduction and Objectives: Influenza is a major cause of morbidity and mortality around the world and influenza virus remains a constant public health threat. Hemagglutinin (HA) is one of the surface antigens of the virus, responsible for virus binding to host cell and therefore has been the primary target of neutralizing antibodies. An antibody in scFv (single chain fragment variable) format consists of variable regions of heavy (VH) and light (VL) chains, which are joined together by a flexible peptide linker and can be easily expressed in functional form in E.cloi. Single chain antibodies due to their small size and high affinity properties have several advantages in clinical practices. In this study we intended to select specific scFvs against influenza virus (H1N1) for their clinical applications. Materials and Methods: A conserved sequence of HA was used as an epitome and a phage antibody display library of scFv was applied for isolation of specific scFvs against the epitome.PANNING PROCEDURE WAS USED TO SELECT T he phage particles bearing antiepitome scoff. In this procedure a Nun immunotube was coated with the epitope and phage rescue supernatant was added. The elusion was performed with Ecoli TG1 and specific clones were selected after four rounds of panning. 20 clones were randomly selected to confirm the presence of VH-VL inserts by PCR. DNA fingerprinting was done to determine the homogeneity of isolated clones and to select specific clones against the peptide. Results: Two specific scFvs with frequencies 55% and 25% were selected against the conserved sequence of HA. Conclusion: During annual influenza epidemics, 5–15% of the worldwide population is typically infected, resulting in 3 to 5 million cases of severe illness and between 250,000 to 500,000 deaths per year. Therefore, a new prophylaxy and treatment strategy is needed. Neutralizing monoclonal antibodies have shown to be promising agents but because of HAMA reaction, these antibodies could not be efficient in clinic. In the current study a successful panning process was performed and two specific scFvs with frequencies 55% and 25% were selected. The neutralizing effect of these antibodies is under investigation. The anti-HA neutralizing scFvs could be used for treatment or prevention of influenza in high risk patients. Key words: Single chain antibodies, Influenza virus, specific clones, Hemagglutinin, Treatment, Prophylaxy

51

O-6 Association of interleukin 22 (IL-22) gene polymorphisms and Helicobacter pylori related gastero intestinal diseases

Choopanizadeh M1, Rasouli M1, Moravej A2, Shamsdin S.A1

1

Department of Immunology,ProfessorAlborzi Clinical Microbiology Research Center, Shiraz University of Medical Sciences, Shiraz, Iran 2

Department of Immunology, Fasa University of Medical Science, Fasa, Iran

Introduction and Objectives: Helicobacter pylori (H.pylori)is associated with variable gastero intestinal (GI)clinical outcomes such as atrophic gastritis, peptic ulcer and gastritic cancer.IL-22 is produced by several cells of innate immunity such as DCs, NK cells and γδT cells. IL-22 in corporation with IFN-γ induces the expression of iNOS and subsequently nitric oxide (NO) production and NO acts as an antimicrobial agent. Based on the important roles of IL-22 in immunity against Helicobacter pylori, the aim of this study was to investigate the probable relationship between IL-22 gene polymorphisms and the susceptibility/resistance to H.pylori related gastero intestinal diseases. Materials and Methods: Two hundred and thirteen H.pylori infected patients and two hundred and fifteen healthy populations were included in this study. Polymorphisms at four position of IL-22 gene (rs2227501, rs2227503, rs1026786, rs2227513) were genotyped by polymerase chain reactionrestricted fragment length polymorphism (PCR-RFLP). Results: The results showed that the frequencies of AA and AG genotypes and A allele at position rs2227513 were higher in the control than that in the gastritis patients (p=0.006 and p=0.020, respectively), also the frequencies of AT and TT genotypes and A allele at position rs2227501 were higher in control than in h.pylori patients (p=0.005 and p=0.005, respectively). Conclusion: In conclusion, our study suggested that inheritance of some genotypes and alleles can be considered as a genetic factor for resistance to h.pylori GI diseases. Keywods: Interlukin-22, Genetic polymorphisms, Helicobacter pylori

52

O-7 The effect of gamma interferonoverexpression by adenoviral vector on phenotypic and functionalmaturationof murinedendritic cells Mofazzal Jahromi MA1, AzadmaneshK 2, HassanZM1, Moazzeni SM1 1

Departmentof Immunology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran 2

Department of Virology, Pasteur institute of Iran, Tehran, Iran

Introduction and Objectives: Dendritic cells (DCs) are potent antigen presenting cells (APCs) with a vital role inimmune-responses.DCs activity is dependent on the expression of class II major histocompatibility complex (MHC) and co-stimulatory molecules, including CD40 and CD86. Gamma-interferon (IFN-γ) is a crucial cytokine in modulation of immune system. Adenoviral vectors (AdVs) can efficiently be used in gene targeting for treatment of cancers and infectious diseases. Materials and Methods: Here, we explored the effects of induction of IFN-γ production byAdVs on DC activation. AdVswere propagated in Human Embryonic Kidney 293 (HEK293) celllinesand DCs were derived from mouse bone marrow using GM-CSF- and IL-4-enriched media. The DCs were infectedbyeither AdVs-green fluorescent protein (GFP) or AdVs-IFN-γ during a 48hr.culture. Phenotypic and functional characteristics of AdV-infected DCs were analyzed by flowcytometry assay. Results: Our results showed that AdVs-IFN-γcould significantlyinduce DCs maturation.Furthermore AdVs-IFN-γ-infected DCs were shown to be efficient inducers of T cell proliferation in allogenic mixed lymphocyte reaction (MLR). Conclusion: Thus, AdVs-IFN-γ can be considered as a potential immune stimulator to be utilized in immuno therapy of cancers and infectious diseases. Key words: Dendritic cells, Adenoviral vector, Gamma-interferon, Maturation

53

O-8 Homology Modeling and Epitope Mapping of the Neuraminidase Molecule of a Newly Emerged H7N9 Influenza Virus Using In Silico Methods PoorinMohammad N1, Ghaedizadeh Sh2, Mohabatkar H1 1

Department of Biotechnology, Faculty of Advanced Sciences and Technologies, University of Isfahan, Isfahan, Iran 2 Department of Biology, Faculty of Sciences, University of Isfahan, Isfahan, Iran Introduction and objectives: The last two decades have witnessed many emerging viral infections. Undoubtedly, vaccination is the most effective medical tool to prevent and control these infections. However, the time-consuming and expensive assays, together with the heavy workload of vaccine design, make the process too uphill to be handled experimentally. Influenza viruses are of those viruses causing much concern among health care authorities which necessitates immediate contrivances. In silico techniques can help efficiently as an accelerant strategy to speed up the vaccine design process. Materials and Methods: Implementing special algorithms, HLA-A2 restricted Cytotoxic Tlymphocyte (CTL) epitopes were predicted. Using docking techniques, the most potent peptidic epitopes were selected on the basis of their interaction with HLA-A2 and T-cell receptor (TCR) molecules. It was assured that the 3D structure of the molecule is not yet available. Therefore, homology modeling of the protein was performed using two computational servers. After assessing the quality of generated models, the best protein model was chosen to operate the antibody epitope mapping. Results: There were 14 peptidic epitopes among of which 4were shown to have highly certifiable binding properties with HLA-A2 and TCR molecules. Furthermore, 79 residues were predicted as conformational epitopes and can be further examined experimentally to find if they can elicit neutralizing antibody response. Conclusion: Thanks to bioinformatics, the need for examining all possible epitopes will be nullified. The results proposed by this study can be beneficial in accelerating the vaccine design process. Keywords: H7N9 influenza virus, neuraminidase, epitope mapping, homology modeling, vaccine design, bioinformatics

54

O-9 A rapid nested PCR and fragment length polymorphism technique for differentiation of pathogenic and nonpathogenic Leptospira spp. in the condemned kidneys in Shiraz abattoir, South of Iran Taghadosi V, Hosseinzadeh S, Shekarforoush SS Department of Food Hygiene and Public Health, School of Veterinary Medicine, Shiraz University, Shiraz, Iran. Introduction and Objectives: Leptospira, a spirochaete of public health concern because it causes zoonotic disease. The present study was conducted to investigate the prevalence of Leptospira spp in Shiraz, Fars province using conventional PCR and nested PCR-RFLP assays. Materials and Methods: 71 condemned kidneys out of 450 total slaughter cattle were collected between Januarys to August 2012. The collected samples were divided into two groups; in which, 55% were belonged to white spotted kidneys and 45% were corresponded to other grossed lesions kidneys. Results: Using the nested PCR-RFLP, 21/39 (53.8 %) and 9/39 (23.07%) were respectively belong to the pathogenic and non-pathogenic species in the white spotted kidneys, whereas, 8/32 (25%) pathogenic and 5/32 (15.6%) non-pathogenic species were corresponded to other gross lesions. The nested PCR RFLP assay was also confirmed the presence of the infection caused by pathogenic strains in 2/10 (20%) of normal kidneys. The conventional PCR assay was also confirmed 11 (15.5%) out of 71 samples infected with pathogenic Leptospira. Conclusion: Our results indicate that the nested PCR-RFLP was more sensitive and therefore is an appropriate technique to confirm leptospirosis. Besides, our work was indicated that other grossed lesions rather than white spotted and also normal kidneys may play a role in transmitting the pathogenic species of Leptospira and thus increase the risk of zoonotic infection. Key words: Leptospirosis, Nested PCR-RFLP, Conventional PCR, White spotted kidneys

55

O-10 Taurine improves the wound healing process in cutaneous Leishmaniasis in mice model, based on stereological parameters Ashkani Esfahani S ˡ, Zarifi Fˡ, Asgari G², Zargari Aˡ, Rafiee S¹, Noorafshan A3 1

Student Research Committee, Shiraz University of Medical Sciences, Shiraz, Iran

2

Department of Parasitology and Mycology, Shiraz University of Medical Sciences, Shiraz, Iran 3

Histomorphometry and Stereology Research Centre, Shiraz University of Medical Sciences, Shiraz, Iran Introduction and Objectives: Cutaneous Leishmaniasis is a self-limiting disease caused by protozoan parasites of the genus leishmania which affects the skin wounds. Taurine (2aminoethan sulphonic acid; Tu) is the most abundant amino acids which have antioxidant and anti-inflammatory effects that play important roles in the process of wound healing. In this study, we investigated the effects of Tu on cutaneous leishmaniasis skin wounds and L.major promastigotes by using stereological techniques and flowcytometry. Materials and Methods: In total, 18 mice were induced with leishmaniasis wounds (with L. Major) on the base of their tails and divided into 3 groups, T1: treated with Tu injection, T2: treated with Tu gel C: no treatment. Treatments were carried out every 24 hours for 21 days. The volume densities of the collagen bundles and vessels, vessel‟s length density and diameter, and fibroblast populations were estimated by stereological methods. Flowcytometry was used in order to investigate direct Tu effect on the parasites. Results: According to stereological analysis, numerical density of fibroblast, volume density of collagen bundles, length densities of the vessels in groups T1 and T2 were significantly higher than that in group C. Fibroblast numerical density of group T1 was significantly higher than that in group T2. By the way, Tu had no direct effect on L. major parasites according to flowcytometry analysis. Conclusion: According to this study Tu showed the ability to improve the wound healing process and tissue regeneration although it had no direct anti-leishmaniasis effect. Keywords: Cutaneous Leishmaniasis, Taurine, Mice, Wound healing

56

O-11 Improvement on Automatic Diagnosis of Malaria Parasites using Red Blood Cells Mask Malihi L1 , Ansari-Asl K1 , Behbahani A2

1 2

Electrical Department, Engineering Faculty, Shahid Chamram University, Ahvaz, Iran School of Health, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran

Introduction and Objectives: The common method for detecting malaria parasite is visual inspection through a microscope. However, this method has some disadvantages: (i) it is time consuming; (ii) it requires a level of expertise. Therefore, automatic detection of this disease is very important in its prompt diagnosis and treatment, especially in the areas with insufficient expert microscopists. In this research, the images of different elements in blood are classified into two parasite and non-parasite categories by classifiers using some appropriate discriminant features. Materials and Methods: In total,400 images of blood slide infected with malaria parasites have been used in this research. Feature extraction and classification algorithms were implemented using MATLAB software. At first, red blood cells and other stained elements of blood such as parasites, white blood cells, and platelets were extracted; then, red blood cell mask was located on the stained elements to eliminate non-red cell elements. Finally, colour histogram, granulometry, gradient and flat texture features were extracted and used as classifier inputs. Here, four classifiers were used:Decision Tree, KNN, 1-NN, and QD. Results: Using the same masking and feature, KNN classifier showed the best accuracy with 91% rate of success among the above classifiers; the accuracies of other classifiers were 87%, 86%, and 88.5% for Decision Tree, QD, 1-NN, respectively. Conclusion: Proposed approach is a major step in development of software for automatic diagnosing of malaria parasites. Among the mentioned classifiers, the best performance belongs to the KNN classifier and the lowest performance is for the QD classifier. Keywords:Malaria,Classifier,K-NearestNeighbours,Area granulometry,Decision Tree, QD, 1-NN.

57

O-12 Molecular characterization of sandflies and Leishmania detection in main vector of Zoonotic Cutaneous Leishmaniasis in Abarkouh district of Yazd province, central Iran Najafzadeh N2,Parvizi P1,Taslimaian R1 1

Molecular Systematic Laboratory, Parasitology Department, Pasteur Institute of Iran, Tehran, Iran 2

Molecular Systematic Laboratory, Parasitology Department, Pasteur Institute of Iran, Tehran, Iran Introduction and objectives: To assess molecular characterization, distribution, seasonal activities of sandfly species and Leishmania parasites infecting them for this Zoonotic Cutaneous Leishmaniasis focus. Materials and Methods: The collections were carried out in 2009-2011using CDC traps, Sticky Papers and manual aspirator in and around the villages in Abarkouh district. Individual sandflies were characterized by PCR amplification and sequencing of fragments of their mitochondrial cytochrome b gene. Leishmania parasite infections within sandflies were performed by targeting Cyt b, ITS-rDNA, k-DNA and microsatellite genes. Results: The PCR assays detected only Leishmania major (L. major). All infections (30) were found in the abundant and widespread vector Phlebotomuspapatasi (P. papatasi). Small numbers of other sandfly species were also screened for infections, but none was found. Sergentomyiasintoni and P. papatasi were the predominant members in all locations of this district and in all habitats throughout the trapping season. Only five other sandfly species were found, namely Phlebotomusansari, Phlebotomuscaucasicus, Phlebotomussergenti, SergentomyiadentataandSergentomyiamerviney. Conclusions: In the current survey, the only infections detected are of L. major in females of P. papatasi (30out of 190). The rates of infection of P. papatasi by L. major are not significantly different in comparison with other locations in Iran with no diversity of parasite strains. Zoonotic Cutaneous Leishmaniasis may have emerged only recently in Abarkouh district, and the reason may well be the instability of the transmission cycles there. Keywords: Zoonotic Cutaneous Leishmaniasis, Phlebotomuspapatasi, Leishmania major, Sand fly, Central Iran

58

O-13 Comparison of Echinococcus granulosus somatic antigens from adult worm (originating from culture media and dog intestine) and hydatid cyst for diagnosis of human cystic hydatidosis using western blotting MohammadzadehT, Sadjjadi SM, Shahriari B, Rahimi HR Dept. Parasitology and Mycology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran Introduction and objectives: For immunodiagnosis of human hydatidosis, the majority of methods have focused on antigens originating from metacestode stage. So, there is little information about diagnosis methods based on worm products. In this regards we evaluated and compared hydatid cyst fluid (HCF) and adult worm E. granulosus somatic antigens from culture media and dog intestine for diagnosis of human hydatidosis using western blotting. Materials and Methods: The somatic antigens were prepared from reared worms. More over a number of E. granulosus originating from experimentally infected dog intestine, utilized to produce somatic antigens. Both mentioned somatic antigens and hydatid cyst fluid were evaluated and compared using western blotting. In this regard, a total of 44, 31 and 30 sera samples from patient suffering from confirmed hydatidosis, other diseases and healthy controls were used, respectively. Results: Results of western blot showed that 22kDa subunits derived from cultivated adult worm antigens and 8, 16, 22 and 23 kDa subunits of HCF have the best sensitivity (81.8%) and specificity (96.7%), respectively. Agreement between results of two types mentioned subunits was 79%. Conclusion: Based on our findings, it can be concluded that adult worm antigens especially cultivated worm antigens that they are not infective to researchers have acceptable sensitivity and with the other antigens might be suitable candidate for diagnosis of human hydatidosis. Keywords: Hydatid cyst, E. granulosus, Somatic antigens, HCF, Adult worm, Western blotting

59

O-14

Evaluating the immunogenicity for plasmids encoding SAG3, SAG1 antigens of Toxoplasma gondii in BALB/c mice Sobati H1,Dalimi A2, Kazami B3,Ghaffarifar F2 1

Department of Biology, Faculty of Science and Research, Amam Hossein University, TehranIran, Graduate of Parasitology, Faculty of Medicine, Tarbiat Modares University 2

Department of Parasitology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran-Iran, 3Department of Parasitology and Cellular & Molecular Biology Research Center, Shaheed Beheshti University Tehran-Iran

Introduction and Objectives: Toxoplasma gondii is the intracellular protozoan parasite responsible for animal and human toxoplasmosis. SAG3 and SAG1 play an important role in invasive and attachment to target cells. In this study, we used complete major surface antigens 3 and 1 gens of Toxoplasma gondii as DNA vaccine cocktail.

Materials and Methods: Genomic DNA extracted by phenol–chloroform method and amplified by PCR method. The PCR products cloned into pBlue script plasmid and then confirmed by sequencing. Then, this gene subcloned into pcDNA3 and after transfection of Eukaryotic cell with pcSAG3, expression of this gene was confirmed by RT-PCR، SDS-PAGE and Western blot analysis.Afterwards, we investigated the efficacy of pcSAG1, pcSAG3 and pcSAG1 + pcSAG3 (DNA cocktail) in female inbred Balb/c mice against toxoplasmosis.

Results: Anti- T. gondii IgG, IgG1, IgG2a values (OD) increased markedly in the case groups, which were significantly higher than those of control groups (P0.05). Conclusions: Due to bacterial contamination in most used brushes, tested in this study, teaching students and encouraging them to follow the advice of modern dentistry are recommended. Keywords: Microbial contamination, Toothbrushes, Dental Health, Students P-51 Molecular characterization and antibiotic susceptibility profile of community acquired Staphylococcus aureus strains isolated from the carriers’ noses Japoni-Nejad A1, Kazemian H2, Ghaznavi-Rad E2 1

Student Research Committee, Arak University of Medical Sciences, Arak-Iran Departments of Microbiology and Immunology, Faculty of Medicine, Arak University Of Medical Sciences, Arak – Iran 2

Introduction and objective: Staphylococcus aureus is a persistent nosocomial and community acquired pathogen that causes a wide range of infectious diseases. The purpose of this study is to determine the resistance patterns and survey the molecular epidemiology of community isolates of Staphylococcus aureus in center of Iran. Materials and methods: A total of 568 nasal swabs were collected from healthy students at Arak university of Medical sciences located in center of Iran. All samples were subjected to S. aureus–specific isolation procedures. Antimicrobial resistance pattern was determined using panel of 18 antibiotics using disk diffusion method and molecular typing carried out by spa typing method. Results: As revealed,84 S. aureus strains were isolated from the anterior nares of 568 healthy students. 31 different spa types were found and the predominant Spa type among the S. aureus

235

isolates was t3204 in 17(20.2%) isolates. The susceptibility pattern of the isolates to the antibiotics were recorded in the following order: Gentamycin , Amicacin, Netilmicin, Cotrimoxazole, Oxacillin, Levofloxacin, Mupirocin, Dalfopristin Quinupristin, Ciprofloxacin, Vancomycin, , Cefoxitin, , Rifampicin, Linezolid, Fusidic acid, Clindamycin, Tetracycline, Tigecycline and Erythromycin were,100%, 100%, 100%, 100%, 100%, 98.8%, 97.6%, 97.6%, 97.6%, 93.9% 93.9%, 96.2%, 95.1%, 90.3%, 86.7%, 83.2%, 84.3%, 84.3% respectively. Similar Spa types have shown same resistance pattern. Conclusion: The present study illustrated increasing non-β lactam resistance in community acquired S.aureus. Therefore, clinicians should be aware of this baseline phenotypic and genotypic information for making treatment decisions particularly in empirical therapy. Continued monitoring of global epidemiology and emerging drug resistance data is critical for the effective management of these infections. Keywords: Antimicrobial resistance pattern, Spa typing, community acquired s.aureus

236

P-52 Investigation of Salmonella spp. contamination in Ducks and Turkeys eggs, consumed in Fars province Ghorbani ranjbaryA, Davary SM, Ghorbani Ranjbary N, Barzegar M , Jome zade MJ 1

Young Researchers Club, Kazerun Branch, Islamic Azad University, Kazerun, Iran

Introduction and Objectives: Salmonella is a short rod shape, gram-negative, nonencapsulated, aerobic and anaerobic options that cause food poisoning in humans. Raw food of animal origin, particularly meat and eggs of birds has an important role in transmission of this disease. Since duck and turkeys eggs are of much importance to transmission of Salmonellosis and consuming of local and non-industrial eggs of ducks and turkeys in this area is common, the present study was performed to clarify the prevalence of salmonella contamination. Materials and Methods: In the present study, 300, native ducks and turkeys eggs were collected and transferred to the lab. In Laboratory after sampling the surface of the egg, shells were disinfected with 80% ethanol and contents of 5 ducks and turkeys eggs, individually mixed in special dishes. After 24 h incubation at 37ºC with a swab in selenite - F broth were inoculated. Samples from selenite-F environment were transferred to Salmonella - Shigella agar. After incubation in 37ºC, colonies suspected to Salmonellawere evaluated. Suspicious colonies in the TSI and lysine decarboxylase environments were inoculated, And bacteria that had reactions with Salmonella, were studied by PCR with specific primers for Salmonellas and serotypes of Salmonella enteritidis and Salmonella typhimurium. Results: A total of 300 eggs of ducks and turkeys ,7 cases (2.3 percent) were contaminated with Salmonella, and from 7 unclean egg s shell , 1 case of turkeys egg shell (0.66%) was infected with Salmonella typhimurium; And 6 duck egg shell (4%) were infected, and all of the serotypes were Salmonella typhimurium. Conclusion: Considering the present study findings, and other research, it can be concluded that the Salmonella infection in the duck and turkey eggs were less than that in poultry eggs. And it seems that vertical transmission of Salmonella in the turkeys and ducks were less than that in poultry. Keywords: Salmonella, egg shells, Duck, Turkey

237

P-53 Serogrouping and drug resistance analysis of Salmonella spp. isolates from Broiler flocks Ghorbani ranjbary A1, ghorbani ranjbary N1, 3 ghorbani ranjbary Z2 1 2

Young Researchers Club, Kazerun Branch, Islamic Azad University, Kazerun, Iran . Khormshahar marine science, technology university, Iran.

Introduction and Objectives : Characterization of salmonella spp. isolated from broiler chickens in Kerman in iran, via serogrouping and drug resistance analysis to 7 commonly used antibacterial agents in Iranian poultry industry. Materials and Methods: 226 pooled samples were collected from 26 broiler flocks at different ages in Kerman. Standard culture method was employed for Salmonella isolation. The slide agglutination test was done using polyvalent antisera and different A-I serogroup-specific somatic antisera. Susceptibilities to 7 commonly used antibacterial agents in Iranian poultry industry (danofloxacin, enrofloxacin, flumequin, neomycin, florfenicole, lincospectin, tetracycline,) were tested by determining the MICs using agar dilution method. Results: Sixty two Salmonella were isolated from 26 broiler flocks and 226 pooled samples. Twenty five Salmonella from one day old chicks, 15 Salmonella from broiler flocks at 1-3 weeks and 22 salmonella from broiler flocks up 5 weeks were isolated. Fifty Salmonella isolates from broiler belonged to group D and 11 isolates belonged to group C. One Salmonella was found as an unknown serogroup. The resistance patterns of 62 isolates to 7 common commercial antibacterial in poultry industry of Iran were included 17 different patterns. 5 isolates were resistant to all 7 antibacterial agents. Conclusion: The highest resistance was associated with tetracycline and linco-spectin. This study could suggest a high incidence of Salmonella in broiler flocks in Kerman with high rates of drug resistance that could be a seen as potential of resistant Salmonella transfer to human. Keywords: Drug resistance, Antibacterial, Salmonella, Serogrouping, Broiler, Kerman.

238

P-54 Mycoplasma genitalium infection in women with cervicitis in Kermanshah Akya A1, Mansur Altaha S2, Ahmadi K2, Salimi A2 1

Nosocomial Infection Research Center, Kermanshah University of Medical Sciences, Kermanshah, Iran 2

Kermanshah University of Medical Sciences, Kermanshah, Iran

Introduction and Objectives: Sexually transmitted infections are among common diseases in societies and impose a large financial burden on families. Mycoplasma genitalium is a small bacterium that causes urethritis, cervicitis, vaginitis and endometritis. This study aimed to assess the frequency of M.genitalium infection in women with cervicitis in Kermanshah. Materials and methods: cervical samples were taken by swab from 239 women with cervicitis admitted to Kermanshah medical centers. Then bacterial DNA was extracted from samples using kits. Primers to determine operon MgPa gene of M. genitalium was prepared and used in PCR reactions. For each woman, data for signs and symptoms were also collected through a questionnaire. Results: of 239 samples, 11 (4.6%) were positive for M. genitalium. The positive samples were belonged to women older than 25 year. In women with abortion, 2 (4.5%) cases were positive but in women with infertilityM. genitalium infection was not found. Women with vaginal discharge and women used condom had the maximum and minimum rate of infection, respectively. Conclusion: The rate of infection is more or less similar to results from other countries. The active sexual age groups showed more infection rate. It seems that the using a contraception methodmay reduce the rate of infection for M. genitalium. Key words: Mycoplasma genitalium, PCR, Cervicitis, Kermanshah

239

P-55 Optimization ofPCRwithdifferentprimersfor the detection ofBrucella fromsera withDNAisolation byusingtheboiling method Zamanian M, Hashemi Tabar G.R, Rad M, Haghparast A. Department of Pathobiology, Faculty of Veterinary Medicine, Ferdowsi University of Mashhad, Mashhad, Iran. Introduction and Objectives: The detection of microbial nucleic acid for the diagnosis of infection is dependent on the successful separation of nucleic acid from clinical material. DNAisolation byboilingmethod for detection of Brucella is simple,reproducing, fast and effective.The aimofthis study wastooptimizePCRwith threedifferent primer pairsfor the detectionofbrucellosis inserum, using boiling method for DNAisolation. Materials

and

Methods:Inthisstudy, theserum

samples

weretakeninthe

acute

phase

ofbrucellosis.Three primerpairs B4-B5, F4-R2andJPF-JPR wereused. DNAswere separated byboiling.To eliminateorreduce the effects ofinhibitorsof thePCR, The resultingDNAwas diluted with ratios of1/100, 1/200, 1/300and1/500 and with each threepairs ofprimers; PCR wasperformed on all dilutions.With each PCR,apositiveandanegativecontrolwere set up. Results: In using of eachthreeprimer pairs, dilution of1 (DNA yieldedofboiling)was notdetectable. The bestdilutionsforB4-B5primer,was 1/100and1/200, forF4-R2primer1/100, 1/200,

1/300and1/500

and

for

JPF-JPRprimer

1/200,

respectively.Intotal,dilution

of1/200ofDNA,for each threeprimer pairs was appropriate. Conclusion:InPCRtestsfordetection ofBrucellaboiling method can

be used for DNA

isolation.Costs associated to PCRtestswould bereducedtoa considerableamount. Keywords:Brucellosis, Serum,Boiling, PCR

240

P-56 Phenotypic reviews of spread spectrum beta-lactamase and metalobeta lactamase enzyme frequencies in Pseudomonas aeruginosa isolated from burn wounds in Shahid Sadoughi burn hospital in Yazd Akhavan TaftiF, Zandi H, Mousavi SM, Mir Vakii M Shahid Sadoughi University of Medical Sciences-Yazd, Iran, Faculty of Medicine, Department of Microbiology Introduction and Objectives: Pseudomonas aeruginosa is a Gram-negative, non-fermentative bacteria which plays a major role in opportunistic infections in burn patients. It causes 10 to 15% of nosocomial infections.Treatment of patients with infections caused by these bacteria is difficult because its mechanisms are resistant to various antibiotics. The purpose of this study was to investigate the prevalence of extended spectrum beta-lactamase (ESBL) enzymes and Metalobeta lactamase (MBL) enzymes in Pseudomonas aeruginosa strains isolated from burn wounds. Methods: Antibiotic susceptibility test was performed by Kirby-Bauer methods according to CLSI standards, Combination Disk Method for ESBL enzymes and for MBL, Etest MBL was used. Results: Of the 180 samples cultured, 54 (30%) isolate as Pseudomonas aeruginosa was identified. 22% (12) of 54 isolates was ESBL posetive and 20.3% (11)was MBLproducer. Overall, 79.62%, 79.62 , 74.7%, 74.04%, 70.37%, 66.6%, 62.69%, of the isolates respectively, was resistant to erythromycin, ceftizoxime, imipenem,gentamycin, piperacillin, cefepime, meropenem, Ertapenem. Conclusion: The results of this study show that the prevalence of MBL and ESBLs enzymes and antibiotic resistance in burn patients is high and it is necessaryto determine susceptibility testing before treatment. Keywords: MBL, ESBL, Pseudomonas aeruginosa, resistance

241

P-57 Seroprevalence of Bordetella pertussis antibody in pregnant women Hashemi SH, Zamani M, Mamani M, Nadi E, Torkaman Asadi F, Javedanpoor R. Department of Infectious Diseases, School of medicine , Hamedan University of Medical Sciences , Hamedan , Iran Introduction and objectives: The increasing incidence of pertussis among adolescents and adults in recent years is an alarming factor in transmission of the infection to non-immune infants and children. Vaccination of pregnant women immediately after delivery and before discharging from the hospital may help to protect mothers and their newborns against the disease. Decision making process regarding maternal immunization requires credible information and knowledge about seroepidemiology of the infection in pregnant women. The aim of this study was to determine the seroprevalence of Bordetella pertussis antibody among admitted pregnant women in Hamedan, Iran. Materials and Methods: In this cross-sectional study, 288 pregnant women who were admitted to the Fatemiyeh hospital were entered into this study. After obtaining consent from every patient, serum samples were taken from patients and were frozen until testing. Serum level of B. pertussis antibody was measured using ELISA. Level of antibody higher than 24U/ml was considered to be positive. Obtained data was analyzed using the statistical software SPSS. Results: From 288 pregnant women, 126 of them (8/43%) were in the second trimester. Serological results in 103 patients (8/35%) were positive. The mean age of mothers with positive serology was 27.5±6 years old. Thirty-five percent of patients had a valid immunization record, and 1/57% of those with no vaccination record had a positive serology. Conclusion: The level of immunity against B. pertussis in pregnant women is low. Immunization before or during pregnancy can stimulate newborn‟s immune response and gives them required protection against pertussis infection. Keywords: Bordetaell pertussis, seroepidemiology, pregnancy, immunity.

242

P-58

Seroepidemiology of Helicobacter pylori antibodies in students of Golestan University of Medical Sciences, 1391

Azadi F1, Hedayat Mofidi M2, ArabAzadeh A2, HedayatMofidi H. S2, Gholamreza R1,Ghasemi-Kebria F1 1

Golestan Research Center of Gastroenterology and Hepatology, Golestan University of Medical Sciences,Gorgan, Iran 2

Golestan University of Medical Sciences, Gorgan,Iran

Introduction and objectives: Helicobacter pylori(HP)is the most common bacterial infection in the world, HP infectionmay be associated with chronic gastritis, pepticulcer disease, and gastric adenocarcinoma. This study aimed to determine the prevalence of HP in Golestan University of Medical Sciences (GOUMS)in1391,was performed.

Methods and materials: This cross-sectional study has been done to determineHP infection in287students ofGOUMS. Infection by serologic test and ELISA method, Ig Gand IgA were performed using kits Pishtazteb. SPSS-16 software was used for statistical analysis. (P value< 0.05)

Results: Of 287subjectsparticipated inthestudy,239patients (83.3%) were infected with HP. The positive rate of91.1% malesand79% females, the significant relationship between HP infection and gender was observed (P =0.03).The positive rate of the three groups of varying ethnic Persian, Turkoman and other subdivisions are respectively 84.21%, 81% and84.6% . Between HP infection variables: age, place of residence, hesitancy and degree correlation was found.

Conclusion:The resultsof this studyindicatea highprevalence ofHP infection instudentsof GOUMS. Due to the high prevalence of the infection in the province as well as the high incidence of esophageal and gastric cancers in this area, it is necessary, especially in high risk individuals. Therefore, it is recommended to accurately determine factors associated with this infection studies done in this area.

243

Keywords:H. Pylori, Antibody, students, Golestan.

P-59 Mutations in the 23S rRNA gene of clarithromycin-resistant Helicobacter pylori in patients with gastrointestinal disorders in Isfahan city, central Iran Khademi F1, Faghri J1 , Poursina F1 , Ghasemian Safaei H1 Department ofMicrobiology, Isfahan University of Medical Sciences, Isfahan, Iran Introduction and Objectives: Helicobacter pylori (H. pylori) is a Gram-negative, flagellate bacillus, micro aerophilic, spiral bacterium that colonizes the stomachs of approximately half the world‟s population. H. pylori antimicrobial resistance is the important factor responsible for treatment failure. The purpose of this study was evaluating the prevalence of point mutations in clarithromycin-resistant clinical isolates of H. pylori. Materials and methods: The MIC for thirty clinical isolates of H. pylori was determined by Etest method. The point mutations in the 288 bp of 23S rRNA gene was investigated in 4 clarithromycin-resistant clinical isolates by PCR followed by sequencing. Results: Among 30 isolates of H. pylori, 4 cases were resistant to clarithromycin. In this study the MIC of 4 isolates resistant to clarithromycin were MIC= 1.5, 2, 2 and 4 µg/ml. One point mutation was found at position T2243C in the 23S rRNA gene. Conclusions: In our study, H. pylori resistance to clarithromycin was associated with point mutation at position 2243(T2243C). It is necessary to study whole gene of 23S rRNA for finding the other point mutations in future. Keywords: Helicobacter pylori, clarithromycin resistance, point mutations

244

P-60 The spectrum of bacterial infection in neonates with suspected sepsis Dehghan F1, Shafii A1, Zolghadri N3 1 2

Khalij Fars Hospital, Bandarabbas, Iran Islamic Azad University, Bandarabbas, Iran

Introduction and Objectives: Neonate sepsis is one of the most important causes of neonatal morbidity and mortality. The objective of this study was to determine the most frequent bacteria which cause neonatal sepsis and their antibiotic susceptibility patterns. Material and methods: This study was performed on 163 neonates who suspected to sepsis and admitted to pediatric ward of Khalij Fars Hospital, Bandarabbas, Iran since March until December 2012. After conventional blood culture has been done to isolate probable bacteria which are responsible for sepsis; antibiotic susceptibility test was done. Consequently obtained results statistically tabulated by proper software. Results: In this study 14(8.6%) positive Blood cultures were found. Most common bacterial agent was belonged to gram negative non-fermenter bacilli, mainly was Acinetobacter baumanni(28.6%) and Pseudomonas aeroginosa(14.3%).Gram positive bacteria like coagulase negative Staphylococcus(28.6%) and Streptococcus viridance(7.1%) was also detected. Rest of them was belonged to gram negative bacilli such as E.coli(14.3%) and Klebsiella pneumonia(7.1%). The maximum antimicrobial susceptibility of gram negative organisms was to cefotaxim(87.5%) as well as Gentamicin(87.5%). The gram positive ones were to Ampicillin(66.6%). Conclusion: According to our observations, as gram negative non-fermenter bacilli formed a remarkable percent of sepsis, therefore, it should be considered in strategy of treatment selected by physician. Recommended antibiotics for these were Gentamicin and cefotaxim. Keywords: Neonate sepsis, bacterial infection, antibiotic susceptibility

245

P-60 The spectrum of bacterial infection in neonates with suspected sepsis Dehghan F1, Shafii A1, Zolghadri N3 1 2

Khalij Fars Hospital, Bandarabbas, Iran Islamic Azad University, Bandarabbas, Iran

Introduction and Objectives: Neonate sepsis is one of the most important causes of neonatal morbidity and mortality. The objective of this study was to determine the most frequent bacteria which cause neonatal sepsis and their antibiotic susceptibility patterns. Material and methods: This study was performed on 163 neonates who suspected to sepsis and admitted to pediatric ward of Khalij Fars Hospital, Bandarabbas, Iran since March until December 2012. After conventional blood culture has been done to isolate probable bacteria which are responsible for sepsis; antibiotic susceptibility test was done. Consequently obtained results statistically tabulated by proper software. Results: In this study 14(8.6%) positive Blood cultures were found. Most common bacterial agent was belonged to gram negative non-fermenter bacilli, mainly was Acinetobacter baumanni(28.6%) and Pseudomonas aeroginosa(14.3%).Gram positive bacteria like coagulase negative Staphylococcus(28.6%) and Streptococcus viridance(7.1%) was also detected. Rest of them was belonged to gram negative bacilli such as E.coli(14.3%) and Klebsiella pneumonia(7.1%). The maximum antimicrobial susceptibility of gram negative organisms was to cefotaxim(87.5%) as well as Gentamicin(87.5%). The gram positive ones were to Ampicillin(66.6%). Conclusion: According to our observations, as gram negative non-fermenter bacilli formed a remarkable percent of sepsis, therefore, it should be considered in strategy of treatment selected by physician. Recommended antibiotics for these were Gentamicin and cefotaxim. Keywords: Neonate sepsis, bacterial infection, antibiotic susceptibility

246

P-62 Infective endocarditis among intravenous drug users Abbasi A¹, Besharat M² ¹Bushehr Unversity of Medical Sciences, Bushehr, Iran ² Shaheed Beheshti Medical University, Tehran, Iran Introduction and Objectives: Infective endocarditis is a common infection among intravenous drug users and can cause high mortality and morbidity. Materials and Methods: In a retrospective study, we evaluate 33 intravenous drug users with documented infective endocarditis in two tertiary care hospitals in Tehran, Iran; Imam Hosein and Loghman Hakim hospitals during 6 years. Demographic information, clinical manifestation, radiologic, laboratory and echocardiographic data were evaluated. Result: Eighty two percent of patients were in 20-40 year old age group. The most common symptoms were fever, cough, dyspnea and lower extremities edema. The most common involved valve was tricuspid with frequency of %45, followed by mitral, aortic and pulmonary valves. Anemia was observed in 95%, leukocytosis in55%, thrombocytopenia in 35%, leukopnea in 10% and elevated ESR in 70% of patients. Of our patient 3 were HIV and 2 were HCV positive. Positive blood culture was observed only in %40 of cases that may be due to sampling error or previously antibiotic missuse by patients. The most common isolated organism was Staphylococcus aureus. Mortality rate was 55% in our study. Conclusion: Endocarditis in intravenous drug users was with high mortality rate in this study. Positivity of blood culture was low. Keywords: Endocarditis, intravenous drug users, mortality

247

P-63 Iatrogenic Botulism; complication of Botulinum toxin injection for treatment of hyperhydrosis Abbasi F¹, VahdaniP ² ¹Bushehr University of Medical Sciences, Bushehr, Iran ²Shaheed Beheshti Medical University, Tehran, Iran Introduction and Objectives: Therapeutic use of botulinum toxin type A is usually effective and safe. Iatrogenic botulism presents with generalized weakness, dysphagia, and respiratory distress and is a rare but significant complication of botulinum toxin type A treatment. Materials and Methods: The patient was a 24 year old man with chief complaint of bilateral ptosis and progressive weakness of upper and lower extremities, nasal speech, diplopea, dysphagia and dyspnea. In past medical history there was not any canned food consumption, traveling, and contact with ill patient or animal. He did not suffer from any neurologic disease. The patient has had several injection of Botox (botulinum toxin) in the palms due to hyperhyrosis of both hands. The injection was done by dermatologist in 40 points of each hand. He received 1000 units of Botox totally. According to disease course and history of Botox injection iatrogenic botulism was diagnosed. Blood sample was taken for evaluation of botulism. Polyvalent botulinum anti-toxin was started. Gerenaral condition gradually improved. After three weeks he was discharged from hospital without any complication while he could eat, drink and walk. Result: In this case conservative management and anti-toxin provided good outcome. Conclusion: Clinicians should be mindful of the risk for systemic botulism when using local injections of the neurotoxin. Keywords: Botulism, iatrogenic, botolinum toxin

248

249

P-64 Tubercolosis Spondylitis (Pott’s disease) in Iran, evaluation of 40 cases AbbasiF¹, Besharat M ² ¹ Bushehr University of Medical Sciences, Bushehr, Iran ² Shaheed Beheshti Medical University, Tehran, Iran Introduction and Objectives: Because of the increased incidence of tuberculosis in recent years, infective spondylitis is still a major problem in the world. Symptoms of spinal tuberculosis are often nonspecific, and the clinician should be aware of this health issue. Materials and methods: In aretrospectivestudyduring 8 years, we evaluated 40 cases with documented tuberculosisspondylitis in Loghman hospital, Tehran, Iran. Epidemiologic aspects,clinicalmanifestation, laboratory tests and radiologic studies were evaluated Results: Of our patients, 25 (% 62.5) were men and 15 (% 37.5) were women. Theoldest was 77 and the youngest was 17 years old. Average of age was 47 years.Involved vertebras were as follow: cervical 10%, thoracic 37.5%, thoracolumbar 27.5% and lumbar 25%.Accompanying diseases were pulmonary TB (%72), TBpleural effusion (% 18), paraspinal abscess (%18) and renal TB (% 2.5). Clinical manifestation were backpain in %100, anorexia in %100, fever in % 90, cough in % 53 and limb paralysis in% 2.5of patients.Erythrocytesedimentation rate (ESR) between 50-125 mm was detected in %35, between 20-49 mm in %15and less than 20 mm in % 10 of patients. Conclusion: Prompt diagnosis and treatment of skeletal TB are important to prevent serious bone and joint destruction and severe neurologic sequelae. Keywords: Tuberculosis, spondylitis, Pott‟s disease

250

P-65 Designing TaqManReal-time PCR for rapid detection of Streptococcus pneumoniae Aghamiri F1, Soleimani M2, Majidzadeh K3, Mohseni AH4 Tasnim Biotechnology of Research Center (TBRC), AJA University of Medical Science, Tehran, Iran Introduction and objectives: Streptococcus pneumoniae is a major cause of meningitis in children. The classic diagnosis of S.pneumoniae such as gram staining, culturing and serological tests is limited by antibiotic therapy that is false negative and time consuming. The aim of this study was to establish a Taqman PCR tests for specific detection of S.pneumoniae. Materials and Methods: ply gene was used and specific primers and probe were designed based on FAM and BHQ1 dyes as labels of the target gene. For evaluation of specificity of primers conventional PCR was done on standard positive control that was made in previous step, then Taqman Real-Time PCR method was used for polygene. Sensitivity of the primers and probe were examined through 10ˉ1 to 10ˉ8 serial dilutions of plasmid DNA with starting concentration of 2 ng/µl. Standard curve was designed and R2 value; slope and efficiency were calculated. Specificity was determined by Taqman Real time PCR in genomic DNA of a variety of bacteria. Results: PCR results for assessment of Taqman real time PCR method showed a band of expected size 197 bp. Taqman Real time PCR results showed specific amplification of ply gene. Sensitivity test indicated that the limit of detection of the assay was 2 fg and the results of standard curve showed Slope = -3.5; Efficiency = 91%; R2 = 1.No amplification was observed by Taqman Real time PCR in negative control bacteria. Conclusion: Knowing that traditional methods are time consuming and limited by prior antibiotic therapy in addition to having low sensitivity and specificity, the results of this study showed a higher sensitivity and specificity. Therefore, this method is a simple, rapid, sensitive and specific test for the detection of S. pneumoniae. Keywords: Streptococcus pneumoniae,Taqman Real-time PCR, Rapid detection

251

P-66 In vivo bactericidal study of melittin derived from honey bee in mouse peritoneum cavity Pooshang Bagheri K, Momenzadeh M, Shahbazzadeh D Pasteur Institute of Iran, Biotechnology Research Center, Biotechnology Dept, Laboratory of Venom and Biotherapeutics molecules, Tehran-Iran Introduction and Objectives: Bacterial peritonitis followed by dialysis is a major clinical concern. During the past decades, morbidity and mortality of bacterial peritonitis have been reported from many countries. Conventional antibiotic regimens are not completely effective regarding epidemiology of drug resistant bacterial strains. Concerning these facts, tracing for new antibiotics with no fear to antibiotic resistance has been considered. Natural peptides purified from plants, vertebrates, insects, and venomous animals are good candidates. In this study melittin, a peptide from honeybee venom, selected for in vivo study of antibacterial activity against Pseudomonas aeruginosa, Staphylococcus aureus and Escherichia coli in a mouse model. Materials and Methods: Melittin isolated from Iranian honeybee, using Reverse Phase-HPLC. In vitro bacteriostatic and bactericidal activity examined with micro-broth dilution assay and colony count. Toxicity of melittin evaluated in mouse peritoneum cavity before in vivo assay. In vivo bactericidal activity performed in peritoneal cavity of a mouse model, BL6/C57, for each bacterium in a time manner. Results: Honey bee venom is composed of twenty distinct fraction in which melittin was the major one. The growth of Escherichia coli, Staphylococcus aureus, Pseudomonasaeruginosa were inhibited at 0.39, 6.25, 12.5 µg and killed at 1.56, 25, and >50 µg respectively. No toxicity was observed in abdomen cavity. The number of bacteria in test group was significantly reduced, compared to that in control group. Conclusion: Melittin specifically invade the bacteria and had significant bacteriostatic and bactericidal effect on bacterial agents of bacterial peritonitis. The results demonstrated that melittin was not toxic in abdomen cavity. According to the obtained results, melittin could hopefully be used as antibiotic for treatment of bacterial peritonitis. Key words: Bacterial Peritonitis, Melittin, Antimicrobial Peptide, Animal Model, Bactericidal Activity

252

P-67 Microbiological pattern and antibiotic susceptibility of agents isolated from nosocomial infections, staff and equipment of Surgery section and ICU of Imam khomaini hospital, Ilam Pakzad I1.4,Akaram Nejad Z2.3, Khodayari F2.3, Azizian R1.4,Bimanand L1.4 ,Azizi Jalilian F4, Taherikalani M4, Hamidi M6 1

Clinical Microbiology Research Center, Ilam University of Medical Sciences

2

Student Research Committee, Ilam University of Medical Sciences

3

Dep. Nursing, Faculty of Nursing and Midwifery, Ilam University of Medical Sciences

4

Dep. Microbiology, Faculty of Medicine, Ilam University of Medical Sciences, Ilam, Iran.

5

Dep. of Pharmaceutical Biotechnology, Tabriz University of Medical Sciences.

Introduction and objectives: Resistant bacteria in various sections of hospital as a main issue of infection transmission are undeniable. Thereby, to achieve infection disease control on hospital, bacteria recognizing and antibiotic resistance determination is necessary. This study aimed to determine the pattern of microbial resistant of isolates isolated from surgery ward and ICU and compare it with nosocomial infection isolates. Material and Methods: In a descriptive and cross-sectional study, during 6 months sampling was carried out from devices and personnel of surgeryand ICU ward. In same period Nosocomial infections from surgery and ICU wards were cultured. Bacteria on Standard criteria according to CLSI were diagnosed. Antibiotic susceptibility was determined according to Kirby-Bauer Disk Diffusion. Result: After culturing, 130 samples were found to be positive, the most frequency of isolated bacteria in both wards were Staphylococcus saprophyticus. Most frequent bacteria in ICU and Surgery ward involved; Entrobacter (35%) and E.coli (25%), in a row. In nosocomial infections, frequency of samples that cultured were positive included in; Lesion (45%), Sputum(42.5%) and Urine(12.5%).E.coli, Klebsiella and Staphylococcus aureus isolated from ICU shown high resistance to Ampicillin, Ceftazidime/Cefotaxime , Ceftriaxone, respectively. Whereas bacteria that isolated from Surgery ward shown high resistance to Tetracycline, AmoxicillinTetracycline, Ceftriaxone. Conclusion: Regarding resistance pattern, there is a correlation between resistance of species isolated from personnel and devices with nasocomial isolates. Therefore, it could be concluded that devices and personnel have a main role to disseminate infection. Thereby, the proper disease control policy could be so useful to combat with issue.

253

Keywords: Antibiotic susceptibility, Resistant Bacteria, ICU, Surgery, and Hospital acquired infection.

254

P-68 Antimicrobial activity in enzymatic hydrolysates of hen egg- white Hajipour L1, Aminlari M1, 2 1

Department of Food Science and Technology, School of Agriculture,

2

Department of Biochemistry, School of Veterinary Medicine, Shiraz University, Shiraz, , Iran

Egg-white proteins exert a wide range of nutritional, functional and biological activities. Many egg-white proteins possess specific properties that make these components potential ingredients of health-promoting foods. Increasing attention is being focused on physiologically active peptides derived from egg-white proteins. These peptides are hidden or inactive within the sequence of the parent protein molecule and can be liberated by special enzymatic systems. Depending on the amino acid sequence, these peptides may exert a number of different activities in vivo, including opiate-like, mineral binding, immunomodulatory, antimicrobial, antioxidant, antithrombotic, hypocholesterolemic and antihypertensive actions. Milk and dairy products, eggwhite, meat, legumes and soybean are rich sources of bioactive peptides. The aim of this study was to produce bioactive peptides from egg-white proteins using trypsin and ficin and to isolate and determine their antimicrobial property. The egg-white proteins were hydrolyzed by trypsin (0.1 mg/ml) and ficin (8 and10 mg/ml) and the hydrolysates were subjected to gel-filtration and ion- exchange chromatography to separate the peptides produced. The bioactive properties of the fractionated peptide were determined. Most of the ficin- and trypsin-produced peptides of the egg-white, which were eluted at the final stage of gel-filtration and ion-exchange chromatography showed the highest antimicrobial properties against E. Coli and Bacillus Cerus. Taken together, these results suggest that protease-produced peptides from egg-white might substitute antimicrobial agents with chemical origin. Keywords: Bioactive peptides, Gel filtration, Ion exchange, ficin, trypsin

255

P-69 Prevalence of Atypical Mycobacteria in Shiraz Tuberculosis reference laboratory affiliated to Shiraz University of medical sciences (2012-2013) Rezaei M1, Emami A1, Sami kashkooli G1,Tavakolian V1, Kalari M1,Honarvar B2, Farahbakhsh A3, Goharnezhad J1, Shafiyan Sh1, Farzanfar E1, khosravani M3. 1

Mycobacterium Research Center, Shiraz Reference laboratory of Tuberculosis, Shiraz University of Medical Sciences, Shiraz, Iran 2 Health Policy Research Center (HPRC) 3 Shohadaye Enghelab health center Introduction and objectives: According to the importance of the various other acid-fast bacilli (AFB) (M. avium, M. Kansaci, M. Chelonei, introduced as atypical mycobacterium (NTM)) in Shiraz TB reference laboratory, besides Mycobacterium tuberculosis complex (MTBC), these bacteria have been either cultured from respiratory and other secretions samples. Recently it has been proved that these groups of AFB are more important in immunocompromised patients. Newly role of these NTM is important in pulmonary and other organ failer diseases. In certain parts of the world, as much as 20% of newly diagnosed mycobacterial pulmonary disease, softtissue and disseminated disease is caused by these organisms. Differentiation of atypical Mycobacteria from MTBC is essential for appropriate treatment choice. Materials and Methods: In this study, biochemical tests included niacin and nitrate reduction was performed for positive culture samples after observing colonies growth rate and their ability in pigment producing. Colonies were negative for nitrate and niacin test were confirmed by non detection of IS6110 gen (specific gen for MTBC detection) by molecular methods. Results: Among 190 positive culture cases on Lowenstein-Jenson media, 14 cases were known as atypical Mycobacterium according to the faster growth rate and abilityof producing pigments. Among these 14 colonies, all were negative for IS6110 either which confirmed NTM pattern. Conclusions: In our study results, showed that 14 (7.3 %( of imunocompromised patients are infected with atypical mycobacteria. According to the importance of the NTM strains detection, highly recommended to stablish more tests for identification and differentiation of NTM strains. Keywords: Atypical mycobacteria, Niacin test, Nitrate reduction test, Shiraz

256

P-70 The Identification and antimicrobial resistance of Pseudomonas aeruginosa in burn patients referring to Emam Mousa Kazem Hospital– Isfahan Moghoofee M, Fazeli H, Ghasemian H Department of Bacteriology and virology, Isfahan University of Medical Sciences, Isfahan, Iran Introduction and Objectives: Nosocomial infections in burn patients are a major medical problem in the world. Pseudomonas aeruginosa is recognized as a serious issue worldwide. Rising resistance of P. aeruginosa to antibiotics causes increasing intreatment costs and mortality rate in these patients.The purpose of this study is to identify Pseudomonas aeruginosa by molecular methods and study the resistance pattern of this bacterium to antibiotics; imipenem, meropenem, amikacin, ceftazidime, ciprofloxacin, aztreonam, gentamicin and polymyxin B in burn patients. Materials and Methods: In this cross-sectional study, 31 P. aeruginosa strains obtained from clinical samples of burned patients in Emam Mousa kazem hospital of Isfahan. P.aeruginosa wasidentified by biochemical tests including Gram staining, oxidase, SIM and O-F tests. The isolates were confirmed by PCR method with ITS primers. Then antibiotic susceptibility tests were performed for imipenem, Meropenem, amikacin, ceftazidime, ciprofloxacin, aztreonam, gentamicin and polymyxin B by disk diffusion method according to CLSI (Clinical and Laboratory Standards Institute). Minimum inhibitory concentration (MIC) was measured by Etest method for imipenem, meropenem and amikacin. Results: The results of PCR were recognized all the Pseudomonas aeruginosa isolates. Antibiotic susceptibility test showed resistance rates imipenem, meropenem, amikacin, ceftazidime, ciprofloxacin, aztreonam, gentamicin and polymyxin B 70%, 70%, 48%, 80%, 80%, 74%, 77%, 0%, respectively. The results of MIC test identified all strains resistance to imipenem (MIC≥16), 22 strains were resistance to meropenem (MIC≥16) and 6 strains were resistance to amikacin (MIC≥96µg/ml). Fifty out of 31 (48%) strains were resistant to 8 antibiotics. Conclusions:Using molecular methods is recommended for accurate and rapid identifying of P. aeruginosa. The current study showed an increase rate of antibiotic resistance. Given the increasing incidence of MDR strains of P. aeruginosa, the appropriate antibiotic selection to begin treatment is necessary to optimizing the clinical results. Antibiotic resistance patterns should be investigated for burned patient by the time. Keywords: Pseudomonas aeruginosa, Antibiotic resistance, PCR

257

P-71 Prevalence of hand and nasal carriage of Staphylococcus aureus among hospital staff and antibiotic resistance pattern in educational centers of Sari. 2012-2013 Ahanjan M, Abdollahei S, Abdoli H, Mohammad nejad FZ Introduction and Objectives: Methicillin-resistant Staphylococcus aureus is a common pathogen responsible for health-care-associated infections. Healthcare workers (HCWs) are the main reservoir for S. aureus transmission to patients. Identification and nasal decolonization in healthcare workers colonized with S. aureus may aid in the development and reinforcement of infection control strategies. The aims of this study were to identify the prevalence of hand and nasal carriage of S. aureus among hospital staff, to analyses their antibiogram with special reference to methicillin resistance. Materials and Methods: This cross-sectional study was conducted in 1391. 148 health workers from different parts of Sari city hospitals participated. Sampling was conducted every individual fingers and Sterile swabs were used to collect the samples from the anterior nares. Samples were cultured on mannitol salt agar immediately. The isolation of S. aureus and their antimicrobial susceptibility patterns were carried out by standard bacteriological procedures. Suspected colonies of Gram strain, catalase and coagulase tests were identified. Susceptibility testing was performed by disk diffusion method. Results:S. aureus carrier status was observed in 24 individuals (16.2%) in this study, and (9.5%) of population were resistant to methicillin. The highest percentage of carriers of S. aureus was in the operation room- angiography staff and internal pediatric ward. All strains were sensitive to vancomycin and Chloramphenicol and resistant to Penicillin and Amoxicillin. Conclusions: The prevalence of the S.aureus carriage in Survey Educational hospitals staff, compared to similar studies conducted in hospitals in Iran is low. This study showed that the prevalence of MRSA in hospitals and even different departments of a hospital is a significant difference. So appearance and spread of antibiotic-resistant strains can be prevented by removal of predisposing conditions and appropriate use of antibiotics. Keywords: MRSA, Nosocomial Infection, Hand, Nasal

258

P-72

Evaluation the prevalence of extended-spectrum beta lactamaz type 1 at acinetobacter isolations from clinical specimen at educational hospitals of Sari city 1392

Ahanjan M, KholdiS

Mazandaran university of medical sciences

Introduction and Objectives: Prevalence of class an extended-spectrum -lactamases (ESBLs) has been investigated in Acinetobacter baumannii. The aims of this study were to determine the prevalenceof class A ESBL-producing A. baumannii and to characterize the genotypes.

Material and Methods: During the period of January to June 2013, clinical isolates of A. baumannii was collected from burn patients in Zare Hospital, Mazandaran University of medical sciences. Antimicrobial susceptibility was determined by the disk diffusion and Etest methods, and ESBLproduction by the double-disk synergy test. Searches for blaTEM, blaSHV, blaCTX-M, blaPER-1, blaVEB, and blaGES/IBC genes were performed by PCR amplification, and the genotypes of ESBLs were determined by a direct nucleotide sequence analysis of the amplified products.

Results: A total of 60 clinical isolates of A. baumannii seven (11.66%) isolates of A. baumannii isolates showed positive results in the double-disk synergy test using ceftazidime and ceftazidime –clavlunic acid disks, and cefotaxime, cefotaxime-clavlunic acid.The most prevalent class A ESBL genotype in A. baumanniiisolates was blaPER-1 (n=7).

259

Conclusions: It is concluded that class A PER-1 ESBL-producing A. baumannii isolates are spreading, has emerged in this hospital. The spread of class A ESBLs could compromise the future usefulness of expanded-spectrum -lactam antibiotics for the treatment of A.baumannii infections.

Key Words:Acinetobacter baumannii, Class AN ESBL, Sari

260

P-73 Bacteruria associated with nephrolithiasis: pre-operative evaluation of 8375 patients candidate for percutaneous nephrolithotomy (PCNL) Hosseini MM, Irani D, Aminsharifi AR, Ghahramani L, Eslah A, Yousefi A , Inaloo R, Abbasi MZ Endourology Unit of Urology Department, Shiraz, Jahrom and Bushehr Universities of Medical Sciences, Shiraz, Iran Introduction and Objectives: Patients who have nephrolithiasis and schedule for operation may have symptomatic or asymptomatic bacteruria, which should be treated before intervention. We evaluated our patients for prevalence of bacteruria before PCNL. Material and Methods: Eight-Thousand Three-hundred seventy-five patients, 5814 men, 2561 women, mean age 38.2 years(17-79), evaluated including complete blood count, renal function, excretory urography, urine analysis and culture preoperatively. In this study we recorded the prevalence of bacteruria. Results: Of 8375 patients, 5638 were first episode of stone formation and 2737 had recurrent diseases. Overall 1091 patients had bacteruria (13.02 %), which is more common in recurrent group (n=504, 18.4% vs.587, 10.4%). Symptomatic bacteruria also was more common in recurrent cases (n=118, 4.3% vs. n= 94, 1.6%). Conclusions: Bacteruria is a common finding in patients with nephrolithiasis, that seems is more common in recurrent diseases, so, urine culture and appropriate treatment highly recommended before any intervention for prevention of serious complications such as infection and sepsis. Key words: Bacteruria, Nephrolithiasis, Percutaneous Nephrolithotomy

261

P-74 Co-existence of methicillin resistance and adherence genes in Staphylococcus aureus ValikhaniM1, Arbab Soleimani N1, Tajbakhsh E2 1

Department of Microbiology, Damghan Branch, Islamic Azad University, Damghan, Iran.

2

Department of biology, ShahreKord Branch, Islamic Azad University, Shahrekord, Iran.

Introduction and Objectives: Scientists are of the conviction that attachment is one of the initial steps of bacterial Pathogenesis. Methicillin Resistant Staphylococcus aureus (MRSA) containing mecA gene can has the gene involved in attachment, called, icaA.The aim of this study was toinvestigation of co-existence of mecA and icaA genes in MRSA. Material and Methods: In this study, 40 samples of human wounds were prepared from Shahrood‟s Hospitals and S.aureus ATCC 25923 was used as control. To study antibiotic resistance, Kirby – Bauer method was used. Biofilm formation was investigated by 96 microtiter plate method Slime production was done by Congo Red Agar (CRA) method. Coexistance of mecA and icaA genes was studied by multiplex PCR.. Results: 20 isolated S.aureus was recognizing as MRSA which were able to produce biofilm and slime too. Multiplex PCR proved that all isolated MRSA had both mecA and icaA genes simultaneously. Conclusions: According to this research, Methicillin Resistant S. aureus which could produce Biofilm and Slime can has both mecA and icaA genes simultaneously which can help MRSA to cause disease. Key words: MRSA, co-existence, mecA, icaA

262

P-75 A Study of nosocomial infections caused by urinary tract infection in comparison with urinary tract infection of outpatients in Shahid Faghihi Hospital in Shiraz from 2012 to 2013 Motevasel M1, OkhovatM.A1, SalehzadehF2, MobarhanfardA2, YarmohammadiA3 1

Diagnostic Laboratory Sciences and Technology Research Center, Faculty of Paramedical Sciences, Shiraz University of Medical Sciences, Shiraz, Iran. 2 Student Research Committee, Shiraz University of Medical Sciences, Shiraz, Iran. 3 Shahid Faghihi hospital, Shiraz University of Medical Sciences, Shiraz, Iran. Introduction and Objectives: Nosocomial infections are the major cause of morbidity and mortality. These infections usually occur after 3 days of hospitalization in patients whom the infection was not present or incubating at the time of admission.Urinary tract infection is by far the most common nosocomial infection due to using of bladder catheters. It is detected by positive urine culture with 105 bacteria per ml of urine. In this study, 703 inpatients and outpatients who were admitted to Shahid Faghihi Shiraz hospital were studied from 2012 to 2013. Materials and Methods: Clinical characteristics were extracted from hospital records. Urinary tract pathogens were isolated from urine samples of patients and diagnosed by conventional microbiology methods. Then the antibiotics sensitivity of bacteria was determined by disk diffusion agar technique. Finally, collected data and information were analyzed statistically by SPSS in terms of age, sex, location of infection, type of bacteria and drug sensitivity. Results: UTI incidence was 27.5% in the 50-70 age group and 26% in 20-40 age group. 55.6% of hospitalized patients and 44.4% of outpatients represented UTI prevalence. 65.9% of females and 34.1% of males were infected by UTI. E.coli in 72.8% of outpatients and Enterococcus in 26.3% of inpatients was isolated. Isolated E.coli was resistant approximately 99% to amoxicillin and tetracycline, whereas detected Enterococcus was resistant 100% to tetracycline and nalidixic acid. Conclusions: This study shows that urinary tract infections are sex dependent and are seen in females significantly more than in males. Likewise, UTI is more likely to be seen in the age of sexual activity and in late middle age with the onset of weakness in immune system. According to this study, E.coli is more common in outpatients; however Enterococcus is prevalent in hospitalized patients. E.coli becomes resistant to amoxicillin and tetracycline, whilst Enterococcus becomes resistant to tetracycline and nalidixic acid. Key words: Urinary tract infection - Nosocomial infection – drug resistance

263

P-76 Comparison of wound infection in hospitalized patients and outpatients in Shahid Faghihi Hospital in Shiraz from 2012 to 2013 Motevasel M1, OkhovatM.A1, Salehzadeh F2, MobarhanfardA2, KhosraviA2 1

Diagnostic Laboratory Sciences and Technology Research Center, Faculty of Paramedical

Sciences, Shiraz University of Medical Sciences, Shiraz, Iran. 2

Student Research Committee, Shiraz University of Medical Sciences, Shiraz, Iran.

Introduction and Objectives: Wound infection is one of the most common causes of nosocomial infections. Skin lesions are defined as tiny microscopic scratches to the widest abdominal and pelvic abscesses. Bacterial resistance in this type of infections can lead to lots of difficulties and impose financial burden to public health.This study has been done based on presenting current pattern of isolated bacteria and their drug resistant. Materials and Methods: Pathogens were isolated from 200 patients and diagnosed by conventional microbiology methods. Then the antibiotics sensitivity of bacteria was determined by disk diffusion agar technique. Finally, collected data and information were analyzed statistically by SPSS in terms of age, sex, site of infection, type of bacteria and antibiotic resistance. Results: In this study, the prevalence of males and females was 54.9% and 45.1% respectively. The highest incidence of wound infection was in 20-40 and 50-70 age groups. 89.4% of hospitalized patients and 10.6% of outpatients represented wound infection frequency. The most common microorganism was Staphylococcus aureus among both inpatients and outpatients. It is worth noting that S. aureus isolated from patients was resistant 100% to a wide range of antibiotics. Conclusions: In this research, wound infections are detected more in men compared to women, probably because of social activities. Moreover, these infections are prevalent in the age group who have considerable social activities and among people that their immune systems are gradually becoming weaker. Wound infections in hospitalized patients are higher than outpatients owing to high incidence of nosocomial infection associated with ulcers. The most common isolated pathogen is S.aureus with high drug resistance to the most of antibiotics.

264

Key words: Wound infection, nosocomial infection, drug resistance

265

P-77 The study of preservative effects, antibacterial and antioxidant activity of Silybum Marianum on rainbow trout (Oncorhynchus mykiss) in vitro Mirzaei M1, Mohammad Taghipour L1, ShiraziG2, Mollasoltani F3 1

Food Hygiene and Quality Control, Shahrkord university, Iran

2

Genetic Department, Shahrkord university, Iran

3

Biochemistry Department, Rasht university, Iran

Introduction and Objectives: During recent years, increasing side effects for syntactic drugs have been motivated by more researchers for finding new compounds of the plant with antmicrobial activity and preservative effects. Dried fruits extract of Silybum.Marianum contain flavonoid compounds and until now, no studies have been conducted on the antimicrobial activates and preservative effects of methanolic extract of this plant. Materials and Methods: In this study the effects of S.Marianum extract on the shelf life of whole, vacuum-packaged rainbow trout, Stored under refrigeration (4±1 Cº) were studied by monitoring the microbiological (total viable count, psycrotrophic ) , chemical (PV,TBA,FFA), pH and sensory changes for a period of 20 days. Result: S.Marianum extract significantly (P 0.5 to 1). Conclusions: The essential oils of H. perforatum can be used as a natural potential source for pharmaceutical or food industries.

Keywords: Hypericum perforatum, Anti-Inflammatory capacity, Antioxidative capacity, Interactive antimicrobial activity.

491

P-264

Production of a fusion protein as a candidate vaccine against two bacterial toxins FatiNajafi M1 , Shaban M2 , Bahreyni M3 , GordNoshahri N3 1

Razi Vaccine & Serum institute , Ahmad Abad , Mashhad , Iran

2

Biology department , Science faculty , Ferdowsi University of Mashhad , Iran

3

Biology department , Science faculty , Ferdowsi University of Mashhad , Iran

Introduction and Objectives: Recombinant fusion proteins have become an important class of molecules in numerous fields of biotechnology including protein engineering and purification, drug targeting and delivery, and immunology . In this method two or more toxins or fragments of selected antigens could be fused and applied for immunization as multifunctional antigens with double antigenic capacity. Materials and methods : In this study , the antigenic regions of beta and epsilon toxins of Clostridium perfringens were identified by bioinformatics tools. The specific primers were designed for each fragment according to NCBI gene Bank. The PCR products ( antigenic fragments) were purified and inserted into cloning vector. The fragments were ligated together using a special linker (designed by bioinformatics tools), the fusion fragments were inserted into the vector. The recombinant vector was transformed into E.coli and the positive clones were selected using blue-white screening method. The Clones were confirmed by PCR and plasmid digestion. A positive clone was inoculated in LB medium and expression was induced using IPTG and Lactose. The presence of the recombinant fusion protein was evaluated by immunological methods. Results : The correct size of the fusion fragment ( 1290 bp ) was seen after PCR and enzymatic digestion, showing that the fusion and cloning of fragments were done successfully. The results of immunological tests showed that the recombinant fusion protein reacts with both normal anti toxins‟ antibodies. Conclusion: This type of fusion protein could be used as an antigen with double capacity and can elicit an immune response against both toxins. This technique also decreases cost of production and can be used to deal with health problems such as botulism , brucellosis, viral infections etc.

Key words: fusion protein, immunization, bacterial toxins, linker

492

493

P-265

Identification of antigenic regions by using bioinformatics and molecular biology methods Fathi Nagafi M1, Gord Noshahri N 2, Makhdoumi-Kakhki A2, Shaban M2 1 2

Razi vaccine and serum research institute, Mashhad, Iran. Department of biology, Faculty of Science, Ferdowsi University of Mashhad, Iran

Introduction and Objectives: Patient‟s safety has emerged as an important health care issue because of the consequences of iatrogenic injuries especially in patient burn and neonatal intensive care unit. At present, aggressive antibiotic therapy is the only choice for management of infections; therefore, novel alternative methods such as antibody therapy for prevention are essential. In this study, we examined a method for producing recombinant protein with high antigenicity based on bioinformatics and molecular biology methods. Materials and methods: For this purpose, the antigenic regions with high antigenicity were analyzed by using appropriate bioinformatics algorithm and protein secondary structure. Primers were designed to amplify these regions. The amplified fragments were inserted into appropriate vector and transformed into E.coli. The Positive clones were selected by blue-white screening and were verified by PCR. The recombinant proteins were expressed by E. coli and their antigenic characteristics were evaluated by immunogenicity methods. This method was used for identification of antigenicity regions of Clostridium novyi alpha toxin. Results: According to the immunogenicity tests, the recombinant protein with the selected antigenic fragments showed more immunogenicity compared to natural whole protein. Conclusion: Combination of different methods can result in production of a good protein with low molecular weight and high antigenic properties. This method can be used for prevention of various pathogenic infections such as Pseudomonas aeruginosa, Staphylococcus aereus, Escherichia coli, Actinobacter, Klebsiella pneumonia, Coagulase- negative staphylococci etc. instead of antibiotic therapy. Keyword: bioinformatics antigenic regions, antigenic recombinant vaccine, antibody therapy, alpha toxin, Clostridium novyi

494

P-266

Frequency of Cutaneous Leishmaniasis in Shush (Khuzestan Province, southern Iran) in the year 2010-2012 Buhamdany I1 , Behbahani A2 1

Environmental Health Department. School of Public Health and Member of Student Research Committee of Ahvaz Jundishapur University of Medical Sciences 2

Medical Entomology Department.School of Public Health. Ahvaz Jundishapur University of Medical Sciences Introduction and Objectives: Leishmaniasis refers to a group of unicellular diseases which transmitted by different species of sand flies which belonging to subcategory of phlebotominae. This disease is common in humans and beasts and is clinically divided into dermal, visceral and dermal-mucous categories. Dermal Leishmaniasis is a sanitary problem in the world, especially in tropical and semi-tropical countries .The wounds of produced by the disease is cured in a year but scars remain on body which causes a damage on face beauty ,feet and the other parts of the body which in fact makes some troubles for patients.The disease is also a sanitary problem in Iran and this study has been done to determine the status of epidemiological dermal Leishmaniasis in Shush. Materials and Methods: This is a retrospective descriptive study in which the researchers collected information on 361patients (200 males and 161 females) suffering fromCL during the years 2010 to 2012. The informationincluded: age, sex, number and place of scars,patient‟s residence and diagnosis date of the disease in each patient.Also,the data were analyzed by SPSS 18, software. Results: In this study, 200 subjects (54.6%) were male and 161 subjects (44%) werefemale. Also, 53%of the patients were in age group of 0-10 which had the high percentage in the study. In addition, 36% of Leishmaniasis scars were observed in hands; 22.1% in face and 16.9%in feet. It must be said that 42.1% of the patients suffer from 1 scar; 22.7% from 2 scars, 14.2% from 3 scars. The highest percentage of the disease were observed month DAY (19.9%) and Azar (18.8).Also, the highest rate of the disease were in the year 1389(49.7%), 1390 (27.3%) and 1389(21.6%) respectively. The abundance of the disease is 34.7% in city and 65.3 in villages. Asthe highest percentage of CL has seen in the age group of 0-10, it can be concluded that Sush is an endemic focus of CL in the south west of Iran. Conclusion: In spite of making progress in the level of science, technology and hygiene, the abundance of CutaneousLeishmaniasis has been increased in Shush. Because of high level of Leishmaniasis cases in the villages, health care systems must be improved and increased in these regions. Also,the number of health care centers must be increased in this regard.

495

Key word:CutaneousLeishmaniasis,epidemiology, shush city.

496

P-267

A Scientometric Analysis of Research on amebiasis in Iran Motazedian H, Armand B, Sedaghat B, Norouzi Y Department of Parasitology and Mycology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran

Introduction and Objectives: Amebiasis is one of the most important parasitic diseases in the world that has been considered by many researchers. Scientometric studies have been conducted to evaluate the articles Biblometricly and can show an overview of the studies and also can reveal the strengths and weaknesses of them. It‟s the first scientometric study on Amebiasis in Iran. Materials and Methods: The databases used for the analysis were “Iranmedex”, “Magiran” and “Scopus”. Searching was done for all years and the purpose was of Persian publications. Results: Totally, 112 papers have been achieved for amebiasis and its agent. Fifty six articles were indexed in Scopus which were cited 337 times by 221 articles. About72 %of the studies have been done in Tehran and Said Behest University of Medical Sciences. More than 50% of the papers were published on the prevalence of Amebiasis and 17% of the papers have been evaluated diagnostic methods to differentiate Entamoeba histolytica from Entamoeba dispar. Forty studies have been published in cooperation with national and international universities. Conclusion: The present study is the first scientometric study on Amebiasis in Iran. Increasing number of articles and citations in recent years reflects the increasing tendency of researchers to this topic. It seems that differential diagnosis of Entamoeba histolytica from Entamoeba dispar has been considered in recent years. Keywords: Amebiasis, Scientometric, Entamoeba

497

P-268

Seroprevalence of canine visceral leishmaniasis in southeast Iran Akhtardanesh B1 ,Mostafavi M 2,Sharifi I B 2,Mahmoodi T1

1

Department of Clinical Sciences, Faculty of Veterinary Medicine, Shahid Bahonar University, Zoonosis Research Committee of Kerman University of Medical Sciences, Kerman, Iran 2

Leishmaniasis Research Center, Kerman University of Medical Sciences, Kerman, Iran

Introduction and objectives: Visceral leishmaniasis is an endemic disease in many parts of Iran and infected dogs constitute the main domestic reservoirs that play a key role in transmission to humans. The objective of this study was to assess the seroprevalence of canine visceral leishmaniasis (CVL) by enzyme linked immunoabsorbant assay (ELISA) in southeast region of Iran. Materials and Methods: This survey was carried out from 2009 to 2011 in Kerman, Bam and Baft districts in Kerman province and Zabol in Sistan - Baluchestan province. Blood samples were taken from 201 dogs after complete clinical examination. Following hematological evaluation; collected sera were tested by indirect ELISA method for the presence of anti Leishmania infantum antibodies. Results: Overall, seroprevalence was 15.4%, including 6.4%, 3.5%, 3% and 2.4% in Bam, Zabol, Baft and Kerman, respectively. However, seroprevalence of disease was not significantly related to age, gender, presence of clinical signs and hematological disorders. Conclusion: Based on the results of the present study, CVL is endemic in southeastern Iran. Delayed diagnosis and euthanasia of potentially infectious animals may occur with an increased transmission risk to sand flies and subsequently to humans. Implementation of potent screening tests with high validity is essential for rapid detection and successful dog elimination programs in endemic parts of Iran. Keywords: Canine visceral leishmaniasis, Seroprevalence, ELISA, Iran.

498

499

P-269

Incidence of head lice infestation in Marand city elementary school students during 1390 and 1391 Sodaei Zenoozagh H, Mahmoodi A , Jeddi A, Aslrahimi V, Barani A Marand city Health Network,Tabriz University of Medical Sciences, Tabriz, Iran Introduction and Objectives: Head lice infestation, one of the most common infectious diseases in children, is one of the most important criteria in assessing personal hygiene students. The aim of this study was to determine the prevalence of head lice among students, between 1390 and 1391 and also, the reasons for infestation decline. Materials and Methods: The study included all 17,344 students ((elementary) in 1390 and 17,259students (elementary) in 1391 were considered. Using gloves, tongue blades, hair students regarding head lice or nit (envy) was examined. Results: This study showed 1.58 percent of the students in 1390 and 0.63 percent in 1391, were infested with lice and lice eggs.Infestation prevalence of female students in 1390 (2.95%) than male students (0.31%) were higher. Infestation prevalence in rural and urban students in 1390 and 1391, respectively, 1.07 and 2.27 percent, respectively, 1.44 and 0.18, respectively. Conclusion: Head lice infestation is with high incidence among children worldwide, and some cities built in a difficult situation. Despite the low percentage of the low prevalence of head lice in this study, other studies show that elementary school students, particularly girls, their parents can benefit from prevention programs and personal hygiene to improve their lot. Thus, a coherent strategy for improving personal hygiene among the students and their parents is required, and the teachers can play an important role. Keywords: Head lice, Elementary school students, prevalence

500

P-270 Camel trypanosomosis (surra) in some provinces of Iran Esmaeili H Department of microbiology, faculty of veterinary medicine, university of Tehran, Tehran, Iran

Introduction and Objectives: Camel trypanosomosis (surra), caused by Trypanosoma evansi, is the most important single cause of morbidity and mortality in camels. Because of the wide geographic range of surra, its control has attracted international attention, with a focus on formulating and implementing effective strategies aimed at increasing productivity and achieving a decrease in mortality and morbidity. In this abstract, the incidence of surra in some provinces ofIran (sistan va baluchestan, South Khorasan and Yazd provinces) is presented during 2010 and 2011. Materials and methods:Blood smears were obtained from 105 affected camels and stained with Giemsa for parasites. Also, clinical signs were documented. Results: Clinical signs such as fever, weakness, lethargy, tachycardia, pale mucosa, subcutaneous edema in brisket and eyelids, nasal and ocular discharges and weight loss were observed. All cases were positive for blood smear and thirty three (31.4%) of them died. Conclusion: Surra is one of the most important diseases of camels whose control can be difficult as there is no vector specificity and a wide range of hosts. Keywords: Camel, trypanosomosis, surra, Iran.

501

P-271

Evaluating the effects of Blueberry extract on Trichomonas vaginalis in vitro Baharvandi Z1, Sadraei J 2 1

Department of medical Parasitology, Faculty of Medical Sciences, Tarbiat Modares University (TMU), Tehran, Iran 2

Department of medical Parasitology, Faculty of Medical Sciences, Tarbiat Modares University (TMU), Tehran, Iran Introduction and Objectives: Trichomoniasis is the most common non-viral sexually transmitted human disease that is caused by protozoan Trichomonas vaginalis. Metronidazole is the selective drug in trichomoniasis treatment. But the reported cases show the increasing trend of drug resistance. This study aims to evaluate the effect of Blueberry extract on Trichomonas Vaginalis. Materials and methods:Trichomonas vaginalis was cultured axenically in TYM (Trypticase Yeast Extract) medium supplemented with 10% bovine serum. The effect of Blueberry extract in 10, 20, 30, 40, 50, 60, 70, 80, 90 and 100 μg/ml on Trichomonas vaginalis were studied after 24 hours. The final numbers of parasite with a hemocytometer and Trypan blue were recorded. Then, the value of IC50 (Half maximal inhibitory concentration) and the lethal percent were calculated. In the present study, the metronidazole is used as positive control. The IC50 value of Metronidazole was calculated in the concentrations of 0.02, 0.04, 0.08, 0.16 and 0.32 μg/ml. Results: The final results confirmed the significant effect of all Blueberry extract concentrations on the reduction of parasite numbers (P 90%) and Cefotaxime, Ciprofloxacin (MIC = 0.5μg/ml), Ceftriaxone, Cefixime (80-90%). Significant statistical relationship was observed between patients’ sex and etiology of peritonitis (P < 0.05). No significant statistical relationship was observed among sex, age, smoking and obesity of patients with antibacterial susceptibility (20 types). (P> 0.05) Conclusions: With respect to the above mentioned results, the most prevalent bacterium causing peritonitis was E.coli (66%) and using of Tobramycin, Ceftizoxime, Amikacin, Cefotaxime, Ciprofloxacin, Ceftriaxone and Cefixime are most effective and is recommended in treatment of moderate peritonitis to avoid the surgical operation or effective treatment after surgery for any type of peritonitis without looking at sex, age, smoking or obesity. Key words: Bacteria, Antibacterial Susceptibility, Peritonitis

674

P-409 Prevalence of isolated bacteria on blood culture and its antimicrobial susceptibility pattern in the patients referred to Shahid Taleghani Hospital in Chalous, Iran Kouchaki MR, porjafari M, Daliryonesi M, Ghaffari Department of microbiology, Islamic Azad University, Tonekabon Branch, Tonekabon, Iran. Intruduction and Objectives: Determine the frequency each of isolates bacterial from blood media and antimicrobial susceptibility patterns have a epidemiological importance and can be effective in selecting pathways to antimicrobial therapy. Therefore, this study aimed to was performed prevalence of isolated bacteria on blood culture and its antimicrobial susceptibility pattern in the patients referred to Shahid Taleghani Hospital in Chalous. Materials and Methods:In this study, 230 blood samples were examined bacteriology from patients admitted to shahid Taleghani hospital Chalous. The samples collected from patients incubated in the bacterial culture medium for 24 hours. After colony growth, bacteria purified and identify bacteria were used based on bacterial and biochemical methods. The susceptibility testing of antibiogram was performed to disk diffusion method and based on the recommendations of the International Committee for Clinical Laboratory Standards. Results: The 230 sample of patients, were 87 (37/82%) men and 143 (62/17%) female. From 71cases (30/86%) were isolated bacteria from blood cultures. Bacteria prevalent in this study were E.Coli (31/2%), Staphylococcus aureus (22/5%), Staphylococcus Epidermatis (20/3%), Pseudomonas aeruginosa(17/8%), Enterobacter(8/2%). The most sensitivity among this bacteria than antibiotics to be Ciprofloxacin (66/1%), Gentamicin (59/9%), Ceftazidime (57/6%), Ceftriaxone (54/3%) and most resistant to the antibiotic Imipenem (74/2%), Amikacin (69/4%). Conclusions:The results of this study showed that common bacteria in blood culture and antibiotic resistance on the rise and to achieve better results and a better choiceofantibiotics, it is essential to have cooperationbetweendoctor and laboratory. Keywords: blood cultures, antibiotic susceptibility, bacteria, Chalous

675

P-410 Antibiotic sensitivity pattern of Staphylococcus aureus from clinical isolates in Tabriz Teyhoo M1, Mozafari NoorA2, Mobaiyen H3, Moaddab SR4 Young Researchers، Club. Department of Microbiology, Basic Science Faculty, Lahijan Branch, Islamic Azad University, Lahijan, Iran. 1

2

Department of Microbiology, Iran University of Medical Sciences, School of Medicine, Tehran, Iran 3

Department of Microbiology, Faculty of medicine, Tabriz Branch, Islamic Azad University, Tabriz, Iran 4

Microbiology department of Paramedical Faculty, Tabriz University of Medical Sciences

Introduction and objectives: The importance of Staphylococcus aureus as a persistent nosocomial and community acquired pathogen has become a global health concern. It has a remarkable capability of evolving different mechanisms of resistance to most antimicrobial agents. The aim of the present study is to establish the incidence of S. aureus in clinical specimens and its antibiotic sensitivity pattern to various antibiotics in this locality. Material and Methods: One hundred and eighty consecutive isolates of S. aureus obtained from various clinical specimens during on year period sent to the Islamic Azad University laboratories of Tabriz were confirmed by standard bacteriological procedures. Antibiotic sensitivity pattern was carried out by disc diffusion method. Results: The age group with the highest number of isolates was (0-10) yrs while wound infection had the highest frequency of S. aureus isolates (30.7%) in the study. Males (64.0%) were more infected than females (36.0%). The sensitivity pattern of S. aureus to the following antibiotics; Gentamicin, Amoxicillin/clavulanate, Streptomycin, Erythromycin, Chloramphenicol, Cotrimoxazole, Tetracycline, Penicillin, Ciprofloxacin, Ofloxacin, Levofloxacin, Ceftriaxone, Amoxicillin and vancomycin were 89.4%, 61.0%, 41.2%, 51.4%, 62.9%, 17.5%, 34.2%, 9.1%, 81.9%, 78.6%, 100%, 74.4%, 27.7% and 100% respectively. Methicillin resistant isolates were sensitive to Levofloxacin 92.7% and Ofloxacin 65.7% Conclusions: The results of the present study show that the fluoroquinolones are effective in the management of S.aureus infections including methicillin resistant strains in this environment. Key words:Staphylococcus aureus, antibiotic sensitivity, Methicillin Resistant S. aureus (MRSA)

676

P-411 The prevalence of antibiotic resistance and detection of mecA genes of MethicillinResistant Staphylococcus aureus isolated from hospitals in Tabriz -Iran by PCR TeyhooM1*, Mozafari NoorA2, Mobaiyen H3, MoaddabSR4 1

Young Researchers' Club, Microbiology Department of Basic Sciences Faculty, Islamic Azad University, Lahijan Branch, Iran 2 Microbiology department, Tehran University of Medical Sciences 3

Microbiology department, Faculty of medicine, Tabriz branch, Islamic Azad University, Tabriz, Iran 4

Microbiology department of Paramedical Faculty, Tabriz University of Medical Sciences

Introduction and objectives: To determine the pattern of antibiotic resistance amongStaphylococcus aureus (S. aureus)isolates from clinical specimens. Methicillin-Resistant S. aureus (MRSA) infections have become a global health problem particularly in hospital setup causing simple skin infections to life-threatening infections. The present study describes a rapid and accurate PCR for detection of clinically relevant antibiotic resistance gene of S. aureus. Materials and Methods: A total of 286 Staphylococcus positive clinical samples were collected from patients hospitals in Tabriz. S.aureus isolates were identified based on cultural characteristics, biochemical reactions and positive tube coagulase test. Methicillin resistance was determined by Kirby-Bauer‟s disc diffusion method. The PCR was used for mecA gene detection from MRSA strains. Results: Of the total 286 S. aureus isolated, 205 (71.6%) strains were MRSA. Twenty-five MSRA strains were randomly selected for PCR assay. Twenty three MRSA strains (94%) were mecA gene positive and two MRSA strains were mecA negative visualized on 2% agarose gel electrophoresis. Among the bacterial isolates, all of 205 S. aureuswere resistant to methicillin, 45(15.7%) were resistant to ciprofloxacin, 116(40.5%) were resistant to tetracycline and the reminder were sensitive or were intermediate to other antibiotics. Conclusions: These results showed that infection due to MRSA is wide spread in Tabriz and with respect to the spread of vancomycin resistance among MRSA and appearance of overwhelming infection. The PCR assay was found to be a rapid and accurate procedure for the detection of MRSA strains as compared to the conventional methods since the reporting time is less and can help efficiently in infection management. Keywords: Antibiotic resistance, MRSA, PCR, mecA genes, Staphylococcal aureus

677

P-412 Prevalence of clinical isolates of Escherichia coli and Klebsiella pneumoniae producing extended-spectrum beta-lactamase (ESBL) in Shiraz Teaching Hospitals KhasheiR, TaheripourM, KhorshidifarM1, SedighH1 Department of Bacteriology and Virology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran. Introduction and objectives: Escherichia coli and Klebsiella pneumoniae are the most important opportunistic pathogens that cause infections, particularly in immunocompromised patients. Broad spectrum betalactamases are enzymes that hydrolyze many of beta-lactam antibiotics, are a major problem in the treatment of serious infections caused by ESBL-producing bacteria. The aim of this study was to evaluate the prevalence of ESBLs in clinical isolates of these bacteria and the relationship between these factors and antibiotic resistance in this area. Materials and Methods: Totally, E.coli (n=75) and K.pneumonia (n=75) isolates were collected from 3 Shiraz Teaching hospitals during a 5 months period in 2012. Isolates were confirmed by the conventional microbiologic tests and API 20E kit. ESBL-producing isolates were identified using the combined disk method as recommended by CLSL. Antibiotic susceptibility of isolates against12 antibiotics was determined by the disk diffusion method as CLSI protocol. Results: From 150 isolates of E. coli and K.pneumoniae, 3.37% (n=28), and 3.33% (n=25) were ESBL-producing, respectively. Among ESBL-producing E. coli isolates, the highest resistance was showed against ampicillin, cefotaxime and ceftazidime (100%) and the lowest resistance was to imipenem and amikacine (0%). Such frequencies among ESBL-producing K. pneumonia isolates were against ampicillin and cefotaxime (100%) and to imipenem and amikacine (4%), respectively. Conclusions: Prevalence of ESBL-producing isolates was high in our area. Also, the resistance rate of isolates to antibiotics was high. The lowest resistance was associated to amikacine and imipenem, so can be concluded that these agents are the choice antibiotics in this region. Keywords:Escherichiae coli, Klebsiella pneumoniae, ESBL

678

P-413 Antimicrobial resistance pattern of Enterococci isolated from clinical samples in West Azerbaijan Hassan M1, Lotfipour F2 1

Pharmaceutical Biotechnology Research Center, Zanjan University of Medical Sciences, Zanjan, Iran. 2

Faculty of Pharmacy and Biotechnology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran Introduction and objectives:The occurrence of enterococci resistant to the most of commonly used antibiotics is a global challenge in the public health sector. Our study investigated the prevalence and antimicrobial susceptibility of enterococci isolated from patients in West Azerbaijan. Materials and Methods: The samples of feces and blood of hospitalized and non-hospitalized patients who had been referred to laboratories of West Azerbaijan provinces were used to perform identification of enterococcal strains. Then, the resistance pattern of enterococcal strains was determined by soft agar disc diffusion assay. The tested antibiotics were ampicillin, chloramphenicol, ciprofloxacin, erythromycin, gentamicin, streptomycin and vancomycin. Results: In overall, 97.4% of the enterococcal isolates were resistant to at least one of the seven applied antibiotics. Regarding the individual antibiotics, majority of isolates (> 50%) showed resistance for gentamicin (92%), ciprofloxacin (84%), erythromycin (76%), streptomycin (74%) and chloramphenicol (53%). The prevalence of resistance to ampicillin and vancomycin was about (34%) and (13%), respectively. Interestingly, there were seven different resistance patterns for seven antibiotics in this study. Multi-antibiotic resistance was observed in 94.7% of enterococcal strains.The most prevalent multi-antibiotic resistance profiles were detected for five antimicrobial agents followed by four. Conclusion:The resistance of most of the isolated enterococci to the tested antimicrobials indicates that multi-antibiotic resistance among enterococci isextensive and alarming in West Azerbaijan and it needs serious and immediate action by Ministry of Health. Keywords: resistance pattern, enterococci, clinical samples

679

P-414 Differentiation Of Beijing and Non-Beijing Strains Of Mycobacterium Tuberculosis By MASPCR TayeboonM1, Arjomandzadegan M1 Tuberculosis And Pediatric Infectious Diseases Research Center, Arak University Of Medical Sciences, Arak, Iran1 Introduction and Objectives:Beijing Strains Of Mycobacterium Tuberculosis have a high Proportion Of Multi-Drug Resistant Strains. In Recent Years Due To the High transmission Power and multiple drug resistance has been much discussed. Mycobacterium Tuberculosis Beijing Genotype Strains more than a Quarter of the world. Materials And Methods:In This Study, 67 Clinical Isolates Of Mycobacterium Tuberculosis Katg Gene RFLP method To determine the genetic groups identified were examined. Then Compare these two methods using a combination of (MAS-PCR) of BreadBeijing Strains were breakdown. Results: RFLP Pattern Of Strain In The Katg Gene Cod on 463Mutations In85% Of Cases Were Shown The Method(MAS-PCR)Showed The Beijing Genotype. Conclusions: Due To The Method (MAS-PCR) To Perform RFLP Analysis Easier And More Affordable, First One Beijing's Sample Set And Then, If Approved, Resistance ToDrugsByMethods Such AsRFLPIdentified.ThisMethodCan BeUsedInRoutineLaboratories ForRapid DetectionOfDrug-ResistantStrains OfBeijingAndUsed. Keywords: Mycobacterium Tuberculosis, Drug Resistance, Beijing

680

P-415 Molecular study on Extended Spectrum β lactamase producing pseudomonas sp isolated from hospitals in Shiraz Kownani M, baserisalehi M Fars Science and Research University Introduction and objectives: Nowadays overuse of the antibiotics culminate in existence of antibiotic resistant bacteria with high frequency.Pseudomonasaeruginosa is one of the most important pathogenic bacteria because of its resistance to beta lactam antibiotics. This character in pseudomonas aerugionsa occurs because of ESBL genes, which carry by transposons, plasmids and mutation. Therefore, the present study conducted to evaluate frequency of existence of OXA, PER, CTX-M1, CTX-M2and CTX-M genes in pathogenic Pseudomonas aerugionsa isolates from different hospitals in Shiraz. Materials and Methods: The pathogenic bacteria were isolated from hospitals in Shiraz during six months. Then the isolates were identified and their antimicrobial sensitivity assessed by antibiogram test. In addition ESBL genes in Pseudomonas aerugionsa were tested by disk double diffusion. Afterward, DNA of the isolates was extracted and the genes amplified by PCR method. Result: Out of 728 bacteria were isolated from the clinical samples obtained from the patients of the hospitals in Shiraz. In total 62 pseudomonas aeruginosa isolates harboured ESBL genes. The high level resistance character of pseudomonas aeruginosa isolates was related to erythromycin ,ampicillin , tetracycline and imipenem .In addition, The highest frequency ESBL was related to OXA-10, PER-1,CTX-M1 ,CTX-M2 and CTX-M3. Conclusion: this investigation showed that all of antibiotic resistant genes of Pseudomonas aeruginosaarelocated in choromosom. Hence, more investigations on ESBL genes such as OXA and the other genes in pseudomonas areuginosa are necessary. Keywords: ESBL (Extended Spectrum β lactamase), OXA,Pseudomonas aeruginosa, antibiogram test

681

P-416 Phenotypic and molecular survey of carbapenem resistant among E.coli strains isolated from patients of IMAM KHOMAINI, SINA and MOTEHARI hospitals, Tehran, Iran Elahi N1, Hakemi Vala M2, Bagheri Bejestani F2 1 2

Islamic Azad University of Pharmacy Shahid Beheshti university of medical sciences (SBMU, Microbiologydepartment

Introduction and objectives: Nowadays, bacteria‟s resistance especially E.coli against existing drugs has been increasing. One of the ways in which bacteria including E.coli acquire resistant against beta-lactams such as carbapanems, is through producing beta-lactamases. Some examples of these enzymes are MBL, AmpC and KPC. Contamination with these bacteria increases the therapeutic costs and mortality. Since prescribing Carbapanem is the last chance for curing, so, it is critical to identify and screen them. Therefore, the aim of this study was phenotypic and molecular survey of carbapanem resistant among E.coli strains isolated from patients of IMAM KHOMAINI, SINA and MOTEHARI hospitals. Materials and Methods: 120 E.coli strains were collected from patients of mentioned hospitals during March 1390 to June 1392. All the strains were confirmed based on the standard methods of microbiology. Their sensitivity against common antibiotics was measured with disk diffusion and microdilution broth methods. The capability of MBL production was investigated with DDST .The AmpC evaluation was done by ceftazidim+clavulanic acid/bronic acid ( Rosco Company, Denmark) .The presence of KPC was surveyed by Modified Hodge Test methods, respectively. E.coli ATCC25922 was used as control, simultaneously .Also, the capability of IMP,KPC production were investigated with PCR method. Results: Only one resistance strain to carbapanems was obtained from 120 collected E.coli isolates. This strain is resistance to Meropenem and Ertapenem and intermediate to Imipenem. By microdilution broth method the MIC for Imipenem and Meropenem was 8,64 µg/ml respectively. Moreover, it was screened as MBL producer by using both Meropenem and Imipenem/ Imipenem EDTA after 5mm difference in resistant zone diameter .It was detected as AmpC negative after bronic acid screening .The KPC negative was identified after Hodge Test. The presence of KPC and IMP were negative after PCR method. Conclusions: Fortunately, the number of resistance strains to Carbapanems is so low (0.8%) in Tehran‟s hospitals. However, doing antibiogram test is suggested before any antibiotic prescription to prevent bacterial resistance. Keywords: E.Coli, PCR, IMP, KPC, AmpC, MBL

682

683

P-417 Antibiotic Resistance Pattern of Class 1 and 2 Integrons in Haemophilus influenzaisolated from Clinical Isolates of Iran Boroumand M1, Siadat SD2, Irani Sh1, Bouzari S3 1

Department of Biology Science and Research branch, Islamic Azad University, Tehran, Iran. Microbiology Research Center & Department of Bacteriology, Pasteur Institute of Iran, Pasteur Ave., Tehran, Iran. 3Molecular Biology Unit, Pasteur Institute of Iran, Pasteur Ave., Tehran, Iran. 2

Introduction and Objectives: High levels of multidrug resistance are normally associated with mobile genetic elements that encode specific resistance genes. The integron is an important genetic element of antimicrobial drug resistant. Its gene sequences contribute to spreading antimicrobial resistance alleles by lateral gene transfer of gene cassettes. Materials and Methods: The antibiogram tests were done by antibiotic discs consist of Amoxicillin, Ciprofloxacin, Ceftriaxone, Clindamycin, Azithromycin, Chloramphenicol, Tetracycline, Trimethoprim/Sulfamethoxazol. All isolates were screened for detection of class 1&2 integrons by the universal primers. Result:As total 20 number of H. influenza20 isolates were resistant to Amoxicillin, Clindamycin, Chloramphenicol and Tetracycline, 9 isolates to Ciprofloxacin and Ceftriaxone and 2 isolates to Azithromycin. Also 20 isolates were sensitive to Trimethoprim/Sulfamethoxazol. In spite of the positive results of phenotypically, class 1&2 integrons were detected in no isolates. Conclusions: Sometimes gene cassettes don‟t express on integrons. Also some isolates that have resistance phenotype but they don‟t have its gene cassette on the integron. In these cases, other factors and genetic elements, except integrons, are responsible for antibiotic resistance. The results of the present study confirm this point.Pay attention to the past researches, there is high prevalence of class 1 integrons and trimethoprim/sulfamethoxazole resistance. In this study all of isolates were sensitive to Trimethoprim/Sulfamethoxazol. It can be a good reason for lack of class 1 integrons justification. Also, it can be a confirmer for geographical heterogeneity, because isolates of this study have been native and they have different genetic base. Keywords: Haemophilus influenza, Integron, Antibiotic Resistance.

684

P-418 Determine of the frequencyandantibiotic susceptibility rateof bacteriaisolatedfrom patients admittedto the Chalous Shahid Taleghani hospital laboratory Porjafari M, Kouchaki MR, Dalir yonesi M, Ghaffari H, GhaneM, Ghayyomi jaze M Department of microbiology, Islamic Azad University, Tonekabon Branch, Tonekabon, Iran. Introduction and Objectives: In recent years,antibiotics have a critical role in controlling infections but of bacterial resistance increasingly and acute problem that threat to global health. This study aimed to determine the frequency and antibiotic susceptibility rate of bacteria isolated from patients admitted to the Chalous Shahid Taleghani hospital laboratory. Materials and Methods: In this study, were used 228 samples of patients referred to Chalous ShahidTaleghanihospital Laboratory forbacteriological analysis. The samplescollected from patientsin theculturemediumincubatedfor 24 hours andaftercolonygrowth, bacteria purified and identificationbacteria were performedaccording to bacterial and biochemical methods. Susceptibility testing of antibiogram was usedby disk diffusion method and according tothe recommendations of the International Committee for Clinical Laboratory Standards. Results: From the228samples studied, the most common isolated bacteria from samples were E.Coli,Staphylococcusepidermatis, Pseudomonas aeruginosa , Staphylococcusaureus, E.Coli samples were resistant respectively49/1%, 54/4%, 67/6%, 34/2%,46/3% to Gentamicin , Ceftazidime , Ceftriaxone ,Imipenem, Amikacin. Pseudomonas aeruginosa samples were resistant respectively 65/6%, 51/7%, 42/4%, 23/2%, 67/8% ratio antibiotics Gentamicin,Ceftazidime,Ceftriaxone, Imipenem and Amikacin. Staphylococcus epidermatis samples were resistant respectively 22/3%, 18/8%, 37/5% ratio antibiotics Gentamicin, Imipenem and Amikacin and were sensitive ratio antibiotics Ceftazidime, Ceftriaxone. Staphylococcus aureus samples were resistantrespectively 35/3%, 27/8%, 32/2%, 37/6%, 47/9% ratio antibiotics Gentamicin, Ceftazidime, Ceftriaxone, Imipenem and Amikacin. Conclusions: This study showed that the rate of antibiotic resistance is increasing in pathogenic bacteria that it isdue tothe indiscriminate useofantibiotic and lack performed antibiotic sensitivity test before antibiotic prescribed by the doctor. Keywords: antibiotic susceptibility, bacteria, Chalous

685

P-419 Antimicrobial effect of Citrus aurantium extractonEnterococcus faecalisand Klebsiella pneumoniaeisolated from Urinary Tract Infection Dadashi M1, Eslami G1, Goudarzi H1, Fallah F2, Taheri S1, Zahirnia Z1 1

Department of Microbiology, School of Medicine, Shahid Beheshti University of Medical Sciences 2

Pediatric Infection Research Center, Shahid Beheshti University of Medical Sciences

Introduction and Objectives: Indiscriminate use of antibiotic in our society today has led toappears resistance to antibiotics.This survey consider to use the extract of the Citrus aurantium and also survey on extract on bacteria whose cause Urinary Tract Infections(UTI),and compare this with common antibiotics prescription. Material and Methods:Citrus aurantium extract performed with boil water by maceration and hydrodistilation by clevenjer methods,respectively.Urine samples was collected from patients and then were cultured on MacConkey,blood agar,EMB media,and bile esculin agar at microbiology laboratory.Toidentify the Klebsiella pneumoniaewas used special test,including:ONPG test,Esculin hydrolysis,Urea hydrolysisand IMViC test.Enterococcus faecalis was diagnosed with special test including:catalase,oxidase,PYR test,NaCl tolerance (6.5%) and Esculin hydrolysis.Two methods had used.First was disc diffusion test and second was Minimal Inhibition Concentration(MIC).The blank discs were macerated in all of extracts then cultured on Mueller-Hinton agar with two different antibiotic discs(Cotrimoxazole,Nalidixic acid),to compare inhibition effects of extract with antibiotics.MIC method have been placed in 9 tubes in different dilution( 1/2-1/512)and 0.1 cc from 0.5McFarland of bacteria was added in all tubes after 24 hours incubation,each tube was cultured on Mueller-Hinton media.The MIC& NBC(No Bacterial Culture)were detected. Results:Enterococcus faecalis had 100% sensitivity to extract and cotrimoxazole but 80%to nalidixic acid.Klebsiella pneumoniae had 80%sensitivity to cotrimoxazole,75% to nalidixic acid and 100% resistance to extract.Extract had inhibition effect on Enterococcus faecalis till 1/128 in tube method. Conclusions:According to results of this research,Citrus aurantium extract has a much more effectiveness in inhibitingthe growth ofGram-positive bacteriacomparedtoGram-negative bacteria. Key words: Citrusaurantium, Nalidixic acid,Cotrimoxazole,Urinary Tract

686

P-420 Prevalence of Staphylococcus aureus isolated from endotracheal tubes of patients in Loghman Hospital, Tehran, Iran Dadashi M1, Eslami G1, Goudarzi H1, Fallah F2, Taheri S1, Zahirnia Z1 1

Department of Microbiology, School of Medicine, Shahid Beheshti University of Medical Sciences 2

Pediatric Infection Research Center, Shahid Beheshti University of Medical Sciences

Introduction and Objectives: Ventilator – associated pneumonia(VAP)is one of the most important problems in ICU admitted patients. Staphylococcusaureus is one of the most important factors in the development of VAP. Due to the high risk of mortality and the costs imposed to the patients, the proper treatment seems to be an undeniable necessity. For this reason the aim of this study is knowing the most common pathogens and the resistance pattern to the antibiotics. Materials and Methods: Samples were taken of 200 patients with VAP who were hospitalized in the ICU of Loghman Hospital. Samples from patients(that more than48hourshadelapsedfrom the time of their admission)were collected and were transported to the microbiology laboratory medicine. Clinical diagnosis of pneumonia under the supervision infectious disease specialist. After cultured in blood agar and mannitol salt agar medium, bacteriological diagnosis based on gram staining, microbial and biochemical test was performed. Determine the antimicrobial susceptibility was performed according to CLSI guidelines. Result: From102 patients, Staphylococcusaureus was found in51%ofsamples. Isolated of Staphylococcus aureus100% were resistant to the antibiotic methicillin and penicillin. All cases of Staphylococcus aureusin 102 patients were100%sensitive toantibioticschloramphenicol, vancomycinandlinezolid. Percentagesensitivity toother antibiotics were as follows: ceftriaxone (82%), erythromycin(69%), cotrimoxazole(91%), cloxacilin(89.8%), imipenem(83%) and gentamycin(82%). Conclusion: Due to the different prevalence of Staphylococcus aureusin many studies, (because of different colonization of Staphylococcusaureus in each hospital) performing this study in the ICU in each hospital seems necessary for reduce mortality and health care costs in VAP disease. Keywords: Ventilator associated pneumonia (VAP), Staphylococcus aureus, Nozocomial pneumonia

687

688

P-421 Antibiotic resistance pattern of Escherichia coli isolates caused urinary tract infection in Jahrom, Southern Iran Ranjbar M1 , Solhjoo K2, Kargar M3, Parastan R 4, Mojahedi Jahromi S4 , Darughe F4 Microbiology Department & Drug and Food Department, Jahrom University of Medical Sciences, Jahrom, Iran 1

2

Microbiology Department, Faculty of Medicine, Jahrom University of Medical Sciences, Jahrom, Iran 3

Microbiology Department, Islamic Azad University, Jahrom Branch, Jahrom, Iran

4

Drug and Food Department, Jahrom University of Medical Sciences, Jahrom, Iran

Introduction and Objectives: Escherichia coli is one of the most important causing agents of urinary tract infection and determination of antibiotic resistance in each region can be useful in choosing of an effective drug and faster treatment of urinary tract infections caused by these bacteria. Thus, the aim of this study is determination of antibiotic resistance patterns for Escherichia coli isolated from urinary tract infections collected in Jahrom. Materials and Methods: In this cross - sectional study, 100 isolates of Escherichia coli from urinary tract infection were collected from laboratories of Pymanieh and Mottahari hospitals in Jahrom at the first quarter of 1392 and antibiotic resistance pattern of them was determined for 14 antibiotics by disk diffusion method.Inhibition zone diameter was measured based on CLSI protocol and the results were recorded in sensitive, semi-sensitive and resistant. Results: The most resistance to antibiotics was seen for ampicillin (89%) and tetracycline (70%) and there was the most sensitivity to antibiotic for nitrofurantoin (94%), imipenem (78%) and chloramphenicol (76%). Conclusions: Antibiotic resistance pattern was revealed that there was more than 50% resistance for seven antibiotics and it is recommended that nitrofurantoin, imipenem, and chloramphenicol are used for the treatment of urinary tract infections caused by Escherichia coli in Jahrom. Keywords: Escherichia coli, urinary tract infections, antibiotic resistance

689

P-422 Antimicrobial Resistance Patterns of Pseudomonas aeruginosa clinical isolates in yazd city, Iran kiani M, Astani A, Zandi H, Musavi M Department of Microbiology, School of Medicine, ShahidSadoughi University of Medical Sciences, Yazd, Iran Introduction and Objectives: Pseudomonas aeruginosa (P. aeruginosa) is a species of pathogenic bacteria, an aerobic gram-negative bacterium, that is resistant to most antibiotics. P. aeruginosa is one of the most important nosocomial pathogen that causes a various types of clinical infections. Antibiotic resistance of P. aeruginosa is becoming a progressive problem in world. Therefore the purpose of this study is to determine the patterns of antimicrobial resistance in Yazd. Materials and Methods: In this study (Descriptive – analytical) conducted on 70 isolates of P.aeruginosa from different clinical specimens were isolated. The specimens were selected on the basis of their growth on routine MacConkey medium which showed lactose Non-fermenting pale colonies which were oxidase test positive and on Nutrient agar pigmented and nonpigmented colonies with oxidase positive. After confirmation of bacteria by biochemical tests, susceptibility testing was done by disc diffusion (Kirby-Bauer) method according CLSI. Results: P. aeruginosastrains were the most sensitive to imipenem (66%), Cefotaxime(61%), Ciprofloxacin (60%), meropenem (56%) and the most resistant to ceftazidime(50%), gentamicin (48%) Tobramaycin(48%). Conclusions: Antimicrobial resistance is the major problem of worldwide, thus it needs urgent attention. P. aeruginosa has the inherent property of developing the resistance. Hence, it is necessary to know the current resistance pattern for proper use of antipseudomonal agents.Therefore this is important to considered antibiotic treatment of patients, and it would be better to change consumption patterns of antibiotics. Keywords: Pesudomonas aeruginosa; Antibiotic Resistance; yazd

690

P-423 Prevalence of Metallo-β-Lactamases-producing Klebsiellapneumoniae strains in patients referred to Hamadan university of Medical Sciences hospitals Noshak MA1, Yousefi Mashof R2, Ahmadi Hedayati M1, Ramazanzadeh R1 1 2

Department of Microbiology, Kurdistan University of Medical Sciences, Iran Department of Microbiology, Hamadan University of Medical Sciences, Iran

Introduction and Objectives: Klebsiella pneumoniae is one of the major causes of nosocomial infections particularly in patient with immunodeficiency. Several antibiotics used in treatment of infections with these bacteria such as Betalactams. Metallo β-Lactamases (MBLs) are bacterial enzymes with Extended-Spectrum activity against beta-lactams. Four groups of MBLs have been described up to now, namely, IMP, VIM, SPM and GIM. The IMP and the VIM types are prevalent and world wildly. In addition, VIM1 and VIM2 are two subtypes of VIM and IMP1 is a subtype of IMP group. Aim of this study was Evaluation of MBL-producing isolates of Klebsiella pneumonia resistant to Imipenem by PCR and DDST methods. Materials and Methods:This research was performed on 100 Klebsiella Pneumonia strains that were collected from patients referred to Hamadan university of Medical Sciences hospitals during 2008-2010. The strains were distinguished separately with two microbiological and PCR methods. Detection of blavim1, blavim2 and blaimp1 genes was done by DDST method for phenotyping and PCR for genotyping. In addition, the antimicrobial susceptibility tested with Kirby-Bauer and E.test methods. Results: According to the results, Imipenem-resistant strains were detected 12% and 8% with using Kirby-Bauer and Etest methods respectively. Furthermore evaluation of DDST method showed that 5% of these strains have Metallo-beta-Lactamase enzyme. Finally, evaluation of blavim1, blavim2, blaimp1 genes showed that 5% of strains have only blavim1 gene and none of them have blaimp1 and blavim2 genes. Conclusion: The genotyping and phenotyping experiments are efficient for detection of antibiotic resistance. These results show high prevalence of blavim1 gene in Klebsiella Pneumonia strains isolated frompatients referred to the hospitals of Hamadan university of Medical Sciences. Keywords: Klebsiella Pneumonia, MBLs, DDST, Etest, PCR

691

P-424 Phenotypic determination of the biofilm-forming ability of Methicillin-resistant Staphylococcus aureus isolates from clinical specimens in two hospitals, Shiraz, Iran Zalipoor M1, Sedigh Ebrahim Saraie H1, Khashei R1, Motamedifar M1,2 1

Department of Bacteriology and Virology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran 2

Shiraz HIV/AIDS Research Center, Shiraz University of Medical Science, Shiraz-Iran

Introduction and Objectives: Biofilm production ability has been recognized as a virulence factor in Staphylococci nosocomial infections. The present study aimed at the determination of the biofilmforming ability of Methicillin-resistant Staphylococcus aureus (MRSA) isolates from clinical specimens and correlation between their isolation sources. Materials & Methods: This cross-sectional study was performed on a total of 134 MRSA isolates which were collected from patients hospitalized in two teaching hospitals (Namazi and Faghihi hospitals) in Shiraz during 2012-2013. Samples were processed and identified as MRSA isolates by using the standard microbiological procedures. Biofilm production characterized phenotypically by cultivation of the isolates on Congo red agar (CRA) plates. The biofilm-producer isolates appeared as black colonies, while the non- producing isolates remind red. Results: Of 134 MRSA isolates, biofilm production was observed in 47% (n=63) of them. Of 63 isolates 36 were strongly or moderately positive for biofilm formation and 27 isolates were weakly biofilm positive. Biofilm production was detected mostly among isolates of endotracheal tube (ETT) 100% (6/6), blood 58.8% (10/17), sputum 46.9% (23/49), urine 46.6% (7/15) and wound 37.5% (6/16) samples. Strong biofilm production was mostly prevalent in the isolates that were belonged to ETT (n=6), blood (n=4), wound (n=4) and urine (n=3) samples.

Discussion: The current study which used CRA as a simple and rapid method for the diagnosis of biofilm formation in S. aureus hospital isolates showed a remarkable rate of biofilm forming isolates. Biofilm formation may lead to the increased risk of nosocomial infections including endocarditis, meningitis, wound infections with the less sensitivity to antimicrobial agents.

Keywords: Congo red agar, Biofilm, Methicillin resistant Staphylococcus aureus

692

P-425 Investigation of resistance genes among ciprofloxacin resistant Enterococcus faecalis isolates from clinical specimens Moeenian M1, Saifi M2, Pourshafie M2, Eidi A1 1

Islamic Azad University, Research and Science Branch of Tehran

2

Pasteur Institute of Iran, Department of Bacteriology

Introduction and objectives: High-level resistance to ciprofloxacin among Enterococcus faecalis (E.f) isolates, makes difficulties for treatment of enterococcal infections. The targets of ciprofloxacin are DNA gyrase that includes GyrA and GyrB and topoisomerase IV that containsParC and ParEsubunits. Alterations in these subunits, lead to resistance. In this study, determination of gyrA, gyrB, parC and parEresistance genes among ciprofloxacin resistant E.f isolates from clinical specimens is performed. Materials and Methods: Among 384 clinical specimens, species of50isolates were determined by standard biochemical methods. Antibiotic susceptibility test with disk diffusion and MIC determination with microdilution method wereperformed and finally determination of resistance genes were done by PCR method. Results :All strains showed the high-level ranges of MICs from 16 to 512μg/ml .7,13,13,13,1,3 strains respectively had MICs of 16,32,64,128,256,512 μg/ml. All of the isolates continedparC, 98% gyrA and gyrB and 80% parE genes. With any MIC values, gyrA, gyrB and parC were found and in the case of parE, 80% have the gene and 20% were without gene that this difference in genotypes had no significant effect on MICs. Conclusion: Investigation of MICs and determination of resistance genes with PCRmethod, has a significant impact on control and treatment.Since almost all strains regardless of their MICs, have gyrA,gyrB, parC and difference in parE genotype, also had no significant effect on MICs,use of the genotyping method such as Pulsed Field Gel Electrophoresis is recommended. Keywords: Enterococcus faecalis,resistance genes, ciprofloxacin.

693

P-426 Antibacterial effects of a new class of piperazinylquinolone derivatives on Bacillus cereus group Ramezani M1,Ramezani M3, Riahi-Madvar A2,Darehkordi A3 1

Department of biology, Science and Research branch, Islamic Azad University, Kerman, Iran

2

Assistant Professor, Department of Biotechnology, Institute of Science and High technology and Environmental Sciences, Graduate University of Advanced Technology, Kerman, Iran 3

Department of Chemistry, Faculty of Science, Vali-e-Asr University of Rafsanjan

Introduction and objective: Bacillusare agroup ofGram-positive bacteria.Somemembers, such as Bacillus cereusarecommon cause offood-borne gastroenteritis, causes one of the most severe posttraumatic or endogenous infections of the eye.Quinolones are an important group of antibiotics and these are one of the most important synthetic medicines used in the treatment of community or hospital acquired infectious diseases. Material and method: Broth dilution MIC methods were determined by micro dilution as described by the NCCLS dilution standard M7-T. Following an overnight incubation at 37°C, the MIC and MBC are determined by observing the lowest concentration of the drug that will inhibit and bactericidalvisible growth of the test bacteria. Results: Our results indicate that the minimum inhibitory (MIC) and toxicity was observed onB.thuringiensis in the presence of piperazinylquinolone derivativesand Minimum Bactericidal Concentration (MBC) in presence of B.cereus is 0.25 while it is more for B.thuringiensis. Conclusions: These compounds displayed good to excellent antibacterial activities. Keywords:Bacillus, antibacterial, piperazinylquinolone derivatives

694

P-427 The prevalence and antimicrobial susceptibility of bacteria isolated from endotracheal tubes of patients in Imam Reza Hospital, Tehran, Iran Lashgari N1, Goudarzi E 2, Goudarzi L3 , Gohary Moghadam K4 , Nasirian R1 1 Department of Microbiology, Imam Reza hospital laboratory, Tehran 2

Department of Microbiology, Islamic Azad University, Karaj Branch, Karaj, IR Iran

3

Department of Microbiology Alzahra University, Faculty of science

4

Department of pathology, Medical college, Military university of Medical Sciences, Tehran

Introduction and Objectives: Nosocomial infections are one of the most important worldwide health problem and increased patients hospital stay, therapeutic problem and mortality rate. Bacterial infections in the lower respiratory tract especially due to Gram negative bacilli, has remained a major complication of tracheal intubation in patients requiring ventilator equipments. The aim of present study was to determine the presence or absence of bacterial infections in tracheal tubes and determination of their antimicrobial susceptibility patterns. Materials and Methods: This study was designed to determine the frequency of microorganisms isolated from tracheal tube in patients admitted to ICU, CCU and internal section at Imam Reza hospital in Tehran from April2012 to June 2013. 171 specimens were collected from tracheal tubes of patients with endotracheal aspiration. The specimens were microbiologically investigated and the isolated bacteria were identified by using standard cultural and biochemical tests. The antibiotic susceptibility testing was then performed on the isolates by disc diffusion method according to CLSI guideline. Results: In total, 98 specimens had positive cultureresults. Most patients were in 50-90 years age group. From patient 57% were male and 43% were female. The most common microorganisms were Klebsiellapneumoniae.(47%), Enterobacter spp., (46%) and Acintobacter spp. (7%). Antimicrobial susceptibility testing revealed that isolated bacteria were most susceptible totobramycin (18 %), Cefotaxime and meropenem(17.2%), nitrofurantoin (8.1%), Cotrimoxazole(9.4%) , ceftazidime (10.6%), ciprofloxacin(8.6), ceftriaxone (6%) and cefixime (4.9%) Conclusions: this survey indicates the emergence of antibiotic susceptibility patterns of nosocomial infection in the studied hospital. Therefore, the prevention strategies and nosocomial infection control are important cases and may require the development of methods for preventing or interrupting the colonization of hospitalized patients with Gram-negative bacilli. Key words: Tracheal Tubes, Antimicrobial susceptibility, Hospital ,Iran

695

P-428 Prevalence of VIM-2 Type metallo-β-lactamase gene in Pseudomonas aeruginosa from clinical isolates in Fars Nasiri N1, Solhjoo K2, Kargar M1, Chobineh D 3, Saadat S1 1 Microbiology Dep., Islamic Azad University, Jahrom Branch, Jahrom, Iran 2 Microbiology Dep., Jahrom University of Medical Sciences, Jahrom, Iran 3 Biotechnology Dep., Jahrom University, Jahrom, Iran Introduction and Objectives: Resistance to carbapenems in Pseudomonas aeuginosa is often due to production of metallo-β-lactamase. MBLs belong to ambler class B and has been described from various part of the world,includingAsia.blaVIM-2 was first identified in southern of France from a P.aeruginosa isolates in a blood culture from a neutropenic patient in 1996.VIM-2 is closely related to VIM-1(90% amino acid identify) and was encoded by a gene cassette in class 1 integron. The aim of this study was to determine the prevalence of bla VIM-2 in P.aeruginosa isolates in Fars by PCR. Materials and Methods: In this describtive-analytic study, 120P.aeruginosacollected from clinical isolates in Fars. All of clinical isolates resistant to Imipenem by disk diffusion method, were screened for production of MBL by E-testMBL.PCR assay was performed for detection of bla VIM-2 gene. Results: Out of the 120 Pseudomonas aeuginosa isolates, 90(75%) were resistant to Imipenem.26 (29%) of which were positive for production of MBLs by E-test MBL. Out of 26Pseudomonas aeuginosa producing MBL, 13(50%) isolates were positive for bla VIM-2by PCR assays. Conclusion: Based on the study result, significant proportion of the resistance to Imipenem is due to MBL production. Considering the emergence of blaVIM-2 in Fars, which can be transferable and spread horizontally among other strains, using the appropriate treatment protocol based on antibiogram pattern of the strains is highly recommended. Key words: Pseudomonas aeruginosa, bla VIM-2, MBLs, PCR

696

P-429 ESBl- Ecoli prevalence among urinary tract infected pregnant women samples as well as Antibiotic Resistance pattern: october2011-october2012 Hamidipour N1, Zarei Z2, Azarafrooz L2 1

Department of pharmacology, Shiraz University. Shiraz, Iran

2

Laboratory expert. Shiraz University of Medical science, Bagher-al- Olom laboratory, Kazeroun, Iran Introduction and Objectives: Many pregnant women suffer from Urinary tract infection (UTI) during their pregnancy and E-Coli have been known as one of the most important causes. Extended-spectrum beta-lactamases (ESBLs) efficiently hydrolyze extended-spectrum betalactams such as cefotaxime, ceftriaxone, ceftazidime, and aztreonam. This study aimed to assess bacterial profile and ESBL-Ecoli prevalence that causes urinary tract infection and their antimicrobial susceptibility pattern among pregnant women who were referred to laboratories due to symptomatic UTI. Material and Methods: A cross-sectional study was conducted in health care center of the city during October 2011-october 2012. Mid-stream urine samples were collected and inoculated into EMB and blood agar. Colony counts yielding bacterial growth of 105/ml of urine or more of pure isolates were regarded as significant bacteriuria for infection. A standard method of agar disc diffusion susceptibility testing method was used to determine susceptibility patterns of the isolates. ESBL- Ecoli was determined using screening and confirmatory test. Results: The predominant bacterial pathogens were Escherichia coli 85.6% followed by coagulase-negative staphylococci, proteus, Klebsiella, and Enterobacter. ESBL-Ecoli was determined as high as 54.4% among E-coli positive samples. Isolated pathogens showed high resistance to Penicillin and Ampicillin and Amoxicillin. Conclusion: ESBL -Ecoli are the most uro- pathogen among pregnant women and drug resistance is increasing dramatically. Our results show a map to health planner in order to control UTI among pregnant women Keywords: Urinary tract infection, pregnant women, ESBL-Ecoli, Antibiotic resistance

697

P-430

Detection of sul2 gene in Escherichia coli isolated from patients with UTI attended to clinical centers in Khoy city

Norouzi J, Akhavan sepahy A, Bazzazzadeh N

Department of Microbiology, Islamic Azad University North Tehran Branch Introduction and Objectives: Widespread use of co-trimoxazole in urinary tract infections treatment as well as its have led to the emergence of E. coli strains resistant to it. The aim of this study was to evaluate sul2 gene among E. coliisolates of patients attending to clinical centers of Khoy city. Methods and Methods: Three hundred urine samples were collected from different clinical centers in Khoy. Among them, 100E.coli isolates were confirmed by using standard biochemical tests. Furthermore, the antibiotic susceptibility tests to 10 antibiotics were performed by the-disk-agardiffusion (DAD) method. Also, MIC and MBC were evaluated for co-trimoxazole by microdilution broth method. Finally, PCR was done in order to find sul2 gene in resistant isolates.

Results: Of 100 isolates, 71(71%) were resistant to co-trimoxazole which 57(80%) of those had sul2 gene. this gene was recognized in sulfonamides-resistant isolates which didn’t create any zone of inhibition. Also, these isolates, which had sul2 gene, were simultaneously resistant to ampicillin, nalidixic acid and ciprofloxacin. In co-trimoxazole-resistant isolates, MIC and MBC for Co-trimoxazole were calculated 16 and 32 μg/ml.

Conclusion: This is the first study in Iran which has studied the presence of sul2 gene in E.coli. The results of the present study indicated that; antibiotic-resistance percentage in Khoy city was reached to 71%. If this goes on, it is likely to have resistance to all common antibiotics prescribed in clinical centers and it will result in unsuccessful treatments.

698

Keywords: Escherichia coli, Sulfonamides, sul2 gene, Antibiotic resistance, disk-diffusion method, MIC

699

P-431 Frequency distribution of carbapenem resistant Acinetobacter isolated from the hospitalized patients in sadoughi hospital of Isfahan (2012-2013) Zare V1, Ataee R.A2, Khaleghi A 3, Mehrabi Tavana A4 1

Graduate student of microbiology; Student research committee, Baqiyatallah University of Medical Sciences, Tehran, Iran. 2 Department of Medical Microbiology, School of Medicine, Baqiyatallah University of Medical Sciences, Tehran, Iran. 3

Department of Medical Microbiology .Shahid Sadoughi hospital, Isfahan, Iran.

4

Health Management Research Center” & “Department of Microbiology, Faculty of Medicine”, Baqiyatallah University of Medical Sciences, Tehran, Iran. Introduction and Objective: Acinetobacter is an important prevalent gram negative bacterium can be adequate in nosocomial infections. From this group A.baumanii is a very important opportunistic pathogene can infectimmunocompromisedpatients.Conversely, hospital environments are appropriate places for the growth of carbapenem (as a high usage antibiotic in hospitals) resistant Acinetobacter baumanii. So, identification and report of this resistance to medical society and physicians has a logical value. Materials and Methods: This study was done descriptively since 2012-2013 on 1708 samples of hospitalized patients in Sadoughi hospital of Isfahan. After the calture and segregation of Acinetobacter baumanii, antibiogram tests were done through the CLSI protocols by disk diffusion methods (Kirby-Bauer antibiotic testing). Result:In this study, from among of 49 positive samples isolated from 1708 samples of hospitalized patients ;63.2% of them were resistant to carbapenem(Imipenem).Here of this rate, the most of members were considered to ICU with 45% of all positive samples. Conclusion: This study was described that the resistance of carbapenem is on the rise and in order to avoid the spread and treatment of these nosocomial infections pay attention to the antibiogramtese results and confirmation tests are essential. Keywords: Acinetobacter. baumanii, Nosocomial infection, Carbapenem.

700

701

P-432 Detection of toxic shock syndrome toxin-1 gene among methicillin sensitive Staphylococcus aureus isolates from Shiraz, Iran SedighEbrahim Saraie H1 , Zalipoor M1, Hosseini Alfatemi M1 , Motamedifar M1,2, Yousefi-Avarvand A1 1

Department of Bacteriology and Virology, School of Medicine, Shiraz University of Medical Sciences, Shiraz, Iran 2

Shiraz HIV/AIDS Research Center, Shiraz University of Medical Science, Shiraz-Iran

Introduction and objectives: Toxic shock syndrome toxin-1 (TSST-1) is a superantigen (sAg) and encoded by the tst gene. Toxic shock syndrome (TSS) caused by Staphylococcus aureus strains that express this gene.The aim of this study was the investigate the presence of tst gene among MSSA isolates from three Teaching Hospital in our region. Materials and methods :A total of 100 methicillin sensitive Staphylococcus aureus(MSSA) isolates were used in this study collected in 2012 from three Teaching Hospital of Faghihi (n=59), Namazi (n=37) and Ghotbodin (n=4), Shiraz. The isolates were recovered from difference clinical specimens and identified as S. aureus and MSSA by conventional biochemical tests and screen by cefoxitin (30μg) respectively. tst gene was detected by PCR. Results: The tst gene among our studied isolates were detected in 23 (23%) of the 100 isolates. The observed frequency of tst gene among specimens were, sputum (5/8), skin (4/10), wound (3/10), urine (3/18), ear (2/2), blood (2/15), CSF (1/3), throat (1/4), eye (1/5) and nasal (1/15).The distribution of tst gene between difference hospiatlas was, Faghihi and Namazi with 15 and 8 positive isolatesrespectively. Conclusion: Although MSSA isolates is considered to be as a lower risk than Methicillin-resistant Staphylococcus aureus (MRSA) emergence and spread of virulent isolates harboring the tst gene could be a major concern in healthcare settings. Considering the results obtained such as these study, identification and elimination of these isolate is recommended for health care settings.

Keywords: Toxic shock syndrome toxin-1,tst gene, methicillin sensitive Staphylococcus aureus

702

P-433

Hand hygiene compliance among health care workers in Emam Reza hospital, Mashhad, Iran Amirian H, Aelami MH, Mostafavi I, Rokni Z, Amirian MH Emam Reza hospital, Mashhad University of Medical Sciences, Mashhad, Iran Introduction and Objectives: Health care associated infection (HAI) is a major treat for hospitalized patients. Hand hygiene (HH) has a critical role in the prevention of HAI. The aim of this study was to evaluate the compliance of hand hygiene among healthcare workerson the basis of WHO guideline in our hospital. Materials and Methods: In a pilot study in Dec 2012hand hygiene compliance was detected by infection control nurses and trained physicians. A questionnaire based on WHO guideline (my five moments for hand hygiene) was used after getting verbal consent from health care workers in different wards of Emam Reza hospital. Results: A total of 510 opportunities among 709 indicationswere detected that accompanied by 111 hand hygiene actions. The calculated HH compliancewas 21.6%. The action for one hundredeleven opportunities was glove usage instead of HH. Conclusion: Hand hygiene compliance was not good among health care workers in our study similar to other studies in Iran so it is necessary to promote hand hygiene practices by multidisciplinary approaches including education, reminders, observation and feedback and involving managers of the hospitals. Keywords: hand hygiene, health care worker, compliance, Iran

703

P-434 Comparison of urinary tract infections and antibiotic sensitivity pattern in outpatient ward of Imam Reza laboratory of Tabriz in 1389 and 1390. TayebiKhosroshahi H1, Habibi Asl B2, Vaez H Varshouchi M1

2,3

, Alizadeh M4, Navapur M1, Nouruzi A1,

1

Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran. Department of Pharmacology, Faculty of Pharmacy, Tabriz University of Medical Sciences, Tabriz, Iran. 3 Student Research Committee, Faculty of Pharmacy, Tabriz University of Medical Sciences, Tabriz, Iran. 4 Faculty of Pharmacy, Tabriz University of Medical Sciences, Tabriz, Iran. 2

Introduction and Objectives: tract infection is a major cause of referring patients to clinics and hospitals. Increasing resistance to antibiotics in recent years has provided the necessity of numerous studies to select the appropriate remedy in the empirical treatment of these infections. Due to the differences in various pathogenic strains in different regions and distinct times, identification of the bacterial resistance pattern in each geographic area seems to be essential. Materials and Methods: In this study, we studied the result of urine sample analysis taken at the Imam Reza laboratory of Tabriz in the years of 1389 and 1390 and the type of involved pathogens and the sensitivity and resistance of them to various antibiotics have been compared. Result: According to our results, in both years the most prevalence involved pathogen of UTI in outpatient ward was E. coli with 52.41% in 1389 and 60.58% in 1390. The greatest sensitivity in 1389 belonged to Amikacin (91.9%) and then Gentamycin (82.9%), Nitrofurantoin (73%), Ciprofloxacin (62.2%), Norfloxacin (57.8%), Ceftriaxone (42.2%), Nalidixic acid (40.6%), Cotrimoxazole (30.3%), Ampicillin (21%). However in 1390 this order changed to Amikacin (98.2%), Nitrofurantoin (91.9%), Gentamycin (75.6%), Ceftriaxone (53.3%), Ciprofloxacin (47.8%), Norfloxacin (41.6%), Cotrimoxazole (33.3%), Ampicillin (31.5%), and Nalidixic acid (31%). Conclusion: Due to the high obtained sensitivity to Amikacin, Nitrofurantoin and Gentamycin, these drug can be prescribed in first line empirical treatment of hospitalized UTI patients and for drugs with low sensitivity such as Ampicillin and Nalidixic acid there are limited indication as a single therapy in hospitalized patients with UTI. Key words: antibiotic sensitivity; outpatient ward; urinary tract infections

704

P-435 Comparison of urinary tract infections and antibiotic sensitivity pattern in hospitalized and outpatient ward of Imam Reza laboratory of Tabriz in 1389 and 1390 Vaez H1,2, Habibi Asl B1, Alizadeh M3, Navapur M3, Tayebi Khosroshahi H4, Nouruzi A4, Varshouchi M4 1 Department of Pharmacology, Faculty of Pharmacy, Tabriz University of Medical Sciences, Tabriz, Iran. 2 Student Research Committee, Faculty of Pharmacy, Tabriz University of Medical Sciences, Tabriz, Iran. 3 Faculty of Pharmacy, Tabriz University of Medical Sciences, Tabriz, Iran. 4 Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran. Introduction and Objectives: Urinary tract infection is a major cause of referring patients to clinics and hospitals. Increasing resistance to antibiotics in recent years has provided the necessity of numerous studies to select the appropriate remedy in the empirical treatment of these infections. Materials and Methods: In this study, we studied the result of hospitalized and outpatient ward urine sample analysis taken at the Imam Reza laboratory of Tabriz in the years of 1389 and 1390 and the type of involved pathogens and the sensitivity and resistance of them to various antibiotics have been compared. Results: According to our results, in both years the most prevalence involved pathogens of hospitalized ward were E. coli (42.85%) and Enterobacter aerogenes (38.61%) in 1389 and 50.75% and 31.21% orderly in 1390 and in outpatient ward was E. coli with 52.41% in 1389 and 60.58% in 1390. The greatest sensitivity to E.coli in 1389 belonged to Amikacin (97.4%) and then Nitrofurantoin (86.19%), Gentamycin (84.55%), Tobramycin (82.2%) and Ciprofloxacin (39.55%). However in 1390 this order changed to Amikacin (95.7%), Nitrofurantoin (91.5%), Tobramycin (64.7%), Gentamycin (64.1%) and Ciprofloxacin (37.6%).For the other common pathogen of UTI in hospitalized ward, E. aerogenes, the greatest sensitivity in 1389 belonged to Amikacin (88.58%) and then Tobramycin (70.14%), Gentamycin (69.07%), Nitrofurantoin (63.78%) and Ciprofloxacin (50%) and in 1390 this order changed to Amikacin (80.4%), Tobramycin (55.2%), Gentamycin (54.8%), Nitrofurantoin (52.1%) and Ciprofloxacin (44.3%).In outpatient ward results the greatest sensitivity in 1389 belonged to Amikacin (91.9%) and then Gentamycin (82.9%), Nitrofurantoin (73%), Ciprofloxacin (62.2%), Norfloxacin (57.8%), Ceftriaxone (42.2%), Nalidixic acid (40.6%), Cotrimoxazole (30.3%), Ampicillin (21%). However in 1390 this order changed to Amikacin (98.2%), Nitrofurantoin (91.9%), Gentamycin (75.6%), Ceftriaxone (53.3%), Ciprofloxacin (47.8%), Norfloxacin (41.6%), Cotrimoxazole (33.3%), Ampicillin (31.5%), and Nalidixic acid (31%). Conclusion: Due to the high prevalence of E. coli and E. aerogenes in hospitalized UTIs and E. coli in outpatient ward and the best obtained sensitivity to Amikacin, Nitrofurantoin, Tobramycin and Gentamycin, these drugs are recommended as first line empirical treatment of these patients

705

and for drugs with low sensitivity such as Ampicillin and Nalidixic acid there are limited indication as a single therapy in hospitalized patients UTIs. Key words: antibiotic sensitivity; hospitalized ward; outpatient ward; urinary tract infections

P-436 Evaluation of Class II integron in enterobacteriaceae isolated from clinical specimens Zandi H1, Eslami G2, Navidifar T1, Kiani Harchegani M1 1

Department of Microbiology, Faculty of Medicine, Shahid Sadoughi University of Medical Sciences, Yazd, Iran 2

Department of Parasitology and Mycology, Faculty of paramedicine, Shahid Sadoughi University of Medical Sciences, Yazd, Iran Introduction and Objectives: Antibacterial resistance in Enterobacteriaceae is a significant problem worldwide. This resistance is frequently mediated by genes localized on extra chromosomal genetic elements, such as plasmids, transposons and gene cassettes inserted into integrons. Integrons have been recognized as important contributor to the acquisition and dissemination of antibiotic resistance gene in Gram-negative bacteria. Three classes of integrons have been described with clinical relevance for antibiotic resistance. The aim of this descriptive study was the evaluation of frequency classII intgron in clinical isolates of Enterobacteriaceae.

Material and Methods: During 6 months, a total of 77 clinical isolates of Enterobacteriaceae species were collected from educational hospitals of Shahid Sadoughi University of medical sciences in Yazd. All isolates were identified by conventional methods. The antimicrobial susceptibility test was performed by Kirby-Bauer disk diffusion method according to CLSI protocols. Class II integron were detected by the PCR method using specific primers for Intl2.

Results: Out of 77 Enterobacteriaceae strains, frequency of classII integron was 24.68%. Among 19 integron carried isolates, 73.68% and 10.53% of them were identified as E.coli and Klebsiella pneumonia respectively. In this study, 68.42% of integron carried strains were isolated from urine. Susceptibility pattern were showed high level of antibacterial resistance (more than 40%) in Enterobacteriaceae isolates..

706

Conclusion: Our results show high frequency of classII integron and multidrug resistance in clinical isolates of Enterobactericeae. Considering the exact role of integrons in coding drug resistance in bacteria, the findings of this study could help us find antimicrobial resistance pattern of Enterobactriaceae isolates.

Key words: Class II integron, Enterobacteriaceae, antibacterial resistance

707

P-437

Evaluation of Metallo-beta-Lactamase production in Paseudomonas aeruginosa strains isolated from clinical specimens by phenotypic and molecular methods in Yazd-Iran Zandi H1, Eslami G2, Gholamrezaee M3 1

Department of Microbiology, Faculty of medicine, Shahid Sadoughi University of Medical Sciences, Yazd, Iran 2

Department of Parasitology and mycology, Faculty of Medicine, Shahid Sadoughi University of Medical Sciences, Yazd, Iran 3

Paramedicine Faculty,Shahid Sadoughi University of Medical Sciences, Yazd, Iran

Introduction and Objectives: Metallo-bata-lactamase (MBLs) producing Pseudomonas aeruginosa is responsible for nosocomial infections. MBLs have a board spectrum and hydrolyze Beta-lactam antibiotics. The IMP and the VIM types being prevalent types of MBLS. NDM is also a new type of MBLs. The aim of this descriptive study was to determine the MBL producing P.aeruginosa strains in Yazd by phenotypic and molecular methods. Material and Methods: During 2 year, a total of 100 P.aeruginosa isolates were collected from various clinical specimens in a teaching hospital dependent to Yazd Shahid Sadoughi University of medical sciences. All isolates were identified by conventional methods. The antimicrobial susceptibility test was performed by disc diffusion method. MBL producing P.aeruginosa were detected by E.test (imipenem/imipenem+EDTA≥8µm confirmed MBL production) and polymerase chain reaction (PCR) using specific primers for blaIMP1, blaVIM1and blaNDM. All tests were performed according to CLSI protocols. Results: Out of the100 P.aeruginosa isolates, 61% were resistant to imipenem. Among 61 imipenem resistant P.aeruginosa strains, 31(50.8%) were found to be metallo-bata-lactamase producers by MBL Etest. PCR confirmed the occurrence of sixteen (51.6%) P.aeruginosa producing blaIMP1 gene. blaVIM1 and blaNDM producing strains were not seen in this study.Out of MBL producing P.aeruginosa, 38.7% were isolated from urine and 35.48% from burn unit. All MBL producing isolates were multi drug resistant. The MBL (+) P.aeruginosa strains were more resistant to SXT and ceftazidim (93.55%), cefepim (90.33%) and cefotaxim (80.65%). Conclusion: Our findings shows the high frequency of MBLs producing P.aeruginosa, so screening of imipenem resistant P.aeruginosa isolates for MBLs production is necessary to prevent further spread of infection by P.aeruginosa.

708

Key words: Metallo-beta-lactamase, P.aeruginosa, E.test, PCR, IMP

P-438 Association between mexB Gene and antibiotic resistance pattern in Pseudomonas aeruginosa Hekmat doost M, Salehi M Department of Microbiology, Faculty of Biological Science, North Tehran Branch, Islamic Azad University, Iran Introduction and Objectives: Bacterial infections are one of the main causes of death, especially in developing countries. Pseudomonas aeruginosa infection is a serious problem in immunosuppressed patients and resistance to antimicrobial agents makes treatment more difficult; thus, fatality rates in these patients are high. In Pseudomonas aeruginosa, seven RND type pumps have been described to date, although the major efflux determinant of intrinsic multidrug resistance and the best studied of these pumps in Pseudomonas aeruginosa is MexABO-prM. MexAB-OprM exports many clinically-relevant antimicrobials, including fluoroquinolones, β-lactams, tetracyclines, macrolides and other substrates, such as dyes, detergents, biocides, homoserine lactones and organic solvents. The development of methods for the early detection and quantification of drug transport across the bacterial cell wall is a tool essential to understand and overcome this type of drug resistance mechanism. Materials and Methods: In this study, 104 multidrug resistant (MDR) strains, from different clinical sources, were isolated and identified through 16S rRNA sequencing and biochemical testing; and achieved a resistance pattern in 12 antibiotic discs through disk diffusion method and in 4 antibiotic through microdilution broth method. Presence of mexB gene was investigated using Colony PCR method. MexAB-OprM protein was extracted and its expression investigated by SDS-PAGE. Results: The disk diffusion assay results were as the following: Ciprofloxain 68% ,Norfloxain 71%, Gentamicin 62%, Amikacin 54%, Tetracycline 66%, Imipenem 42%, Piperacillin 54%, Carbenicillin 73%, Ceftazidime 65%, Cefepim 94%, Ceftriaxone 76% and cephalothin 69%. The microdilution broth method showed the following: Ceftazidime 64%, Imipenem 32%, Ciprofloxacin 65%, and Gentamicin 57%. PCR products demonstrate the presence of mexB in 28 strains from 104 clinical isolates. SDS-PAGE revealed the expression of the MexAB-OprM in 82% (23/28). Results showed that, mexB positive strains were significantly higher in antibiotic resistant in comparison with mexB negative strains (p1 day in 96% for our center and 78% for European hospitals. Conclusion: In medical wards, the high percentage of antimicrobials use and combination therapy could be targets for quality improvement in our center. In surgical wards, potential targets identified for antimicrobial stewardship initiatives include high rate of combination therapy and prolonged duration of surgical prophylaxis in or center. Key words: Point prevalence survey, Antibiotic resistance, Hospitalized children

716

P-444 The neonatal antimicrobial point prevalence survey in a Tertiary Hospital, Southern Iran in 2011 and 2012: based on the antibiotic resistance and prescribing in European Children (ARPEC) Project. Jafarpour Z, Pouladfar GHR Professor Alborzi Clinical Microbiology Research Center, Shiraz University of Medical Sciences, Shiraz, Iran. Introduction and Objectives: The frequent use of antibiotics is considered to be one of the main reasons for the high prevalence of antimicrobial resistance observed in hospitals. This study aimed at analyzing neonatal antimicrobial prescribing patterns in neonatal intensive care unit (NICU) level 3 and general neonatal medical ward of Namazi hospital, a tertiary teaching hospital in southern Iran to identify targets for quality improvement. Materials and methods: We collect data by reviewing medical charts of all neonates hospitalized at 8:00 am on the day of the survey who received at least one antimicrobial, in October 2011 and 2012. We used the validated and standardized point prevalence survey method of ARPEC project for data collection, entry, and reporting. The data compared with those of European centers. Results: A total of 68 hospitalized neonates were evaluated, 62.5% were male. Overall, 48 (70.5%) patients received at least one antibiotic. In 2012, the rate of antibiotic use in our NICU was 67% and in European NICU was 37%. The most common reasons for treatment were sepsis (45.8%). In 2012, antibiotics were prescribed empirically in 88% of our cases and 81% of European patients. The most frequently prescribed antibiotics were Ampicillin (32.4%) and vancomycin (16.2%) and cefotaxime (16.2%). In 2012, excessive use of antimicrobial combinations detected in our center (92%) compared to European hospitals (71%). Conclusion: The high prevalence of antimicrobial prescription and combination therapy could be targets for quality improvement in our center. Key words: point prevalence survey, hospitalized neonates, antimicrobials.

717

P-445 Low Prevalence of Multidrug-resistant and Extended-spectrum Beta-lactamase-producing Salmonella Species Isolated from Bloodstream at Namazi Hospital, Shiraz, Iran 2008-2013 Pouladfar GHR, Anvarinejad M, Pourabbas B, Aminshahidi M, Hoseini M, Rafatpour N, Dehyadegari MA Prof. Alborzi Clinical Microbiology Research Center, Shiraz University of Medical Sciences, Shiraz, Iran Introduction and Objectives: Salmonella species,Salmonella Typhi and Salmonella Paratyphi, are frequent causes of bloodstream infection in Asia. The emergence of multidrug resistance (restraint to ampicillin, cloramphenicol and co-trimoxazole) are a major problem that creates a biggest challenge for the clinicians in selection of suitable empirical antimicrobial agents. We conducted this study to evaluate the rate of multidrug resistant and extended-spectrum beta-lactamases-producing (ESBLs) salmonella strains isolated from bloodstream in Namazi Hospital, Shiraz, Iran over a period of 6 years. Materials and Methods: We recultured lyophilized salmonella strainsisolated from blood stream and stored at Professor Alborzi Clinical Microbiology Research Center during 2008-2013.Identification was done using conventional API. We performed aantimicrobial susceptibility tests to seven antibiotics: cotrimoxazole, ceftriaxone, ciprofloxacin, nalidixic acid, ampicillin, cloramphenicol, azithromycin according to Clinical and Laboratory Standards Institute (CLSI, USA) guidelines.Extended-spectrum betalactamases-producing strains were detected by double disc synergy test.

Results:Totally, 22 strains of salmonella spp. were isolated. The rate of multidrug resistance was about 4.5%. All strains were non-ESBLs-producing. The rates of resistance to azithromycin were 100%, nalidixic acid 50.1%, cloramphenicol 18.2%, ampicillin 18.2% and co-trimoxazole4.6%. All strains were sensitive to ciprofloxacin and ceftriaxone.

Conclusion:With respect totheabove-mentioned findings, ciprofloxacin and ceftriaxone have the most antimicrobial effects.Regularmonitoringof multidrug resistance and ESBLs production invarious times is essential for effective therapeutic outcome.

Keywords: Antimicrobial resistance, bloodstream infection, Salmonella

718

P-446 In silico selection of the best immunogenic region of Acineto bacter baumannii FepA as a vaccine candidate Bazmara H, Rasooli I Shahed University, Tehran-Iran Introduction and Objectives: Acineto bacter baumannii is a rapidly emerging nosocomial pathogen causing infections with high mortality rates due to inadequate available treatment and remarkable capacity to acquire antimicrobial resistance. Ferric siderophore complexes are produced by most bacteria to acquire iron, a vital element. These complexes are transported across the outer membrane by receptor proteins commonly known as FepA (ferric enterobactin protein).Antibiotics directed against these proteins associated with iron uptake exert a bacteriostatic or bactericidal effect against A.baumannii in vitro, by blocking sidrophore mediated iron uptake pathology.Identification and characterization of B-cell epitopes in target antigens is one of the key steps in epitope-driven vaccine design. Computational techniques offer a fast, scalable, and cost-effective approach for predicting B-cell epitopes. Attempt should be made to discover peptides that could mimic protein epitopes and possess the same immunogenicity as the whole protein. In the present study we exploited bioinformatic tools to select the appropriate region as effective B cell epitpes. Materials and Methods: In the present study, in silico study amino acid sequence of FepA protein was extracted from NCBI database. Three-dimensional structure was predicted by homology modeling and threading methods. In silico Linear and conformational epitopes for all proteins were determined via several software. Tope rated epitopes proposed with each software were determined. Results: The best immunogenic region of this protein include most number of epitopes with high scores of immunogenicity introduced with most of software was selected. Conclusion: The selected region that is consensus with various software as the best immunogenic region can be used as an epitope vaccine. This peptide can induce protective immunity in the host andit is not necessary to use whole protein as a vaccine. Keywords: Acineto bacter baumannii, FepA, B-cell epitopes, immunogenic region

719

P-447 Creating human ScFv antibody library next to tetanus toxin Rouhani Nejad H, Bazzaz M, Fallah Zadeh R, Fallah Mehrabadi J Department of Cell and Molecular Biology, Faculty of Biosciences and Biotechnology, Malekashtar University of Technology, Tehran, Iran. Introduction and Objectives: Over the last three decades, monoclonal antibodies became powerful therapeutic and diagnostic tools. Fully human mAbs show minimum immunogenic reaction. Therefore, scientists have developed different techniques such as phage display to make mAbs. The first step for this is to construct antibody genes library, and the next step is screening antibody with high affinity to target antigen. The purpose of this study was to construct an Immune antibody library from a vaccinated donor against tetanus toxin. Materials and Methods: A whole blood was drawn from the donor who was vaccinated against tetanus toxoid. PBMC was isolated by using focal. After RNA extraction, two multiplex overlap extension RT-PCR reactions were performed to amplify VH and VL regions and linking them as a ScFv antibody. The amplicons were inserted in T-vector and transformed to E.coli DH5α strain. Recombinant Plasmids were extracted and sequenced. Results: A cDNA quality was confirmed using housekeeping RT-PCR by HPRT primers. In following, transformation was applied. Positive clones were selected based on growth on LB agar and the blue/white selection method. After plasmid extraction and DNA sequencing, the sequences were aligned using BLAST at NCBI. The results showed acceptable similarity among antibody gene library nucleotide sequences and the antibody genes were deposited in this database. Conclusion: In this study, the human antibody library was constructed and confirmed using DNA sequencing and alignment the sequences. The next step is screening the library to find an antibody specific for tetanus toxin. Keywords: phage display, antibody, tetanus toxin

720

P-448 PCR‐RFLP Method for Determination of HinfI restriction pattern of Haemophilus influenzae sppompP5 in clinical isolates with the aim of vaccine design Samari Z Department of Biology Science and Research branch, Islamic Azad University, Tehran, Iran. Introduction and Objective: Haemophilus influenzae strains are divided according to capsular polysaccharide into typeable and non typeable (NTHi). Available H. influenzae type b (Hib) vaccines consist of polyribosyl ribitol phosphate (PRP) coupled to a protein carrier and does not develop active immunity against infections caused by H. influenzae in children aged 3 months until 3 years. Protein 5 is one of the H. influenzae. Outer membrane proteins (OMPs) expressed by Hib and NTHi. Analysis of the gene encoding P5 (ompP5) nucleotide sequence data revealed that this gene have variable and conserved regions. The purpose of this research is determination of PCR-RFLP pattern of H. influenzae sop ompP5 in clinical isolates for further vaccine studies. Materials and Methods: Clinical samples from 21 out patients of Imam Khomeini and Milady hospitals suffering from pneumonia and meningitis were collected.ompP5 amplified using primers designed for conserved region of this gene. Restriction enzyme analysis was performed on the conserved region of ompP5 for 15 samples using HinfI. Results: Conserved region of ompP5 was amplified in 17 samples. Hinfl restriction pattern in 14 samples were similar and in 1 sample was different from the standard strain (Hib). Conclusion: ompP5 in both strains of Hib and NTHi is highly conserved and thus could be used as a vaccine candidate against all of H. influenzae infections after further investigations. Keywords: Haemophilus influenzae, ompP5, PCR-RFLP

721

P-449 Determination of nucleotide sequence of variable region ofompP5 in clinical isolates of Haemophilus influenza spp with the aim of vaccine design Samari Z, Irani S Department of Biology Science and Research branch, Islamic Azad University, Tehran, Iran. Introduction and Objective: Isolates ofHaemophilus influenza are divided into encapsulated and nontypable strains (NTHi). Available H. influenza type b (Hib) vaccines consist of polyribosyl ribitol phosphate (PRP) coupled to a protein carrier and does not develop active immunity against infections caused by H. influenza in children under 3 years. Protein 5 is the H. influenza outer membrane protein (OMP) that is expressed by Hib and NTHi. The purpose of this research is determination of nucleotide sequence of variable region of the gene encoding P5 (ompP5) in clinical isolates of H. influenza spp with the aim of vaccine design. Materials and Methods: Clinical samples from 21 outpatients of Imam Khomeini and Milady hospitals suffering from pneumonia and meningitis are collected.ompP5 amplified using primers designed for conserved region of this gene. Restriction enzyme analysis was performed on the conserved region of ompP5 using Alul. By detecting the subsequence and comparing the subsequences of ompP5 gene of 5 clinical strains of H. influenza with standard strain, the similarities and differences between them were found. Results: Conserved region of ompP5 was amplified in 17 samples. Alul restriction patterns in 2 samples were different from the standard strain. The results of subsequence detection for the variable region of ompP5 of 5 samples was 86.24%, 100%, 92.56%, 93.94% and 88.24% similarity with variable region of ompP5 of Hib. Conclusion: These data suggested that the ompP5 is a potentially valuable vaccine candidate for Hib and NTHi disease. Keywords: Homophiles influenza, ompP5, Nucleotide sequencing

722

P-450 Comparison between active and passive immunization with flagellin-based subunit vaccine from Pseudomonas aeruginosa in the burned-mouse model Faezi S1, Shahcheraghi F 1, Behrouz B 2, Nikokar I3, Mahdavi M4, Ian Alan Holder 5 1

Departments of Bacteriology, Pasteur Institute of Iran, Tehran, Iran

2

Department of Microbiology, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran

3

Laboratory of Microbiology and Immunology of Infectious Diseases, Paramedicine Faculty, Guilan University of Medical Sciences, Guilan, Iran 4

Departments of Virology, Pasteur Institute of Iran, Tehran, Iran

5

Departments of Microbiology and Surgery, College of Medicine, University of Cincinnati, and Shriners Burns Institute, Cincinnati, Ohio, USA Introduction and Objectives: Pseudomonas aeruginosa is an opportunistic pathogen that infects hospitalized, burned and immuno suppressed patients. The main aim of the present study was to develop a vaccination strategy based on recombinant flagellin type A (r-fla-A) against P. aeruginosa in the burn wound sepsis model. Materials and Methods: After preparation of type A r-flagellin, a specific polyclonal IgG was produced in rabbit. After immediate post-burn and post-challenge, mortality rate was screened in the mice treated with anti r-fla-A IgG, and inbred mice were also immunized with r-fla-A in separate groups. Finally, vaccinated mice were burned and challenged. The functional activity of anti r-flagellin antisera was determined by opsonophagocytic killing test. To evaluate the humeral immune response, sera were analyzed by ELISA for its total and IgG isotypes antibody. Results: In vivo administration of r-fla-A afforded a remarkable improvement in the survival of mice challenged with homologous strain (PAK) in the burn wound infection (83.3% vs. 0% in control).Antibodies generated against r-fla-A and anti r-fla-A IgG achieved 25% and 33.3% survival following challenge with heterologous strain (PAO1), respectively. The anti r-fla-A IgG provided a significant improvement in survival of mice infected by PAK strain from 16.6% to 75%.Anti r-flagellin antibody promoted phagocytosis of the homologous strain and decreased the killing of heterologous strain (53.1% and 17.4% respectively vs. 3.7% in the control group). Flagellin also induced a high level humoral immune response in the immunized mice via IgG1production. Conclusion: We concluded that immunization with r-fla-A and anti r-fla-A would protect burn edmice against lethal P. aeruginosa challenge. Keywords: Pseudomonas aeruginosa, flagellin, immunization, burn

723

P-451 Stability studies on the vaccine diluent used at Razi vaccine and serum research institute Khoshnood S , Mojghani N Biotechnology department ,Razi vaccine and serum research institute,Karaj Abstract: In house prepared physiological saline is used for diluting the lyophilized animal vaccines manufactured at Razi institute. This diluent is prepared by WFI made at Razi institute and sodium chloride salts. This study was conducted in order to determine the stability of the mentioned diluent. Pyrogeny, sterility and Physico-chemical tests were performed on three different batches of the diluent stored at variable temperature for a period of three years. According to the results the diluent was stable between 4 to 37°C during the tested time period. All samples appeared sterile, non pyrogenic and no change in their pH and sodium chloride content was recorded during the period. All results were in accordance with the British pharmacopia 2011.To conclude, the expiry date of the diluent as mentioned on the label is two years at cool temperature (below 37C) but based on the results it is suggested that the expiry date of this product could be extended to three years at room temperature. Keywords: vaccine diluents, Pyrogeny, sterility, Physico-chemical tests

724

P-452 Neutralizing antibody response against inactivated FMDV type O/IRN/2010 vaccine by electron beam in BALB/C mice MotamediSedeh F1, Chahardoli Sh2, Mahravani H3, Harzand Ni2, Sotoodeh M3 1

Nuclear Science and Technology Research Institute, Tehran, Iran Karaj Islamic Azad University 3 Razi Vaccine and Serum Research Institute 2

Introduction and Objective: Foot-and-mouth disease virus (FMDV) is an important disease of farm animals. The disease results in considerable economic losses. Control of the disease is mainly achieved using inactivated vaccines. The aim of this study is evaluation of Neutralizing antibody response in vaccinated BALB / C mice by electron beam inactivated FMD Type O/IRN/2010. Materials and Methods: FMD virus type O/IRN/2010 was inactivated by electron beam without antigenic changes as electron radio vaccine. The BALB / C mice were divided into three groups, each group containing five mice. Three groups of mice were inoculated with conventional vaccine and electron beam irradiated vaccine FMDV type O/IRN/2010 subcutaneously two weeks interval, the final group as negative control. The sera were separated from the blood samples of mice 14 days after vaccinationand tested for the presence of antibodiesagainst FMDV type O 2010 by serum neutralization test. The SerumNeutralization Test (SNT) was carried out according to the Kraber protocol. Results: The results of the SNT, in three groups of mice 14 days after last vaccination showed the titration of neutralizing antibody in the vaccinated mice groups; electron radio vaccine; andconventional vaccine, were significantly higher than that in negative control group (PRial 7000000 (57%, 114). The mean knowledge score of mothers was 35.29±7.38 (intermediate level, equal to answering 64%). The most important source of information gain in mothers was the media (62.5%, 125) and healthcare worker (30.5%, 65). The most significant concerns in neglecting the regarding vaccination in mothers was death from vaccination (62.5%, 125). Conclusion: Totally, pregnant mothers had concerns and would like to increase immunization information. The awareness of risks and benefits of vaccines was the most important factor for leading to modifying practice and prevention of diseases. Healthcare worker should recognize the high proportion of pregnant mothers with concerns about vaccinating and had spent more time on discussing vaccination with pregnant mothers who were more doubtful about vaccines. Keywords: Attitude, Knowledge, Practice, Pregnant mothers

726

P-454 Prediction of interspecies relationship property to be a Vaccine Candidate of Segment 4 protein of Influenza A virus from Iran Shafaati M.R1, Yazdansetad S2, Shafaati M3, Khadem N1 1

Islamic Azad University, Damaghan Branch, Damaghan, Iran

2 Young Researchers and Elite Club, Damghan Branch, Islamic Azad University, Damghan, Iran 3 Islamic Azad University, Address: Science and research Branch, Iran

Introduction & Objectives:Fourantigenicsitesontheglobularsurface antigenhemagglutinin(HA)existsthatamino acidsubstitutioncaused byapoint mutationinthis regionhasbeenintensified. The purposeof thisstudy was to investigatethegeneH1N1 (segment4) to find specific relationshipswithinandbetweenhydrophilicandantigenicregions ofthe proteinusinga computertoolfor the introduction ofvaccinecandidatesagainstinfluenza. Materials and Methods: The goal of this research work includes analyzing the gene sequence of segment 4 from H1N1 (IRAN), to find out interspecific relationship between them by using advanced tools and techniques, for prediction of vaccine candidate we have predicted hydrophilic, property to be a vaccine candidate for future invention. Results: The nucleic acid sequence of H1N1 segment 4 has 1071 base-pairs. By using Bio-Edit we have predicted the sequence similarity interspecifically in between 20 species for evaluating the relationship between them, also calculated the entropy of the segment 4. Data obtainedshowed manysimilarities betweeninfluenza virussegment 4isolates from IranandSaudi Arabia. Conclusion: In this study, phylogenetic analysis of H1N1 Swine influenza virus genome segment 4 was shown.StrainsisolatedinIran havemany similaritieswithstrainsisolated fromSaudi Arabia.The results were as expected, produceda vaccine againsteachothercanbe an effectiveframework. Therefore,an effective vaccineagainstthis virus requires efficient designs.

Keywords: H1N1 swine flu segment 4, interspecies relationship, vaccine candidate

727

P-455 A new conjugated vaccine made by oligopolysaccharide of Salmonella Paratyphi A and Diphtheria toxoid, can increase the IgG and IgM antibody levels against Salmonella paratyphi A in mice Mohseni Meybodi MA.1, Rahnema M.2, Shapoury R.3 1

Department of Microbiology, Zanjan Branch, Islamic Azad University, Zanjan, Iran

2

Associate Prof of Biology, Biology Research center, IslamicAzaduniversity, Zanjan Branch, Zanjan, Iran. 3

Assistant Prof of Microbiology, Biology Research center, IslamicAzaduniversity, Zanjan Branch, Zanjan, Iran.

Introduction and objectives: Salmonella Paratyphi A is a subset of the Enterobacteriaceae family that cause sparatyphoid fever.The aim of this study was to develop candidate vaccines to prevent the disease. Materials and Methods: LPS of the Salmonells bacteria was isolated using a modified hot phenolextraction.OPS was isolated from LPS by dialysis. The OPS was purified by column chromatography using sepharose CL-2B gel. 36 BALB/c mice were divided into four groups (9 in each) according to the kind of injection; pure OPS, conjugated vaccine, pure Diphtheria vaccine and normal salin (as control group) respectively. Vaccination was performed in three steps by two weeks of intervals. The inductions of Gig and I’m measured by ELISA method in incubated mice after each injection. Results: According to the results of the ELISA test, the conjugated vaccine is a strong immunogen in mice. All mice receiving conjugated vaccine had statistically higher IgG and IgM levels, after each incubation, than that detected in other groups. Conclusions: The conjugation of Diphtheria toxoid with OPS of Salmonella paratyphi A leads to production of a high performance vaccine which can activate Tells, induce a memory cell production and make a long- stable protection against paratyphoid fever. Keywords: Salmonella paratyphi A, Diphtheria toxoid, Conjugated vaccine, ELISA, Paratyphoid fever.

728

729

P-456 Immunogenicityof Influenza Vaccine in HIV-Patients Akbari M1, Baharlou R2, RazaviF2 1

Department of Student Research Committee, School of Medicine, Jahrom University of Medical Sciences, Iran 2 Department of Immunology, School of Medicine, Jaharom University of Medical Sciences, Iran Introduction and Objectives: Human immunodeficiency virus (HIV), the etiologic agent that causes AIDS, is the fourth largest killer in the world today.Since Individuals with immunodeficiency diseases, including HIV infection, are among highriskgroups for complications and premature deaths from seasonal influenza, therefore, from influenza vaccination was recommended as a prevention strategy. In this study, the immunogenicity oftwodoses ofinfluenza vaccine with single dose of that in HIV-positive participants was compared. Materials and Methods: In this review, the immunogenicity of influenza vaccine in single –and two-dose in HIV- positive individuals is reviewed in context of clinical and serocon version states. Results: In this study, the seroconversion rate and seroprotection rate before and 21 days after the first dose and 21 days after the second dose of the vaccine is reviewed. The findings of studies Indicate that after a single immunization, HIV- positive patients had seroprotection rate of 77% and seroconversion rate of 67% and after two immunizations the rates increased significantly to seroprotection rate of 97% and seroconversion rate of 86%. Conclusion: A single dose of influenza vaccine created an adequate immune response in HIV infected patients but with doses of that improved the immunogenicity further. Keywords: HIV-patients, Influenza vaccine, Seroconversion

730

P-457 Effect of Gamma –irradiation on of Foot and Mouth Disease Virus type Asia1 MotamediSedeh F1, Javadi M2, Mahravani H3, Harzandi N2, Sotoodeh M3 1

Nuclear Science and Technology Research Institute, Tehran, Iran Karaj Islamic Azad University 3 Razi Vaccine and Serum Research Institute 2

Introduction and Objectives: Foot-and-mouth disease (FMD) is an acute and highly contagious vesicular disease affecting cloven-hoofed animals. The aim of this research is inactivation of FMDV type Asia1 by Gamma irradiation in order to prepare inactivated vaccine. Materials and Methods: FMD virus typeAsia1was multiplie don BHK21 cell line, the virus was titrated by TCID50 method. The FMD virus samples were irradiated by gamma ray from60Co source and the titration of irradiated virus samples was calculated by Read and Munch method. The Dose/Survival curve for irradiated FMD typeAsia1 Virus was drawn by OriginPro6.1 software. The D10 value factor and the optimum dose range for inactivation of the virus were calculated according to the Dose/Survival curve. Infectivity of the irradiated virus by optimum dose of gamma ray was determined as safety test during four blind cultures. Results: The virus titration was decreased gradually by increasing of gamma irradiation (P< 0.05). According to the Dose/Survival curve, the optimum dose range of gamma ray for FMD Virus type Asia1inactivation and the D10 value factor were calculated to be 7.69 and 50kGy, respectively. The results of safety test for irradiated virus were without any Cytopathiceffect after four times of blind culture. Conclusion: The conventional method of virus inactivation is based on the chemical substance such as, binary ethylenimine (BEI), formaldehyde, etc which are associated with the risk. But gamma irradiation can decrease this risk. Therefore, FMD inactivated vaccines by gamma irradiation can play a key role in the control and eradication of FMD. Keywords: Foot and Mouth Disease Virus, Gamma irradiation, Inactivation .

731

P-458 In silico analysis of L1 and L2 proteins of human papilloma viruses: designing a universal vaccine for HPVs Ghorbanhosseini N1, Rahimi A2, Rezaei M3, Mahdavi M4 1

Department of Microbiology, Pharmaceutical Sciences Branch, Islamic azad university, Tehran, Iran 2 Department of Microbiology, Islamic azad university of Urmia, Urmia, Iran 3 Department of Microbiology, Pharmaceutical Sciences Branch, Islamic azad university, Tehran, Iran 4 Department of Virology, Pasteur Institute of Iran, Tehran, Iran Introduction and Objectives: Human papilloma virus (HPV) is one of the most common sexually transmitted infections in sexually active adolescents and young women and has been implicated as a cause of the majority of cases of cervical cancers, which is the second most common cancer in women all around world. The high-risk HPVs include HPV16, 18, 31, 45 and 58 which are of particular importance, since they have been highly associated with over 80% of all cervical cancers. HPV capsid proteins, including L1 and L2 proteins, were shown to generate neutralizing antibodies against HPV particles in immunized cases. In this study, using silico analysis we designed a universal vaccine for human papilloma viruses. Materials and Methods: At first, HPV protein sequences of high-risk serotypes (for L1 and L2) were obtained from NCBI databank. After alignment, different L1 and L2 sequences were tested by hybrid prediction method for epitopes that have immunogenicity for T cell and potency for attachment to HLA-A*02:01 (A2) and H2-Kd. Selected epitopes were attached to each other in different patterns and evaluated for best status of proteasome cleavage sites. Also, Codon optimization was done for compatibility of the designed vaccine with different expression systems. Results: Result of Hybrid method and also selection among 5 high risk serotype sequences that overlap between HLA-A*02:01 allele & H2-Kd ; HPV16 L1 28-37 (SLWLPSEATV) , L2 114123 (FIDAGAPTPV), HPV18 L1 44-53 (HYIILFLRNV), L2 225-234 (RLYSRAYQQV); HPV31 L1 390-398 (TYIHSMNPA), L2 221-230 (GLYSKATQQV); HPV45 L1 420-428 (YIHSMNSSI), L2 226-234 (LYSRANQQV); HPV 58 L1 28-37 (SVWRPSEATV) L2 325-334 (YQDLSPIQPV). At least 8 fusion peptides that had best patterns of proteasome cleavage sites in construct were chosen. Conclusion: It seems that designing of a rational universal vaccine that immunologically covers HPV16, 18, 31, 45 and 58 strains is feasible in order to develop a cervical cancer prophylactic universal vaccine. Keywords: human papillomavirus (HPVs), T cell, Epitope prediction, Universal vaccine

732

733

P-459 Immuno-reactivity of nano-vaccine from Leishmania major TSA recombinant protein formulated in chitosan KhabazZadeTehrani N1, TabatabaieF2, Imanifooladi A.A3, Mahdavi M4 1

Microbiology Dept., Science& Research branch, Islamic Azad University, Tehran, Iran,

2

Parasitology and Mycology Dept., School of medicine, Iran University of medical sciences, Tehran, Iran, 3

Applied Microbiology, Research Center, Baqiyatallah University of Medical Science, Teheran, Iran 4

Virology Dept., Pasteur Institute of Iran, Tehran, Iran.

Introduction and Objectives: The availability of hundreds of adjuvants has prompted a need for identifyingrational standardsfor the selection of adjuvant formulation based on immunological principles for human vaccines.Chitosan, as a biopolymer, is the deacetylated form ofchitin that has threetypes of reactive functional groups. This nano-particle is characterized bylow porosity and weak diffusion properties; so long contact times are required. The thiol-specific antioxidant (TSA) is a considerable antigen of Leishmania major. The main aim of this study was to evaluate the adjuvant activity of chitosanon TSA as an appropriate Leishmania major subunit based vaccine. Materials and Methods: Plasmids contain TSA gene was sub-cloned into the PET28a expression vector. The expression of recombinant protein was confirmed with SDS page and western blotting. Forty-eight ALB/c mice were divided into four groups (TSA/Freund, TSA/Alum+BCG, TSA/chitosan adjuvants and PBS control groups) and immunized with20 g of vaccine subcutaneously three times intervals on days 0, 14 and 28. The mice were challenged with parasite 21 days after final immunization. All immunologic parameters comprising, lymphocyte proliferation were evaluated with Brdu method. IL-4, IFN- cytokines and also total antibody, IgG1and IgG2a isotopes were evaluated with ELISA method. Finally lesion size was evaluated after the challenge. Results: Vaccine formulated with recombinant TSA-Chitosan induced lymphocytes proliferation and total antibody, as compared with the control groups. Conclusion: The study concludes that TSA vaccine formulated in chitosan stimulates immune responses and can be used for further studies. Keywords: TSA Recombinant protein; Chitosan;Leishmaniasis; Vaccine

734

P-460 Epidemiologic review of side effect from vaccination in vaccinated people by Karaj health center (NO.2) during years of 1390-1391(2012-2013) Khani Y, Kabir K, Rasi M, Mollajan A Karaj Health Center (NO.2), Alborz University of Medical Sciences, Karaj, Iran Introduction and Objective: The occurrence of side effect after vaccination is undeniable. Adverse events following immunization (AEFI) are vaccine reaction, program error, coincidental, injection reaction and unknown reaction. According to aforementioned point, the aim of this study was epidemiologic review of side effects from vaccination in vaccinated individuals by Karaj health Center (no.2) during 2012-2013 Materials and Methods: In a cross sectional study, all vaccinated people between2012-2013 in 40 vaccination centers were studied. To collect data, a specific questionnaire, including vaccine recipient profile, type of vaccine, birth weight, and 15 adverse reactions was used. Results: The results showed that 284 individuals were reported with different kind of side effects including Lymphadenitis 152(52.53%), High fever 30(10.56%), Sever area side effect 26(9.15%), Skin allergy 14(4.92%), Constant screaming and restlessness 14(4.92%), Toughness in injection area 14(4.92%) and others 34(11.97%) cases. Considering side effects related to vaccine type, results were as follow: BCG 132(46.6%), DTP 62(21.8%), MMR 56(19.7%) and others vaccine 34(11.9%) cases. Considering side effect based on AEFI categorization, results were as follows: Vaccine reaction 110(38.73%), Program error 124(43.66%), Coincidental 20(7.04%), and Injection reaction 30(10.56%) cases. Conclusion: Complications of immunization program is low but considerable. By considering that 43% of the observed side effects were related to program error, it is vital to provide vaccinator with training classes. Also, by considering that over 68% of the observed side effects are caused by BCG and DTP vaccines it is important to take it into account and find suitable solution for this problem. Key words:vaccination, review, side effect, Karaj

735

P-461 Designing and constructing a DNA vaccine encoding TB10.4 gene of Mycobacterium tuberculosis Samira Rashidian1, Zahra Meshkat1, Ali Sadeghian1, SaeidAmel Jamehdar2, 1

Microbial Resistance Research Center, Avisenna Institute, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran 2 Infection Control and Hand HygineResearch Center, Imam Reza Hospital, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, Iran

Introduction and Objectives: Tuberculosis (TB) remains one of the leading causes of morbidity and mortality in humans, and it represents a major public health problem in many countries. The current vaccine against Mycobacterium tuberculosis, Mycobacterium bovis bacillus CalmetteGuerin (BCG), has demonstrated variable protective efficacies ranging from 0 to 85% in different field trials. It has been demonstrated that T cell-mediated immune responses are essential for control of tuberculosis. A number of CD8 epitopes have been identified in M.tb proteins, such as TB10.4, Ag85A and Ag85B.In the present study; we constructed a DNA vaccine which contains TB10.4 in order to study it in subsequent research. Materials and Methods: M. tuberculosis H37Rv was grown at 37 ◦C on Lowenstein-Jensen medium. DNA extraction was done by boiling method. The nucleotide sequence corresponding to TB 10.4 gene was PCR amplified using specific primers. After agar gel elution, the PCR product was cloned into pcDNA3 vector. Results: Recombinant vectorwas assessing by colony PCR. A 291 bp fragment was seen. The recombinant construct containing TB10.4 had its sequence check with sequencing. Conclusion: We demonstrated that the TB10.4 was cloned in appropriate plasmid. In future we will assess protein production and it immunogenicity in mice. The capacity to induce both humoral and cellular specific immune responses may potentiate the chances of this antigen to be used as vaccine for TB. Keywords: Tuberculosis, DNA vaccine, TB10.4 gene

.

736

P-462 Methylation status of E6 Promoter in high-risk and low risk HPV Zafari E1, Soleimanjahi H1, MirabSamiee S2, HadiRazavinikoo S.M1 1

Department of Virology, Faculty of Medical Sciences, TarbiatModares University Food and Drug Laboratory Research Center, Ministry of Health and Medical Education, Tehran, Iran 2

Introduction and objectives: Cancer of the uterine cervix is an important cause of death in women worldwide. Methylation at position 5 of cytosine in DNA is an important event in epigenetic changes of cells, the methylation being linked to the control of gene functions. The DNA methylation can be analyzed by bisulfite genomic sequencing. DNA methylation contributes to the chromatin conformation that represses transcription of human papilloma virus type16 (HPV-16), which is prevalent in the etiology of cervical carcinoma. Because dysregulated genes frequently show abnormal patterns of DNA methylation, we hypothesized that comprehensive mapping of the HPV methylomes in cervical samples at different type of low risk and high-risk would reveal patterns of DNA Methylation. Materials and Methods: Inthisstudy Methprimer and Methyl Primer Express v1.0 software was used to design primers for the promoter region of the types 11, 16, 18 and HeLa cell as a positive control. Methylation status of E6 Promoter of high-risk and low risk HPV was analyzed by BSP and by bisulfite-modified DNA sequencing. Results: PCR products were run on agarose gel and the related bands were observed. The PCR product was cloned and confirmed by sequencing. It was observed that methylation of the promoter is different in high-risk and low risk HPV. Conclusion: Based on the results methylation status of high-risk and low risk HPV-E6 Promoter are different and probably reveals a significant correlation between HPV-induced cervical carcinogenesis. Keywords: Methylation, epigenetic, bisulfite genomic sequencing, HPV, low risk, high-risk

737

P-463 Investigation of human papillomavirus genotypes associated with breast cancer in Iran Nahavandi Araghi A3, Rassi H 1,Tabaraie B4, Hashemi M5, Salehi B 1,Mohammadian T2 1

Department of Microbiology, Karaj Branch, Islamic Azad University, Karaj, Iran Department of Microbiology, Shahr-e-Qods Branch, Islamic Azad University, Tehran, Iran 3 Biotechnology Academy of Gene Gostar, Karaj, Iran 4 Department of Bacterial Vaccine, Pasteur Institute of Iran, Tehran, Iran 5 Khatam Hospitals, Tehran, Iran 2

Introduction and Objectives: High-risk human papillomaviruses (HPV) are the causative agent of several cancers. In this study, the prevalence and genotype distribution of HPV infection among Iranian patients with breast cancer (BC) were determined. The study group consisted of postoperative tissues from patients diagnosed with breast cancer. 150 formalin-fixed, paraffinembedded tissue blocks from 150 breast cancer samples were analyzed. Verification of each cancer reported in a relative was sought through the pathology reports of the hospital records. The prevalence of HPV by Multiplex PCR in breast cancer was evaluated. Materials and Methods: DNA extracted by the simple boiling method yielded higher proportionsof successful gene amplifications (99 %) for b-actin gene. Results: Prevalence of HPV infection was 34.6 % in the archival breast cancer samples. HPV DNA typing identified 52 infections: 21 (40.38%) HPV 16, 15 (28.84%) HPV 18, 8 (15.38%) HPV 11, 4 (7.69%) HPV 31, 2 (3.84%) HPV 33 and 2 (3.84%) HPV35. In this study HPV types 16, 18, 31, 33 and 35 were considered high risk. Overall, MY09/11 consensus PCR failed to detect 44 (55.69%) of all HPV infections and interestingly, the predominant genotype detected in all cancers was the oncogenic variant HPV16/18 and about 34% of women aged 24 to 54 were infected with at least one type of HPV. Conclusion: Our results demonstrate that DNA derived from archival tissues archived for less than 8 years couldbe used successfully for HPV genotyping by multiplex PCR. The results indicate a likely causal role for high-risk HPV in BC, and also offer the possibility of primary prevention of BC by vaccination against HPV in Iran.

Keywords:human papillomavirus genotypes, breast cancer, Multiplex PCR, oncogenic variant HPV16/18

738

P-464 The frequency of Enterovirus71 in children with aseptic meningitis in Tehran Rahimi P1, Roohandeh A2, Sohrabi A3,4, Mobasheri M5, Azadmanesh K4, Shahoseini Z4, Motamedi Rad M4 1

Department of Hepatits and AIDS, Pasteur Institute of Iran

2

Pharmaceutical science branch, Islamic Azad University, Tehran, Iran

3

Department of Molecular Medicine, School of Advanced Medical Technologies, Tehran university of Medical Sciences, Iran 4

Department of Virology, Pasteur Institute of Iran

5

Departments of Medical Biotechnology, School of Pharmacy, Islamic Azad UniversityPharmaceutical Branch, Tehran, Iran

Introduction and objectives: Human enteroviruses are members of the Enterovirus genus of the family Picornaviridae. Human Enterovirus71 is the most recently described serotype of the genus enterovirus and like the other members of this genus can cause aseptic meningitis in both infants and adults. In this study, we determine the prevalence of enteroviruses, especially HEV71 in children who were referred to 3 hospitals of Tehran. Materials and methods: In total, 102 Cerebrospinal fluid samples were collected from patients with aseptic meningitis and White Blood Cell count of more than 5x106/mm3, Enterovirus RNA was extracted with Roch extraction kit and Enteroviral infection was detected by Reverse Transcriptase polymerase chain reaction test. Subsequently, a HEV71-specific RT-PCR assay was used to determine the HEV71 infection. Results: Enterovirus was isolated from 63 (61.76%) of the 102 aseptic meningitis patients enrolled in the study. HEV71 was identified in 14 (22.22%) of the enterovirus-positive patients. From HEV71 positive cases: 8 (57.14%) patients were younger than 2 years old, 11 (78.57%) were male and 3 (21.43%) were female. The seasonal peaks of HEV71 and other entroviruses were observed during autumn and winter. Conclusion: HEV71 is the causative agent of a variety of diseases from hand, foot and mouth disease to severe neurological complications and is now considered as an important cause of childhood aseptic meningitis. This is the first study on epidemiology of EV71 in children in Iran that showed the circulation of HEV71 in Tehran. Keywords: Human Enterovirus A; Aseptic Meningitis; Cerebrospinal Fluid; Reverse Transcriptase polymerase Chain Reaction.

739

740

P-465 Device designation for pathogen reduction in human plasma Elikaei A1, Hosseini SM 1, Latifi H2, Sharifi Z3, Nikbakht H2, Mirshafiee H1, Asadollahi A2 1

Department of Microbiology, Faculty of biological science Shahid Beheshti University Laser and Plasma Research Institute, Shahid Beheshti University 3 Blood Transfusion Research Center, High Institute for Research and Education in Transfusion Medicine, Tehran, Iran 2

Introduction and Objectives: Despite improvement in safety of plasma products, the possibility of virus transmission still remains a problem. Lack of diagnosis of viruses by current diagnostic methods in the windows period for some viruses, re-emerged, mutant and new viruses have introduced the most risks to the plasma recipients. So as WHO (World Health Organization) recommends, many countries developed PRT (pathogen Reduction Technologies) to inactivate pathogens, especially viruses in plasma components. The MB (Methylen Blue) based methods especially Thera flex® are one of the most famous and universal one. The purpose of this research was designation and manufacturing a device that can inactivate viruses in MB environment. Materials and Methods: Totally, 143pcsof1WredLEDlamp have been used on the device to emit light with wave length (central wavelength) of 627nmand the width (FWHM full width at half maximum) of 20nm. Two sides' pouch escan beirra diated simultaneously. The distance of the middle of the bag from LED arrays, 4.5cm has been considered. This device was designed for light (LED, including the distance and placement of blood bags per LED)with the help of simulations of ware Wolfram Mathematica® considering the intensity profile(intensity profile) LED sand right number of used LEDs. Light emission ot the plasma bag was optimized and uniformed. Results: By optimizing the placement of LED, 75% of the radiation was emittedinto the bagandthe baglimitwas less than40%changein theintensity ofthepeakintensity. Maximumirradiation power obtained was 650 mW / cm2. Conclusion: In Theraflex® system 180 J/cm2 for 15 min for each bag is used to inactivate pathogenssuspended in MB. This device that designed and manufacturedcan reach required energy level and ready for further inactivation study. Keywords: Pathogen reduction, Human Plasma, Device.

.

741

P-466 A survey on Epstein- Barr virus infection in patients with leukemia/ lymphoma and anemia Dehghani Samani A, Dehghani Samani A, Mahzoonieh M.R Faculty of Veterinary Medicine, Shahrekord University, Shahrekord, 115, Chahar Mahal & Bakhtiyari, Iran. Introduction and Objectives: The Epstein-Barr virus (EBV) is a gamma herpes virus which causes infectious mononucleosis and has been associated with a variety of neoplasms including endemic Burkitt's lymphoma, undifferentiated nasopharyngeal carcinoma, Hodgkin's disease, some T-cell lymphomas, polymorphic B cell lymphomas and a typical B-cell lymphoproliferation in immunosuppressed individuals. EBV was first reported as the etiological agent of Burkitt‟s lymphoma in 1964. Although EBV is linked to a number of different types of tumors, the association between this virus and T-cell prolymphocytic leukemia has not been previously explored. EBV has also been linked to T-cell lymphomas, Hodgkin‟s lymphoma, and etc. The aim of this study is showing the relationship between infection by EBV and occurrence of leukemia/ lymphoma and anemia in patients. Materials and Methods: Totally, 100 Whole blood samples were taken from three groups of referred persons to Seyyed A Shohada Hospital in Isfahan, central Iran. 33 Samples from patients with anemia, 33 Samples from patients with lymphoma and 34 Samples from healthy persons without anemia and lymphoma. Then sera were extracted. In next step, DNAs were extracted and then primer with the chain 5´GCAGGGCTCGCAAAGTATAG3´ used for PCR analysis. PCR was performed by heating at 95 ◦C for 5min and subsequently for 40 cycles, each cycle including 95 ◦C for 1min, 56 ◦C for 1 min, and 72 ◦C for 2 min, followed by further incubation at 72 ◦C for 10 min, in a PTC-100 programmable thermal cycler. 50 micro liters aliquots of PCR products were loaded then assayed by electrophoresis on a 2.0% ME-agarose gel and visualized by ethidium bromide. Then gel imaged by gel-doc. Results: After the electrophoresis and imaging, sharp bands with 760 pb were formed in 3 samples that reported as EBV positive samples after the sequencing of 50 micro liters of PCR products. One person with anemia and two persons with lymphoma were EBV positive. There were no significant relationships between the infection by EBV andoccurrence of anemia and also between EBV and occurrence of lymphoma. Conclusion: We advise that in next research on EBV and occurrence of leukemia/ lymphoma and anemia in patients, researchers focus on other factors that have more effect on occurrence of leukemia/ lymphoma and anemia, because there were no significant relationships between the infection by EBV andoccurrence of anemia and also between EBV and occurrence of lymphoma in our study and also in the same studies about this relationship in Iran. Keywords: Anemia, Epstein- Barr virus, leukemia/ lymphoma

742

743

P-467 Prevalence of human T Lymphotropic virus type I (HTLV-I) in patients with coronary artery disease Behboudi B1, Meshkat Z2, Gayour Mobarhan M3,Jashnsaz A4 1 2

Department of Microbiology, Science and Research branch, Islamic Azad University, Fars, Ira. Women’s Health Research Center, Mashhad University of Medical Sciences, Mashhad, IR Iran.

3

Biochemistry of Nutritional Research Center, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, IR Iran. 4 Pharmacy School, Mashhad University of Medical Sciences, Mashhad, IR Iran. Introduction and Objectives:Specific infectious agents have been found to be related to the pathogenesis of coronary atherosclerosis. Few studies have shown the association between HTLV-I infection and coronary artery disease (CAD). Mashhad (Razavi Khorasan Province, Iran) is an endemic region for HTLV-I. Therefore, the present study was carried out to evaluate the prevalence of HTLV-I on CAD in this population. Materials and Methods: One hundred and forty patients admitted to Qaem Hospital (20112012) were included in this study. The seroprevalance of HTLV-I infection was determined by the ELISA method. Results: Our study participants comprised 140 (53% male and 47% female; age range of 40 to 76 years) patients who underwent coronary angiography. The angiography results indicated that patients with and without CAD, 73(50%) and 73(50%), respectively. The prevalence of HTLV-1 was 0.0% and 2.8% (2 of 73) in patient with and without CAD, respectively. Conclusion: Our results suggested the prevalence of Human T Lymphotropic Virus Type I (HTLV-I) infection is low in patients with coronary artery disease. Key word: Human T Lymphotropic Virus Type I (HTLV-I), Coronary Artery Disease (CAD), angiography

744

P-468 Hepatitis B virus infection in patients with coronary artery disease Behboudi B1, Meshkat Z2, Gayour Mobarhan M3, Jashnsaz A4 1

Department of microbiology, Science and Research branch, Islamic Azad University, Fars, Iran

2

Women’s Health Research Center, Mashhad University of Medical Sciences, Mashhad, IR Iran

3

Biochemistry of Nutritional Research Center, Faculty of Medicine, Mashhad University of Medical Sciences, Mashhad, IR Iran 4

Pharmacy School, Mashhad University of Medical Sciences, Mashhad, IR Iran

Introduction and Objectives:Many studies have reported on the association between human coronary artery disease (CAD) and certain persistent bacterial and viral infections. Currently, it is unclear whether hepatitis B virus infection is associated with the risk of the atherosclerosis. The aim of this study was to investigate the hepatitis B virus infection in angiography-proven CAD patients. Materials and Methods:Sera from 140 patients who underwent coronary angiography were tested for hepatitis B surface antigen (HBsAg) by enzyme-linked immunosorbant assay (ELISA). Results:Our study population included 140patients (53% male and 47% female; age range of 40 to 76 years), who underwent coronary angiography. Their angiographic results showed 73(50%) patients with CAD and 73(50%) patients without CAD. The prevalence of HBsAg positivity was0.0% and 4.2% (3 of 73) in patients with and without CAD, respectively. Conclusion:Our results suggest that hepatitis B virus infection is low in patients with coronary artery disease. Key word:Hepatitis B virus (HBV), HBsAg, Coronary Artery Disease (CAD)

745

P-469 Spontaneous clearance of HCV infection is associatedwith+A2109G IFN-γ gene polymorphisms in Fars Province, Southern Iran Sarvari J1, Moattari A1, Pirboonyeh N1, Hossini Y2, Moeini M2, fattahi M.R2 1

Department of Bacteriology and Virology, Shiraz University of Medical sciences, Shiraz, Iran

2

Gastroenterohepatology research center, Shiraz University of Medical sciences, Shiraz, Iran

Introduction and Objective: Following hepatitis C virus (HCV) infection, spontaneous viral clearance occurs in 10-40% of individuals, generally within the initial 6 months. In HCV infection an inappropriate ratio of cytokine may determine different outcomes of the infection. Certain polymorphisms in the regulatory regions may affect cytokine production; therefore, we aim to determine the effect of IFN-γ gene at +2109A/G loci on HCV infection; Chronic infection versus spontaneous clearance. Materials and Methods: Totally, 200 patients with chronic hepatic C and 48 individuals who spontaneously clear the infection were included in this study. The presence of chronic HCV infection and/or spontaneously clearance of infection in participants were confirmed using ELISA and quantitative RT-PCR techniques. Genomic DNA of the participant was extracted using salting out method. IFN-γ gene polymorphism was carried out using PCR-RLFP method on genomic DNA. Results: The frequency of GG genotype (p=0.0001, OR=0.18, CI: 0.07-0.45) and allele (p=0.0001, OR=0.2.73 CI: 0.1.54-4.83) of IFN-γ gene at +2109 loci were significantly different between individuals with chronic infection and those who spontaneously clear the infection. Conclusion: Our findings indicated that individuals with GG genotype at +2109 loci of IFN-γ gene may spontaneously clear HCV infection more frequently than those with AA genotype.

Keywords: Hepatic C virus, interferon-γ, Polymorphism, Chronic infection, Spontaneous clearance

746

P-470

Isolation and Cloning of human St6galnac5 (siat7e) from cancer cells for MDCK cell suspending

Akbari KH1,2, Mohamadpour A3, Fotouhi F2, Mazaheri V2, Kamali R2, Saleh M2, Tabatabaian M2, TavasotiKheiri M2, Farahmand B2

1

Pharmaceutical Sciences Branch of Islamic Azad University

2

Department of virology (Influenza Unit), Pasteur institute of Iran

3

Science and Research Branch Kurdistan of Islamic Azad university

Introduction and Objective: MDCK cells were found to be suitable for influenza virus production but their inability to grow in suspension burdens the process of scale up and hence their production capability. St6galnac5 is Golgi type II trans membrane glycosyl transfers that is identified as having an important role in cellular adhesion. These enzymes catalyze transfer of sialic acid from CMP-Neu5Ac to the glycan moiety of glycol conjugate on the cell surface. This isolated gene will be able to convert anchorage-dependent MDCK cell to anchorage- independent cells. Materials and Methods: Total RNA was extracted from cancer cell line. cDNA was obtained and used as a template in PCR. RT-PCR was carried out for amplifying specific sequences of siat7e gene by designed specific primers.PCR productswere confirmed by enzyme digestion. Then, it was cloned into pGEMTEasy vector then the recombinants were selected and analysis. Results: The extracted plasmids was sequenced and aligned with different siat7e sequences. The results revealed about more than 99% identity with sequences that are presented in Genbank. Conclusion: This gene encodes a protein that is responsible for the synthesis of disialoganglioside that is involved in cell adhesion. Recent studies show this protein acts as a mediator (decrease cell adhesion) in

747

metastatic cancer cell line. In this study three pairs of primers were designed based on the Sialyl motifs. This motifs playsmain roleinsialylation of glycoproteins. Key words: Human Siat7e, MDCK, Suspension, Influenza virus

748

P-471 The frequency of HPV-16 and HPV-18 in 20-35 years old women’s Pap smear samples, referred to the pathological laboratories in Rasht city by Real-Time PCR Hamidkholgh KH1, Hamidkholgh GH2 1

Department of Science and Research branch, Islamic Azad University

2

Private office

Introduction and objectives: Cervical cancer is the second most common cancer of the women worldwide and the role of human papilloma virus in the etiology has been fully proven. This virus is transmitted sexually and multiple sexual partners, immune efficiency, contraceptive pills and smoking are other predisposing factors. The goal of this study is to determine the contamination rate of human papillomavirus types 16 and 18 in the cervical secretions by Real-Time PCR. Materials and Methods: Totally,196 samples of Pap smear were collected randomly among of patients referred to the different laboratory centers in the Rasht city in a year .After extracting DNA from all samples, presence of virus was determined by Real-Time Taqman PCR assay based on the E7 and E1 genes. Results: Out of196 samples of Pap smear, 19/4% was infected with the HPV16&18. Rate of HPV18and HPV16 were 8/2%and13/3%, respectively. Conclusion: Determination of prevalence of high-risk HPV and use of sensitive molecular methods for detection could be helpful for screening, management and vaccination planning against common HPV genotypes. Keywords: HPV 16, HPV 18, Pap smear

749

P-472 Assessment of minimum vaccination coverage of Measles using the time series SIR epidemic model in Iran Ahmadi A 1, Mosavi Nasab S.D2, Babanejad M3, 4, Azizian R4.5, Hamidi M6 1

Department of Virology, Jahrom University of Medical Sciences

2

Department of Virology, Tarbiat Modarres University

3

Department of Epidemiology, Faculty of Public Health, Ilam University of Medical Sciences

4

Student Research Committee, Ilam University of Medical Sciences

5

Research Center of Clinical Microbiology, Ilam University of Medical Sciences

6

Tabriz University of Medical Sciences, Pharmaceutical Biotechnology

Introduction and Objectives: Measles is one of the most communicable diseases in infants. In recent years, computational modeling including Susceptible – Infective – Resistance (SIR) has an important role in epidemiological studies. This model is based on mathematical answers to the questions related to existence or absence of epidemics. The present study aimed to determine the existence of infections resulted from Measles and to assess its minimum vaccination coverage using the SIR epidemic model in Iran from 1977-2010. Materials and Methods: Data were recruited from Center of Diseases Control related to health ministry of Iran and were analyzed using the SIR model, R0 and P parameters of infection during four years. Results: Based on R0 results, there is an epidemic condition in Measles in Iran and the vaccination coverage of measles is going to a bad situation year by year. P parameter was estimated for 2008 and 2011 years at 9.671543 and 10.08324, respectively. Conclusions: Our findings suggest that the policy of Health Ministry should be improved about Measles vaccination.

Keywords: SIR model, Measles, Iran.

750

P-473 Comparison of molecular and serological methods for the detection of Hepatitis C virus among transplant patients in Shiraz, southern Iran

FeyznezhadR1, BehzadiMA2, 3, YaghobiR4, ZiyaeyanM2 1

Department of Microbiology, Science and Research Branch, Islamic Azad University, Fars, Iran. 2 Professor Alborzi Clinical Microbiology Research Center, Shiraz University of Medical Sciences, Namazi Hospital, Shiraz, Iran. 3 Student Research Committee, Shiraz University of Medical Sciences, Shiraz, Iran. 4 Shiraz transplant research center, Shiraz University of Medical Sciences, Shiraz, Iran Introduction and Objectives: Hepatitis C virus infection may lead to several complications among patients, especially transplant ones. Thus, screening of the disease and quantification of HCV load is important for appropriate pre and post transplantation antiviral therapy and future HCV treatment strategies development. This study was conducted to compare molecular and serological methods for detection of Hepatitis C virus and to determine the HCV RNA level among transplant patients referring to Namazi hospital, between Sep 2011 and Jan 2013. Materials and Methods: A total of 101 transplant recipients who were suspected to HCV infection referred to Prof. Alborzi clinical microbiology research center for HCV diagnosis, in this period. From each individual,5 ml peripheral blood sample was collected and the plasma was separated.Anti-HCV antibodies detection was performed on the samples using a commercial chromatographic immunoassay kit. Moreover, viral RNA was extracted from all the samples and TaqMan one-step RT-PCR assay was done for detection and quantification of HCV nucleic acid, applying a commercial kit. Finally, the results were statistically analyzed and compared between different sex, age (≤40 yrs and >40 yrs), and graft recipient groups. Results:Of the 101 individuals (59 (58.4%) men and 42 (41.6%) women), 44 (43.6%), 55 (54.5%), and 2 (2%) were the recipient candidates of liver, kidney and bone marrow, respectively. Patients’ ages ranged from 5 to 74 (mean ± standard deviation: 46.53 ± 13.73 years). From those, 47 (46.5%) were positive for anti-HCV antibodies and 34 (33.7%) for RNA with a significant difference (p < 0.05). Out of the seropositive patients, 15 patients were RNA negative. HCV RNA was detected in the absence of anti-HCV antibodies,in two kidney transplant patients with the regular hemodialysis history. RNA copy number ranged from 4.6×103 to 3.11×107 copies/ml; Median 2.92×106 copies/ml, with no statistical differences in all groups. Conclusion:Although the serological tests are valuable for HCV detection and screening among the population, some limitations still exist. Thus, to make an accurate HCV diagnosis and pursuing effective pre and post transplantation treatment, HCV RNA detection and quantification seems to be vital in this group.

751

Keyword: Hepatitis C virus, Molecular and serological methods, Transplant patients, Iran

752

P-474 Hepatitis C virus genotyping among liver, kidney and bone marrow transplant patients in Shiraz, southern Iran, using real-time PCR assay Feyznezhad R1, Behzadi M.A2, 3, Yaghobi R4, Ziyaeyan M2 1

Department of Microbiology, Science and Research Branch, Islamic Azad University, Fars, Iran 2 Professor Alborzi Clinical Microbiology Research Center, Shiraz University of Medical Sciences, Namazi Hospital, Shiraz, Iran 3 Student Research Committee, Shiraz University of Medical Sciences, Shiraz, Iran 4 Shiraz transplant research center, Shiraz University of Medical Sciences, Shiraz, Iran Introduction and Objectives: Hepatitis C virus (HCV) infection still exists as a health concern among the transplant patients. Due to the severity of the disease, different responses to treatment and side effects resulting from long therapeutic period, determination of genotypes and viral loads can help choose the best treatment protocols. This study aims to determine the HCV genotypes and its distribution patterns among liver, kidney, and bone marrow recipients from across Iran, referred toProfessor Alborzi Clinical Microbiology Research Center, Namazi Hospital, Fars province, between Sep 2011 and Jan 2013. Materials and Methods: Of 34 HCV positive transplant recipients, 5 ml plasma was collected from each individual and the viral RNA was extracted.To detect different HCV genotypes (1, 2, 3, and 4) commercial RT-PCR kit (Genome Diagnostics Pvt. Ltd., Hague, Netherland) was applied.The results were statistically analyzed between differentsex, age (≤40 yrs and >40 yrs), and graft recipient groups and the distribution map was designed. Results:The frequencies of the genotypes 1 (50%) and 3 (35.3%) were higher than those of the genotypes 2 (2.9%), 4 (2.9%), and undetermined one (8.8%). Genotype 1 was significantly more prevalent in liver transplant recipients, those older than 40 years, and male groups (p