Department of Immunology, Research Institute of Scripps Clinic, La Jolla, California. (Received September ..... and technical support. ... Press, Orlando, FL.
Eur. J. Biochem. 173,45-51 (1988) 0FEBS 1988
Isolation and characterization of a cDNA clone corresponding to bovine cellular retinoic-acid-binding protein and chromosomal localization of the corresponding human gene Magnus H. L. NILSSON‘, Nigel K. SPURR’, Pushpa SAKSENA3, Christer BUSCH’, Hans NORDLINDER’, Per A. PETERSON4, Lars RASK’ and Johan SUNDELIN4 Department of Cell Research, Uppsala University and Swedish University of Agricultural Sciences, Uppsala Imperial Cancer Research Fund, Claire Hall Laboratories, Potters Bar Department of Pathology, Uppsala University, Sjukhuset Department of Immunology, Research Institute of Scripps Clinic, La Jolla, California (Received September 7/November 27, 1987) - EJB 87 1018
A bovine adrenal cDNA library was constructed and a clone corresponding to cellular retinoic-acid-binding protein (CRABP) mRNA was isolated and sequenced. The insert of the clone corresponds to 75 bp of the 5‘ untranslated portion, the whole translated and the complete 3’ untranslated portion of the bovine CRABP mRNA. A genomic Southern blot, probed with CRABP cDNA, indicated that only one copy of the gene is present in the human genome. Hybridizing bands in restricted chicken and fish DNA were also observed. Using the CRABP cDNA as probe we have located the human CRABP gene to chromosome 3 in hybridizations to mouse-human, hamster-human and rat-human cell hybrids. I n situ hybridizations on rat testis cells probed with CRABP and cellular retinol-binding protein antisense mRNA indicate that both proteins are expressed in tubuli cells. The molecular function of vitamin A outside the visual process is unknown. Vitamin A deficiency has been carefully studied [l] and is known to result in retarded growth, keratinization of epithelia, sterility and blindness. All symptoms can be reversed by addition of retinol to the food. Retinoic acid, a metabolite of retinol, can also cure all the general symptoms but can not substitute for retinol in the visual process and it is not able to reverse the degeneration of the germinal epithelium cells in the testis. The overall ability of retinoic acid to substitute for retinol together with the finding that it can differentiate tumor-cell lines, e.g. murine F9 teratocarcinoma cells [2], might indicate that in most tissues retinoic acid is the active form of the vitamin. Vitamin A and its derivatives are hydrophobic and must therefore be transported by a vehicle in an aqueous milieu. Indeed, from the storage site in the liver to the target cells, vitamin A is carried in plasma by a specific retinol-binding protein [3]. Outside the eye, three specific intracellular binding proteins for vitamin A have been found. One, the CRBPII [4] (cellular retinol-binding protein II), seems to be selectively expressed in the intestine and fetal liver, at least in rat. Several species have been investigated regarding the tissue localization and distribution [5 -91 of the other two more generally spread vitamin-A-binding proteins, CRBP (cellular retinol-binding protein) [lo] and CRABP (cellular retinoic-acid-binding protein) [I I]. Correspondence to M. H. L. Nilsson, Institutionen for Cellforskning, Uppsala Biomedicinska Centrum, Sveriges Lantbruksuniversitet, Box 596, S-75124 Uppsala, Sweden Abbreviations. NaCl/Cit buffer, 0.1 5 M NaCI, 0.01 5 M sodium citrate buffcr, pH 7.0; P,/NaCI 0.15 M NaCI, 0.02 M sodium phosphate buffer, pH 7.3; EDTA/Tris/acetate buffer, 0.002 M EDTA, 0.04 M Tris/acetate buffer, pH 8.0; CRBP, cellular retinol-binding protein; CRABP, cellular retinoic-acid-binding protein.
However, data from different laboratories have not been fully consistent. This may be due to the fact that the three intracellular vitamin- A-binding proteins belong to a family of small (14-16 kDa) lipid-binding proteins [11, 121. So far, eight members of this protein family have been identified and they display amino acid sequence identities ranging from approximately 25% to 75% [4, 11 -131. It is reasonable to assume that immunological reagents against one member might cross-react with other members of this family, known or unknown. One approach to circumvent this problem is to use in situ hybridization techniques. For this and other reasons we have cloned and sequenced a cDNA corresponding to bovine CRABP mRNA. MATERIALS AND METHODS Construction of’the cDNA library
Cellular RNA was extracted from bovine adrenal glands with 6 M urea, 3 M LiCL [14]. Poly(A)-richmRNA was selected on oligo(dT)-cellulose [15]. cDNA synthesis and cloning in lgtl 1 (Promega Biotec, WI) [I61 were carried out according to published procedures [17, 181. Packaging extracts were purchased from Stratagen Cloning Systems (CA). The library, approximately 106 independent clones, was screened [19] with a 90-bp-long probe corresponding to the preferred codons of the carboxy-terminal part of the bovine CRABP protein sequence [ll]. The probe was synthesized from two complementary, partially overlapping oligonucleotides of 51 and 53 bases respectively. The two oligonucleotides were annealed and labeled with [ K - ~ ~ P ] ~ C and T P[ K - ~ ~ P I ~ Ausing T P the Klenow fragment of polymerase I to a specific activity of 10’ dpm/pg. Positive clones were subcloned into the plasmid pBS(M13 ’) (Stratagen Cloning Systems, CA).
46
Nucleotide sequence determination Sequence analysis was performed using the method of Maxam and Gilbert [20].
L
"
0 4
5'
0
2I
I
100
300
2 I
700
3'
Northern blot analysis Poly(A)-rich RNA was separated on a 1.2% agarose gel containing formaldehyde, and transferred onto nylon filters [15]. The filters were hybridized to bovine CRABP and human CRBP probes, respectively, labeled by the random priming procedure [21] to a specific activity of 5 x lo8 dpm/yg, for 15 h at 65°C in 50 mM Pipes, 100 mM NaCl, 50 mM sodium phosphate, 1 mM EDTA (pH 6.8) containing 5% SDS. The filters were washed in 1 x NaCl/Cit buffer, 5% SDS at 65°C for 3 x 15 min and then exposed to Kodak XAR film with Dupont intensifying screens for 3 - 15 h.
Fig. 1. Restriction map of' a cDNA clone corresponding to a cellular retinoic-acid-binding protein mRNA. A solid bar indicates the coding part of the insert while the open bar represents the 5' untranslated region and the slashed bar the 3' untranslated region. The arrows below the bars show the sequencing strategy
NaCl buffer (0.15 M NaCI, 0.02 M sodium phosphate pH 7.3). They were then acetylated and treated with 0.1 M Tris/HCl, pH 7.0, 0.1 M glycine with intermittent washes in 2 x NaCl/Cit buffer (0.15 M NaC1, 0.015 M sodium citrate, Southern blot analysis pH 7.0). After a 5-min wash in 40% formamide, 2 x NaCI/ DNA was isolated from whole-blood samples of cattle, Cit buffer, 10 y1 probe solution was applied containing 40% human, chicken, Xenopus laevis (frog) and rainbow trout. The formamide, 10% dextran sulfate, 10 mM dithiothreitol, 20 yg methods used in preparation of the DNA have been described nuclease-free bovine serum albumin, 10 pg sheared herring elsewhere [22]. The Southern blot was performed according sperm DNA, 10 pg E. coli tRNA, 2 x NaCl/Cit buffer and to standard procedures [23] onto Pall Biodyne hybridization probe (1.3 x 1O6 cpm) to each section. The slides were incubatmembrane. As molecular-size marker, BstEII-digested il ed at 50°C in a humidified chamber for 3 h. The slides were phage DNA was used. The membrane was prehybridized at then washed repeatedly in 2 x NaCl/Cit buffer, 40% 42°C for 6 h in 10 ml 30% deionized formamide, 1 M NaC1, formamide and then in 2 x NaCl/Cit buffer. This protocol 50 mM sodium phosphate, pH 6.5, 5 x Denhardt's solution, [27] was used for all in situ hybridization experiments. The 1% SDS, 10% dextran sulfate, 200 yg/ml denatured salmon unhybridized RNA was digested with RNase. After further sperm DNA, prior to the addition of the BglI - NarI fragment rinses in 40% formamide, 2 x NaCl/Cit buffer and in 2 x of the CRABP cDNA (15 x lo6 cpm), labeled by random NaCl/Cit buffer, the slides were dehydrated, air-dried and priming [21]. The hybridization was performed for 15 h under autoradiographed. The slides were then treated with absolute the same conditions as the prehybridization. The filter was alcohol for 2 h and after that stained [28] with cresyl echt washed in 2 x NaCl/Cit buffer, 0.2% SDS for 2 x 5 min at violet solution for 1 h. They were differentiated rapidly in room temperature and in 1 x NaCl/Cit buffer, 0.5% SDS at 95% alcohol, dehydrated in absolute alcohol and cleared in 58 "C for 2 x 25 min and then exposed to Kodak XAR-5 film xylene and mounted with Permont (Fisher Scientific, NJ). with Dupont intensifying screen at -70°C for 4 days. To be able to produce labeled antisense CRBP and CRABP mRNA copies without the poly(A) tail, fragments were excised corresponding to bp 1 - 580 from the human Chromosomal localization experiments CRBP cDNA clone [29] and corresponding to bp 1 -452 from All cells were maintained as outlined earlier [24]. Isolation the bovine CRABP cDNA clone. They were then separately of genomic DNA from mouse-human, hamster-human and cloned into the pGEM3 (Promega Biotech) transcription rat-human cell hybrids and restriction digestion of this DNA vector thus creating pGCRBP and pGCRABP. After linearwith Hind111 and BamHI were carried out according to stan- ization, pGCRBP was transcribed in vitro [27] using [ E dard procedures [15]. The digested DNA was separated in an 35S]UTP[a-S]in both directions producing both sense and 0.8% agarose gel in EDTA/Tris/acetate buffer (0.002 M antisense copies of CRBP mRNA. pGCRABP was linearized EDTA, 0.04 M Tris/acetate, pH 8.0) for 36 h at room tem- and transcribed in vitro in the antisense direction producing perature. The DNA was transferred to Gelman biotrace RP antisense CRABP mRNA. nylon membranes using an alkali transfer method [25]. The hybridization procedure was carried out as described earlier [26] at 65°C for 16-24 h with the same probe as described RESULTS AND DISCUSSION above. After the hybridization the filters were washed in 2 x Cloning of c D N A corresponding NaCl/Cit buffer for 30 min at 65°C and in 0.2 x NaCl/Cit to cellular retinoic-acid-binding protein, CRABP buffer for 30 min at 65°C. The further handling of the filters A bovine adrenal cDNA library was constructed in the has been described earlier [26]. Finally the filters were exposed i g t l l phage vector and screened using a 90-bp probe conto Kodak XAR-5 film at -70°C for 4 days. structed from two overlapping oligonucleotides. This probe corresponds to the carboxyterminal part of the bovine In situ hybridization experiments CRABP. 40000 clones were screened and four were found to Testis from an adult rat was fixed in 4% paraformaldehyde be positive. After rescreening, the clone having the longest for 2 h and embedded in paraffin. The sections were cut at insert was subcloned into the pBS creating pCRABPl and about 5 pm thickness and were mounted on poly-L-lysine- sequenced. Fig. 1 shows the restriction map of the 760-bp treated slides. Before hybridization the sections were de- insert of pCRABPl together with an outline of the sequencing paraffinized, treated with proteinase K and washed with Pi/ strategy. Sequence analysis (Fig. 2) revealed an approximately
41 -1 1 M e t P r o A r n P h e A l a G l y T h r T r p L y s Met G G G G C T T G 6 A G T G T G C C C G C T G T G C C 6 C A G C T G T C C G T G C C T G C C G C C G C C T T C C C G C C G C C G C C A C C G C T 6 C C A C C A T G CCC A A C T T C GCT GGC A C C TGG AAG A T G
10
20
30
A r g Scr S c r G l u A s n P h e A s p G l u Leu Leu L y s A l a Leu G l y V a l A s n A l a Met Leu A r q L y s V a l A l a V a l A l a A l a A l a SPr L y s P r o CGC AGC AGC GAG A A T T T C GAC GAG CTG C T C A A G GCG CTG GGT G T G AAC GCC A T G CTG AGG A A A GTG GCC GTG GCG GCT GCG T C C A A G CCG
LO
50
9
107
39 197
60
H i s V a l G l u Ilc A r g G l n A s p G l y A s p G l n P h e T y r I l e L y s T h r Ser T h r T h r V a l A r q T h r T h r G I " 1 1 0 A s n P h e L y s V a l G l y G l u CAC GTG GAG A T C CGC CAG GAC GGG GAC CAG T T C T A C A T C A A G ACG T C C ACC ACG GTG CGC ACG ACC GAG A T C A A C T T C AAG GTC GGA GAA
287
70 80 90 G 1 v P h e G l u G l u G l u T h r V a l A s p G l y A r g L y s C y s A r g Ser Leu P r o T h r T r p G l u A s " G l u AE.~ L y s I l e H i s C y s T h r G l n T h r Leu GGC T T T GAG GAG GAG A C C GTG GAC GGA CGC AAG T G C AGG AGC T T A CCC A C T TGG GAG A A T GAG A A C A A G A T C C A C TGC A C A C A A A C T C T T
99 377
b9
100
110 120 Leu G l u G l y A s p G l y P r o L y s T h r T y r T r p T h r A r g G l u L e u A l a A s n A s p G l u Leu I l e Leu T h r P h e G l y A l a A s p A s p V a l V a l C y s CTG GAG GGG G A C GGC CCC A A A ACC T A C TGG ACC CGC GAG CTG GCC A A C GAC G A A CTC A T C CTG ACG T T C GGC GCC GAT GAC GTG G T C TGC
130 136 T h r A r g Ile T y r V a l A r g G l u *i* ACG AGG A T 1 T A T G T T CGG GAA T G A A G G C G G C C A G C T T G C T C C A G C T T T G G G G G T G G G A T G C A T G T T C C C C C A A G G A A T G T C A T A G C T C T G A G C C G C C A G T G G A C C T C C T C T T
129 467
136 579
CCCCGGTATTAACGTTAGGTGATCCCGATGTCCCCCCAGT~ATGCTGTAGTGTTTTCCCCAAGGCTTTGTGCCTCTGTCTCCCTGGCGCTCCATAGTCTGGCATCTGTATGGTTTCATCA 699
760
Fig. 2. Nucleotide sequence of the CRABP cDNA clone. The lower line shows the nucleotide sequence of the clone; the upper line shows the deduced amino acid sequence. A putative poly(A) addition sequence is underlined
75 bp long part of the 5' untranslated region followed by an initiation codon and an open reading frame encoding 136 amino acid residues. The deduced amino acid sequence was identical to that determined by protein sequencing of bovine CRABP [ll]. A 3' untranslated region of 234 bp was followed by a poly(A) tail. 17 bp upstream of the poly(A) tail a potential poly(A) addition signal, ATTAAA, was situated. The perfect identity of the deduced amino acid sequence with the known CRABP sequence establishes undoubtedly that the isolated cDNA clone corresponds to a CRABP mRNA.
Southern gmomic blots It is known that the aminoterminal 32 amino acid residues of bovine and rat CRABP [30] are identical. This suggests that CRABP has been well conserved during evolution. To further substantiate this observation we carried out Southern genomic blots with DNA from cattle, human, chicken, X . luevis (frog) and rainbow trout (fish). The separated EcoRIdigested DNA samples were hybridized with a 270-bp BglI NarI fragment (corresponding to amino acid residues 33 123) of the bovine CRABP cDNA. Consequently this part of the cDNA does not contain any 5' or 3' untranslated regions that may cause non-specific cross-hybridization. Neither does it contain any of the DNA sequence corresponding to the aminoterminal part of CRABP that has been shown [31] to represent the most highly conserved part among the members of the lipid-binding protein family. Distinct hybridizing patterns were observed for all species except for &nopus, which hybridizing band (Fig' 3)' The strong O n l y showed a hybridization pattern for chicken and the clear single band for the trout DNA sample suggest that these bands indeed correspond to CRABP genes in these species and that the CRABP gene is well conserved during evolution. The conservation of large parts of the encoding sequence suggests that CRABP may be involved in several molecular interactions such that only marginal changes in the amino acid sequence of CRABP can be tolerated. Among such interactions the specific binding of retinoic acid is obviously constraining the accumulation of replacement substitutions. Another putative
Fig. 3. Genomic &Xfthernblot of CRABP. The probe was a fragment of bovine CRABP cDNA clone (corresponding to amino acid residues 33- 123). Hybridization and washing conditions are described in Materials and Methods. Samples human, bovine, chicken, frog and fish DNA were digested with EcoRI. Lane 1, bovine; lane 2, human; lane 3, chicken; lane 4, x.Iaevis (frog); lane 5 rainbow trout (fish)
interaction might involve the dehydrogenase enzyme complex that oxidizes retinol to retinoic acid. A third interaction, possibly involving CRABP, is with the target structure(s) to which CRABP is destined to deliver the vitamin.
48 Table 1. The somatic cell hybrids that were tested and the human chromosome content of each hybrid The results of the Southern hybridizations are indicated in the column with the superscript CRABP. +, appearance of a hybridizing band corresponding to the human gene; -, failure to detect any such band. HindIII/BamHl-digested genomic DNA from human cells and humanrodent somatic cell hybrids was Southern-blotted and hybridized with a Eg1I-NarI fragment of the CRABP cDNA as probe. Human DNA showed a 6.7-kb band. Hamster DNA showed two bands at 5.3 kb and 1.3 kb. Mouse DNA showed two bands at 4.2 kb and 3.0 kb, and rat DNA one band at 7.2 kb. All hybrids are mouse-human except: * = hamster-human, ** = rat-human hybrid. CRABP, hybrids that contained the human CRABP gene; tr, trace amounts; w, weak, small amounts Hybrids
Chromosome number 1 2 3 4 5
~~
~~
PLT1.S DT1.2.4 FST9/IO DUR4R3 Mog13/10 DIS20* SI F I5* * THYB1.3 PCTBA1.8 HORLI 289 CLONE21 E 1WlLA4 HORP9.5 MCP6 HORP27R HORL9D2R1 3W4CL5 FIR5 SIR74ii Butler ~~
~
a
~~~
CRABP
6 7 8 9 10 11 12 13 14 1.5 16 17 18 19 20 21 22 X ~
~~
~
+ - + - + - + + + - - + t - + - - + + - + + + - - + - - - - - - - + - - - + + - - + + - + - + + - + + t t - - + - + - + + - -
Ref.
note” [371
+-++ +-+--+--++++--++-++--
-
+ ~
~~~
noted
~
Gift from Dr D. Sheer, ICRF, London.
I, Gift from Dr S. Povery, Galton Laboratory, University College, London.
Gift from Dr C. Bostock, Edinburgh. Butler is human DNA extracted from human foreskin fibroblast used as positive control, gift from the Galton Laboratory, University College, London.
Fig. 4. Northern blot o f CRABP mRNA. 2 Pg each of poly(A)-rich RNA from bovine adrenal gland (lane I), rat liver (lane 2) and rat testis (lane 3) was size fractionated on a 1.2% formaldehyde/agarose gel and transferred to nylon filter. The migration distances of RNA molecular mass markcrs (in kb) are indicated. (a) The filter was hybridized to a 32P-labeledbovine CRABP probe. (b) The same filter was hybridized to a ’P-labeled human CRBP probe
The gene structures of four members of the lipid-binding protein family have been characterized, namely human CRABP [26], rat CRBPII [32], mouse adipose P2 protein [33] and the rat fatty acid-binding protein [12]. Amino acid alignments [12, 261 have shown that the intron-exon organization of these genes is preserved even between very divergent members of this protein family. This might indicate that the exons correspond to distinct structural units, as has been shown for serum retinol-binding protein [34]. One or more of the polypeptide segments encoded by the exons may accordingly have different functions. One way of investigating this could be to create hybrid proteins in which one or more exons have been deleted or exchanged. Such gene constructs can then be used in transfection experiments to see, for example, if the protein still can bind retinoic acid, Chromosoma[ [ocation
The human genes of CRBP [26, 32, 351 and CRBPII [32] have recently been assigned to chromosome 3. A third member
Fig. 5. In situ-hybridizations on preparations of rodent testis with CRABP and CRBPprobes. Preparations of an adult rat testis were cut lo a thickness of 5 pm and in situ hybridized with in vitro transcribed CRABP and CRBP antisense mRNAs and sense mRNA CRBP as probes as described in Materials and Methods. (A) A testis preparation hybridized with a CRABP probe. The small black dots indicate hybridized mRNA. (B) A testis preparation hybridized with a CRBP probe. The small black dots indicate hybridized mRNA. (C) As a control a testis preparation was hybridized with a sense-mRNA CRBP probe
49
A
c
Fig. 5A-C
50 of this protein family, human liver fatty-acid-binding protein, has been mapped to chromosome 2 [36]. To investigate where the gene encoding human CRABP is located, we performed Southern blot hybridizations on restricted genomic DNA from rat-human, mouse-human and hamster-human cell hybrids. The results (see Table 1) clearly show that the human CRABP gene is located on chromosome 3, which might indicate the existence of a cluster of the genes for the intracellular retinoid-binding proteins. This result strengthens the idea that the latter genes have evolved by duplication of an ancestral gene, and that such events occurred after the separation of the more distantly related liver FABP gene.
R N A hybridization experiments Immunohistochemical techniques have been used to localize CRABP at the cellular level in various rat tissues [7, 91. However, the results have not been fully consistent. Since immunohistochemistry is a non-competitive method, it is difficult to exclude cross-reactivities with other proteins, especially when polyclonal antisera are used to detect a protein which is a member of a protein family. In this respect the detection of mRNA through in situ hybridization offers an advantage. While only a single immunological determinant needs to be conserved between related proteins to obtain cross-reactivity at the antibody level, a stretch of nucleotide sequence in an mRNA needs to be complementary to a DNA or RNA probe to cause crosshybridization. In order to determine if heterologous probes, bovine CRABP and human CRBP [29], would detect the corresponding rat mRNAs we performed northern blots (Fig. 4). It is clear that the bovine CRABP probe detects a single mRNA species in rat testis, although the hybridizing band is approximately 200 nucleotides longer than the species in bovine adrenal gland. As expected from the very low level of CRABP present in rat liver [9], no CRABP mRNA was detected in this tissue. Rat testis was chosen for the in situ hybridizations for two major reasons. First, the degeneration of the germinal epithelium as a result of vitamin A deficiency cannot be reversed by retinoic acid, although CRABP seems to be present at relatively high concentrations in rat testis [9]. The localization of CRABP and CRBP might explain the lack of efficacy of retinoic acid. Second, immunohistochemical studies of the localization of CRBP and CRABP have not given unambiguous results. We used in vitro transcribed antisense human CRBP and bovine CRABP mRNAs as probes (procedure outlined in Materials and Methods). As a negative control probe, sense human CRBP mRNA was employed. The results (Fig. 5) show specific hybridizations to tubuli cells of both CRABP and CRBP antisense probes but not the CRBP sense probe. The particular susceptibility of testis to histotechnical manipulations (although rat testis was found less vulnerable than bovine testis) caused a somewhat blurred morphology. This made it impossible to determine the distributions of CRABP and CRBP mRNAs accurately among the various cell types in the testis. Accordingly a detailed investigation of the CRBP and CRABP expression in the various cell types in the testis has to be carried out on separated cells. By the cloning of human CRBP cDNA [29] and the bovine CRABP cDNA, faithful reagents are now available for detailed studies of the tissue distributions of the two ubiqui-
tous intracellular vitamin-A-binding proteins, CRBP and CRABP. We want to thank Dr Leif Andersson for valuable discussions and technical support.
REFERENCES 1. Moore, T. (1957) Vitamin A , pp. 295 - 339, Elsevier, Amsterdam. 2. Strickland, S. & Mahdavi, V. (1978) Cell 15, 393-403. 3. Goodman, D. S. (1984) in The retinoids (Sporn, M. B., Robert, A. B. & Goodman, D. S., eds) vol. 2, pp. 42-71, Academic Press, Orlando, FL. 4. Li, E., Demmer, L. A., Sweetser, D. A,, Ong, D. E. & Gordon, J. I. (1986) Proc. Nut1 Acad. Sci. U S A 8 3 , 5779-5783. 5. Goodman, D. S. (1984) in The retinoids (Sporn, M. B., Robert, A. B. & Goodman, D. S., eds) vol. 2, pp. 89 - 127, Academic Press, Orlando, FL. 6. Eriksson, U., Das, K., Busch, C., Nordlinder, H., Rask, L., Sundelin, J., Sallstrom, J. & Peterson, P. A. (1984) J . Bid. Chem. 259, 13464-13470. 7. Porter, S. B., Ong, D. E., Chytil, F. & Orgebin-Christ, M. C. (1985) J . Androl. 6, 197-212. 8. Blaner, W. S., Das, K., Mertz, J. R., Das, S. R. & Goodman, D. S. (1986) J. Nutr. 27, 1084-1088. 9. Eriksson, U., Hansson, E., Norlindcr, H., Busch, C., Sundelin, J . & Peterson, P. A. (1987) J. Cell Physiol. in press. 10. Sundelin, J., Anundi, H., Trlglrdh, L., Eriksson, U., Lind, P., Ronne, H., Peterson, P. A. & Rask, L. (1985) J . BioLChein. 260,6488-6493. 11. Sundelin, J., Das, S. R., Eriksson, U., Rask, L. & Peterson, P. A. (1985) J. Biol. Chem. 260, 6494 - 6499. 12. Sweetser, D. A,, Lowe, J. B. & Gordon, J. 1. (1 986) J . Biol. Chern. 261, 5553 - 5561. 13. Sacchettini, J. C., Said, B., Schultz, H. & Gordon, J . L. (1986) J . B i d . Chem. 261, 8218-8223. 14. Auffray, C. & Rougeon, F. (1980) Eur. J . Biochem. 107, 303314. 15. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) Molecular cloning, Cold Spring Harbor, Ncw York. 16. Young, R. A. & Davis, R. W. (1983) Proc. Nut1 Acad. Sci. USA 80, 1194-1198. 17. Watson, C. J. & Jackson, J. F. (1985) in DNA cloning (Glover, D. M., ed.) vol. 1 , pp. 79-87, IRL Press, Oxford. 18. Huynh, T. H., Young, R. A. & Davics, R. W. (1985) in DNA cloning (Glover, D. M., ed.) vol. 1 , pp. 49-78, IRL Press, Oxford. 19. Benton, W. D. & Davis, R. W. (1977) Science (Wash. DC) 196, 180- 182. 20. Maxam, A. M. &Gilbert, W. (1980) Method.? knzymol. 65,499560. 21. Feinberg, A. P. &Vogelstein, B. (1 984) Anal. Biochem. 137,266267. 22. Andersson, L., Bohme, J., Rask, L. & Peterson, P. A. (1986) Anim. Genet. 17, 95 - 112. 23. Southern, E. M. (1975) J . Mol. Bid. 98, 503-517. 24. Spurr, N. K., Feder, J., Bodmer, W. F., Goodfellow. P. N., Solomon, E. & Cavalli-Sforza, L. L. (1 986) Ann. Hum. Genet. 50, 145-152. 25. Reed, K. C. & Mann, D. A. (1985) Nucleic Acids Res. 13,72077227. 26. Nilsson, M. H. L., Spurr, N. K., Lundvall, J., Rask, L. &Peterson. P. A. (1988) Eur. J . Biochem. 173, 35-44. 27. Funa, K., Steinholtz, L., Nou, E. & Bcrgh, J. (1987) Am. J. Clin. Pathol. 88, 21 6 - 221. 28. Manual ojhistology. Staining methods u j the Armed Forces Institute of Pathology (1968) 3rd edn, McGraw Hill, Minneapolis. SS. 212-213. 29. Colantuoni, V., Cortese, R., Nilsson, M. H. L., Lundvall, J., Bivik, C. O., Eriksson, U., Peterson, P. A. &Sundelin, J . (1985) Biochem. Biophys. Res. Commun. 130,431 -439.
51 30. Eriksson, U., Sundelin, J., Rask, L. & Peterson, P. A. (1981) FEBS Lett. 135, 70-72. 31. Sundelin, J., Eriksson, U., Melhus, H., Nilsson, M., Lundvall, J., BQvik,C.-O., Hansson, E., Laurent, B. &Peterson, P. A. (1985) Chem. Phys. Lipids 38, 175- 185. 32. Demmer, L. A., Birkenmeier, E. H., Sweetser, D. A,, Levin, M. S., Zollman, S., Sparkes, R. S., Mohandas, T., Lusis, A. J. & Gordon, J. I. (1987) J. Biol. Chem. 262,2458-2467. 33. Hunt, C. R., Ro, J. H.-S., Dobson, D. E., Min, H. Y. & Spiegelrnan, B. M. (1986) Proc. Natl Acad. Sci. USA 83,37863790. 34. Laurent, B. C., Nilsson, M. H. L., BBvik, C.-O., Jones, T. A,, Sundelin, J. & Peterson, P. A. (1985) J . Biol. Chem. 260, 11476- 11480. 35. Colantuoni, V., Rocci, M., Roncuzzi, L. & Romeo, G. (1986) Cytogenet. Cell Genet. 43, 221 -222. 36. Chen, S. M., Van Tuinen, P., Ledbetter, D. H., Smith, L. C. & Chan, L. (1986) Somatic Cell Mol. Genet. 12, 303 - 307. 37. Swallow, D. M., Solomon, E. & Pajunen, L. (1977) Cytogenet. Cell Genet. 18, 136-148. 38. Hobart, M. J., Rabbitts, T. H., Goodfellow, P. N., Solomon, E., Chambers, S., Spurr, N. & Povey, S. (1981) Ann. Human Genet. 45, 331 -335.
39. Povey, S., Jeramiah, S. J., Barker, R. F., Hopkinson, D. A,, Robson, E. B., Cook, P. L. J., Solomon, E., Bobrow, M., Carritt, B. & Buckton, K. E. (1980) Ann. Human. Genet. 18, 241 -248. 40. Heisterkarnp, N., Groffen, J., Stephenson, J. R., Spurr, N. K., Goodfellow, P. N., Solomon, E., Carritt, B. & Bodmer, W. F. (1982) Nature (Lond.) 299, 747 - 749. 41. Edwards, Y. H., Parkar, M., Povey, S., West, L. F., Parrington, J. M. & Solomon, E. (1985) Ann. Hum. Genet. 49, 101- 109. 42. Bai, Y., Sheer, D., Hiorns, L., Knowles, R. W. & Tunnacliffe, A. (1982) Ann. Human Genet. 46, 337-347. 43. Croce, C. M. & Koprowski, H. (1984) J . Exp. Med. 140, 12211229. 44. Hope, R. M., Goodfellow, P. N., Solomon, E. & Bodmer, W. F. (1982) Cytogenet. Cellgenet. 33, 204-212. 45. van Heyningen, V., Bobrow, M. & Bodmer, W. F., Gardiner, S. E., Povey, S. & Hopkinson, D. A. (1975) Ann. Hum. Genet. 38, 295 - 303. 46. Goodfellow, P. N., Banting, G., Trowsdale, J., Chambers, S. & Solomon, E. (1982) Proc. Nutl Acad. Sci. USA 79,1190 - 1 194. 47. Hall, A., Marshall, C. H., Spurr, N. K . & Weiss, R. A. (1983) Nature (Lond.) 303, 396 - 400.
