Abstract The discovery of mutations in the neural calcium channel (CACNA1A) gene in familial hemiplegic migraine. (FHM), variant of migraine with aura, led to ...
Neurol Sci (2002) 23:1–5
© Springer-Verlag 2002
ORIGINAL
R. Brugnoni • M. Leone • A. Rigamonti • E. Moranduzzo • F. Cornelio • R. Mantegazza • G. Bussone
Is the CACNA1A gene involved in familial migraine with aura?
Received: 25 January 2002 / Accepted in revised form: 25 February 2002
Abstract The discovery of mutations in the neural calcium channel (CACNA1A) gene in familial hemiplegic migraine (FHM), variant of migraine with aura, led to the suggestion that this gene might be involved in familial migraine with aura (FMA). We investigated whether the mutations in FHM are present in FMA patients, analyzing genomic DNA by PCR, single stranded conformation polymorphism, sequencing and restriction enzyme. No mutations were found. A known polymorphism (5682–14C>T) was found in exon 36. These findings suggest that the mutations found in FHM and the other known mutations of the CACNA1A gene are not the genetic basis of FMA. Genetic alterations in FMA patients may be localized on chromosome 19 but not in the CACNA1A exons we investigated. Key words Migraine with aura • Familial hemiplegic migraine • CACNA1A gene • Mutation
R. Brugnoni • E. Moranduzzo • F. Cornelio • R. Mantegazza Department of Neuromuscular Diseases C. Besta National Neurological Institute Milan, Italy M. Leone • A. Rigamonti • G. Bussone () Headache Center C. Besta National Neurological Institute Via Celoria 11, I-20133 Milan, Italy
Introduction Relatives of patients with migraine with aura are at increased risk for the disease; this observation is strongly suggestive of a heritable component [1]. However, the genes responsible for migraine with aura are unknown. The discovery of mutations in the gene for the neural calcium channel α1A-subunit (CACNA1A) on chromosome 19p13 in subjects with familial hemiplegic migraine (FHM), currently considered to be a variant of migraine with aura, led to the suggestion that this gene might also be involved in migraine with aura [2, 3]. Several studies have investigated CACNA1A mutations in non-FHM migraine forms with conflicting results. In a Finnish linkage study [4] conducted on four migraine families (with or without aura or both), lod scores for markers of a 50-cM region flanking the FHM locus on chromosome 19 were negative. Another study investigated the transmission of marker D19S39, near the FHM locus, in 28 migraine families with and without aura [5]. Although the linkage was not significant, sibpair analysis showed that affected siblings shared the marker allele more frequently than chance; however this was mainly due to findings in one large family. In another study, positive lod scores, co-segregation and significant allele sharing for markers within or adjacent to the FHM19 locus were found in a large family with typical migraine (with and without aura) but not in the other three families examined [6]. A study of 14 Italian families with “typical migraine” did not find a significant linkage to chromosome 19 [7]. A recent study on 36 independent, multigenerational Dutch families using the microsatellite markers D19S391, D19S394 and D19S221, the intragenic marker D19S1150, the intragenic CAG repeat, and D19S226, found that the CACNA1A gene was linked to nonhemiplegic familial migraine, notably in migraine with aura [8]. Turning to genetic studies, exons 4, 17 and 36 – found mutated in FHM [9] – were studied in 12 familial cases of migraine with aura and 15 migrainous stroke patients [10]; the authors failed to find the three previously reported CACNA1A mutations in these exons. The entire 47 exons plus introns of
R. Brugnoni et al.: CACNA1A screening in migraine with aura
2
the CACNA1A gene were sequenced in nine probands from families with autosomal dominant transmission of migraine and episodic vertigo [11], selected because of clinical resemblance to FHM and episodic ataxia; no mutation was found. Thus, although no family with non-hemiplegic migraine has been reported to harbor CACNA1A mutations, a role of this gene in the more common migraine types, and in particular in migraine with aura, was found in 36 Dutch families by sib-pair analysis [8]. The aim of this study was to determine whether the mutations reported in the CACNA1A gene in hemiplegic migraine are present in families affected by migraine with aura.
Materials and methods Patients We studied 32 subjects with migraine with typical aura from 12 unrelated Italian families. Only families with at least one affected first-degree relative of the proband were included. Aura lasted less than 60 minutes (i.e. typical aura) and was characterized by visual, sensory and/or language disturbances followed by the headache phase. Diagnosis was according to the International Headache Society criteria [12]. A control group consisted of 40 unrelated healthy sex- and age-matched Italian volunteers.
Methods Our study focused on 22 of the 47 exons of the CACNA1A gene. Exons 4, 16, 17, 27, 32 and 36 were studied because missense mutations (R192Q, T666M, V714A, V1457L, L1682P and I1811L,
respectively) have been found in FHM families [2, 9] (Table 1). Exons 13, 25, 26, and 33 were studied as these have been found mutated in non-familial hemiplegic migraine [2, 9]. Exons 5 and 37 were also studied because the former has been found mutated in migraine-coma [13] and the latter in migraine-ataxia [14]. A mutation in exon 26 has also been found in a case of migraine-coma [15]. Exons 6, 22 and 29 were included as they have been reported mutated in episodic ataxia [2, 9, 16]. Two exons encoding the S4–S5–S6 pore region complex, namely exons 7 (I-S6) and 15 (IIS5–S6), were also included. In addition, exons 2 (I-S1), 11 (II-S1), 12 (II-S2–3), 23 (III-S2–S3), and 30 (IV-S1–2) were studied as the initial aim was to investigate the entire gene. Genomic DNA, extracted from peripheral blood lymphocytes by the phenol-chloroform method and ethanol/sodium acetate precipitation [17], was analyzed by polymerase chain reaction (PCR) using intron primer sequences specific for each of the 22 exons studied (exons 2, 4, 5, 6, 7, 11, 12, 13, 15, 16, 17, 22, 23, 25, 26, 27, 29, 30, 32, 33, 36, and 37) [18]. The 50 µl reaction mixtures contained 200 ng DNA, 5 µl PCR buffer (10 mM Tris-HCl (pH 8.8), 1.5 mM MgCl2, 50 mM KCl, 0.1% Triton X-100), 200 µM of each dNTP (Perkin Elmer, Norwalk, CT), 1 µM each primer, and 2 U DynaZyme DNA polymerase (Finnzymes, Oy, Finland). The first cycle was at 94° C for 4 min, followed by 30 cycles consisting of denaturation at 94° C for 30 s, annealing for 30 s (at optimized temperature for each primer set; Table 2) and extension at 72° C for 1 min. A 2400 Thermal Cycler (Perkin-Elmer) was used. The amplification products were analyzed on 2% agarose gel. Additional purification using QIAEX II gel extraction kit (QIAGEN, Germany), according to the manufacturer’s instructions was applied to the PCR products from exons 2, 7, 25, 30 and 36. To intensify the bands of exons 25 and 27, 5 µl PCR product was re-amplified using the same conditions as the first PCR reaction. The 22 exon-specific PCR products from each proband were subjected to single strand conformation polymorphism (SSCP) analysis. Each PCR product (2 µl) was mixed with 9 µl loading dye (10 mM NaOH, 95% formamide, 0.05% bromophenol blue and 0.05% xylene cyanol), denatured at 94° C for 2 min and loaded onto
Table 1 CACNA1A mutations in familial (FHM) and non-familial hemiplegic migraine (HM), migraine with coma and migraine with ataxia Disease
Location
Domain
Amino acid change
FHM HM Migraine-coma HM-PCA FHM-PCA FHM HM-PCA HM HM-PCA Migraine-coma FHM HM-PCA FHM-ataxia HM-PCA HM FHM-PCA Migraine-ataxia
Exon 4 Exon 4 Exon 5 Exon 13 Exon 16 Exon 17 Exon 17 Exon 25 Exon 26 Exon 26 Exon 27 Exon 32 Exon 32 Exon 32 Exon 33 Exon 36 Exon 37
I S4 I S4 I S5 II S4 II P-S5/S6 II S6 II S6 III S4 III S5 III S5 III P-S5/S6 IVS6 IV S4 IV S4 IV S5 IV S6 Not reported
R192Q R195K S218L R583Q T666M V714A D715E K1335E Y1384C Y1385C V1457L R1667W L1682P W1683R V1695I I1811L Stop
PCA, permanent cerebellar ataxia
R. Brugnoni et al.: CACNA1A screening in migraine with aura a non-denaturing 0.5x MDE gel (J.T. Baker, Philipsburg, NJ), followed by electrophoresis in 0.6x TBE (53.4 mM Tris, 53.4 mM boric acid, pH 8.3, and 1.2 mM EDTA) running buffer at room temperature for 16–18 hours, depending on the length of the PCR product (Table 2). The SSCP bands were revealed by silver staining, according to standard protocol [19], and compared to those obtained from the 40 controls. This screening method has been used in previous studies and has revealed three new mutations and two known polymorphisms in the chloride channel gene (CLCN1) in patients with myotonia congenita [20]. An abnormal conformer of exon 36 was found, and this was sequenced using an automated DNA sequencer (SEQ4x4 Personal Sequencing System, Amersham Pharmacia Biotech). First the genomic DNA was amplified by PCR using the same primers used for the PCR-SSCP analysis and also using an internal reverse primer (5’-ACGCACGTACTCATCCAGGT-3’). The products were then labeled with the Thermo Sequenase Cy5.5 terminator cycle sequencing kit (Amersham Pharmacia Biotech), according to the manufacturer’s instructions. Both DNA strands were then sequenced and the sequences were compared with the exon 36 sequences in the GenBank database (accession number, Z80146). The polymorphism found by sequencing was confirmed by SmaI restriction enzyme analysis (Boehringer Mannheim, Mannheim, Germany). This polymorphism was a C to T substitution on one allele which abolished the SmaI restriction site present
3 on the wild-type exon. The PCR-amplified genomic DNA of exon 36 was purified on 2% agarose gel using the QIAEX II gel extraction kit. The material was then resuspended in an adequate volume of water and digested with SmaI. The restriction products were separated by electrophoresis on a 9% non-denaturing acrylamide gel and revealed by ethidium bromide [20].
Results The clinical characteristics of the 32 migraine patients from 12 different families and the 40 age- and sex-matched controls are given in Table 3. Computed tomography (CT) and magnetic resonance imaging (MRI) of the brain, and neurological examination were normal in all probands and affected relatives (data not shown). No mutation was found in any of the 22 exons of the CACNA1A gene investigated, either in migraine patients or healthy controls. However SSCP analysis revealed that exon 36 had abnormal mobility in 5 (16%) patients and in 14 (35%) healthy controls (data not shown). Direct sequencing of this abnormal conformer revealed a previously reported polymorphism [21] corresponding to a C to T transition in
Table 2 PCR primer sequences used to amplify the 22 exons of CACNA1A gene. Primer pair sequences are those used by Ophoff et al. [2] unless otherwise indicated Exon
Forward primer
Reverse primer
Tan (° C)
Product size (bp)
SSCP Hours Volts
2 4 5 6 7 11 12 13 15 16 17 22 23 25 26 27 29 30 32 33 36 37
CACCTCCAACACCCTTCTTT AAAACCCACCCTCTGTTCTC CTTGGTGGCGGGGTTT TCCCTTCCCTTTTGTAGATG GACAGAGCCACAAGAGAACC ATTTCTTCTGAAGGAACAGC CAAGCCTAACCTCCTCTCTG ATTTGGAGGGAGGAGTTTGG CTTGGAGATGAGATACTGAGC TCCACAGCTGCATCTCCAAG CAGTGGTTGCTTTTCCTGAC AGCCTGTGGTCTGAGTGGAC ATCCACTGCTCTCTTGCTTT CTACCCAACCTGACCTCTGC CTCATCCTCTCTGTCAACTC CTGCTTCCCAAGCAGTCTAG CTCTGCCGCTCTCACCACTG ATGAAGCTGACCTCCCCACTa TCTGTGAGTGGTGACAGCTC TGGAAGGACTCTGGCACGTG TTCATTCCCTCGGTCTCTGC TGTGAACCCATTGCCTGCA
TCTGTGCCCTGCTCCACTC TTGTCAGGGTCGGAAACTCA CTGCCTAATCCTCCCAAGAG GTGGGGCTGTGTTGTCCTT AGCAAAGAGGAGTGAGTGGG GGAGGGATCAGGGAGTTGGC TCATTCCAGGCAAGAGCTG TCACTTTCCCAACTTTCTGG CAGGCACTTTCATCTGTGAC ACCCTCCCTTGAGCCCCT TTGCCAGAGAAACATTCTCC TAGGAAGGGGTGTGCTCTGTG GTGTGTTCTCACTTATAATCTGC ACATGATAACCCTGACAGTC TGGTTCCAATGGGAATGTGC TCCTGGATAGATTTCCAGTC TTTATCAGGGTAGAGGCAGG TAGCTGTAGCCCCAAGGT a GTCACCTGTCTTCTCAGC GGAGGCTCTGGGAACCTTAG CTGACTGAACCTGTGAGAC TGAAGAACCCCAAGCCACAa
Tan, annealing temperature; SSCP, single strand conformation polymorphism analysis a New primer sequences
62 58 55 55 55 60 55 55 55 58 58 63 60 58 58 58 63 58 58 58 60 60
240 160 291 346 252 270 206 314 213 270 130 210 170 220 229 300 250 213 236 230 350 201
17 16 17 18 17 17 17 18 17 17 15 17 15 17 17 17 18 17 17 17 18 17
80 80 80 80 80 80 80 80 80 80 80 80 80 80 80 80 80 80 80 80 80 80
R. Brugnoni et al.: CACNA1A screening in migraine with aura
4 Table 3 Principal characteristics of patients and controls
Males, n (%) Mean age, years Mean age at onset, years Mean illness duration, years
Migraine with aura (n=32)
Healthy controls (n=40)
11 (34) 39.7 19.5 19.2
18 (45) 38.2 – –
the 5’ region flanking exon 36, 14 bp upstream of the ATG initiation codon (5682–14C>T). We confirmed this heterozygous polymorphism by restriction analysis using the SmaI restriction enzyme (not shown).
Discussion In this study we directly examined all known mutations of familial and non-familial hemiplegic migraine in families with migraine with aura. None of the CACNA1A gene mutations previously reported in familial and non-familial cases of hemiplegic migraine were found in the 32 migraine with aura sufferers from the 12 unrelated Italian families we studied. Our findings are in accordance with recent studies [22, 23]. We also studied several other exons of this gene and found a known heterozygous polymorphism 5682–14C>T [21] in both patients and controls. Lack of mutations in the 22 exons of the CACNA1A gene suggests that genetic alterations in migraine with aura are either distinct from those observed in FHM and episodic ataxia or that they may be localized in the other 25 exons of CACNA1A gene, which we did not investigate. Another possibility is that the SSCP technique is unable to detect these mutations and that a more sensitive approach should be used. Mutations may be present in the exons not investigated of the CACNA1A gene, but these mutations have never been reported in patients with hemiplegic migraine. In one study, no mutations were found in the 47 exons coding for the CACNA1A gene in nine probands from families with autosomal dominant migraine and episodic vertigo [11]. So far only two patients with non-hemiplegic forms of migraine have been reported to have a mutation in the CACNA1A gene; both of these were relatives of FHM patients and both had the same mutation as present in the FHM relatives [3]. Other studies have not produced convincing evidence of a link between CACNA1A gene mutations and migraine [4, 11]. Considering a recent linkage study which indicated an involvement of the chromosome 19 region encompassing the FHM gene in migraine with aura [8], our results suggest that mutations different from those known in the CACNA1A gene are likely to be associated with FMA. Further studies on the remaining 25 exons of the CACNA1A gene as well as in other non-coding regions are necessary. It is also possible
that genes flanking the CACNA1A gene are involved. Clearly, further studies on larger series of FMA patients and covering all 47 exons of the CACNA1A gene are necessary to definitively exclude or confirm whether familial migraine with aura (FMA) and FHM share common genetic defects.
Sommario Nell’emicrania emiplegica famigliare (FHM), considerata una variante dell’emicrania con aura, sono state scoperte mutazioni nel gene del canale neuronale del calcio (CACNA1A) localizzato sul cromosoma 19p13, portando a supporre che questo gene possa essere coinvolto nell’emicrania famigliare con aura (FMA). Recenti studi, infatti, hanno mostrato un linkage tra CACNA1A gene e FMA, sebbene non sia stata ancora localizzata la regione di interesse. Abbiamo cercato, quindi, se le mutazioni trovate nei pazienti FHM fossero presenti anche in 32 pazienti FMA, analizzando il DNA genomico mediante PCR, SSCP, sequenziamento e analisi di restrizione. I risultati hanno portato alla scoperta di un polimorfismo eterozigote (5682–14C>T) nell’introne 36, ma di nessuna mutazione. Questo ci ha portato a supporre che le mutazioni trovate nei casi di FHM e le altre mutazioni trovate sul gene CACNA1A non sono legate alla FMA, non escludendo che alterazioni genetiche nei pazienti FMA potrebbero essere localizzate sul cromosoma 19 negli esoni del gene CACNA1A che non abbiamo analizzato, o che alternativamente possano essere coinvolti altri geni fiancheggianti la regione. Acknowledgments We thank Don Ward for translating the manuscript.
References 1. Russell MB, Olesen JS (1995) Increased familial risk and evidence of genetic factor in migraine. BMJ 311:541–544 2. Ophoff RA, Terwindt GM, Vergouwe MN et al (1996) Familial hemiplegic migraine and episodic ataxia type-2 are caused by mutations in the Ca2+ channel gene CACNL1A1. Cell 87:543–552 3. Ferrari MD, Russell MB (2000) Genetics of migraine. In: Olesen J, Tfelt-Hansen P, Welch KMA (eds) The headaches, 2nd ed. Lippincott, Williams and Wilkins, Philadelphia, pp 241–254 4. Howatta I, Kallela M, Farrkila M et al (1994) Familial migraine: exclusion of the susceptibility gene from the reported locus of familial hemiplegic migraine on 19p. Genomics 23:707–709 5. May A, Ophoff RA, Terwindt GM et al (1995) Familial hemiplegic migraine locus on 19p13 is involved in the common forms of migraine with and without aura. Hum Genet 96:604–608 6. Nyholt DR, Lea RA, Goadsby PJ et al (1998) Familial typical migraine. Linkage to chromosome 19p13 and evidence for genetic heterogeneity. Neurology 50:1428–1432
R. Brugnoni et al.: CACNA1A screening in migraine with aura 7. Monari L, Mochi M, Valentino ML et al (1997) Searching for migraine genes: exclusion of 290 cM out of the whole human genome. Ital J Neurol Sci 1(8):277–282 8. Terwindt GM, Ophoff RA, van Eijk R et al (2001) Involvement of the CACNA1A gene containing region on 19p13 in migraine with and without aura. Neurology 56(8):1028–1032 9. Montagna P (2000) Molecular genetics migraine headaches: a review. Cephalalgia 20:3–14 10. Cevoli S, Valentino Ml, Mochi M et al (1997) Molecular analysis on migraine patients: exclusion of mutations in CACNL1A4 gene. Ital J Neurol Sci 4[Suppl]:59 11. Kim JS, Yue Q, Jen JC et al (1998) Familial migraine with vertigo: no mutations found in CACNA1A. Am J Med Genet 79:148–151 12. – (1988) Classification and diagnostic criteria for headache disorders, cranial neuralgias, and facial pain. Headache Classification Committee of the International Headache Society. Cephalalgia 8[Suppl 7]:1–90 13. Kors EE, Vermeulen FLMG, Vergouwe MN et al (1999) Mutation in the calcium channel α1A subunit gene (CACNA1A) associated with migraine coma. Cephalalgia 19(4):304 14. Terwindt GM, Vermeulen FLMG, Kors EE et al (1999) Ca2+ channel α1A subunit gene (CACNA1A) mutation analysis in migraine associated disorders. Cephalalgia 19(4):304 15. Vahedi K, Denier C, Ducros A et al (2000) CACNA1A gene de novo mutation causing hemiplegic migraine, coma, and cerebellar atrophy. Neurology 55:1040–1042
5 16. Yue Q, Jen JC, Nelson SF et al (1997) Progressive ataxia due to a missense mutation in a calcium-channel gene. Am J Hum Genet 61:1078–1087 17. Madisen L, Hoar DI, Holroyd CD et al (1987) DNA banking: the effects of storage of blood and isolated DNA on the integrity of DNA. Am J Med Genet 27:379–390 18. Ophoff RA, Terwindt GM, Ferrari MD et al (1998) Genetics and pathology of voltage-gated Ca2+ channels. Histol Histopathol 13:827–836 19. Santos FR, Pena SDJ, Epplen JT (1993) Genetic and population study of a Y-linked tetranucleotide repeat DNA polymorphism with a simple non-isotopic technique. Hum Genet 90:655–656 20. Brugnoni R, Galantini S, Confalonieri P, Balestrino MR, Cornelio F, Mantegazza R (1999) Identification of three novel mutations in the major human skeletal muscle cloride channel gene (CLCN1), causing myotonia congenita. Hum Mutat 14(5):447 21. Haan J, Kors EE, Terwindt GM et al (2000) Alternating hemiplegia of childhood: no mutations in the familial hemiplegic migraine CACNA1A gene. Cephalalgia 20:696–700 22. Lea RA, Curtain RP, Hutchins C, Brimage PJ, Griffiths LR (2001) Investigation of the CACNA1A gene as a candidate for typical migraine susceptibility. Am J Med Genet 105(8):702–712 23. Jones KW, Ehm MG, Pericak-Vance MA, Haines JL, Boyd PR, Peroutka SJ (2001) Migraine with aura suseptibility locus on chromosome 19p13 is distinct from the familial hemiplegic migraine. locus. Genomics 78(3):150–154
