Environ Sci Pollut Res DOI 10.1007/s11356-015-5944-y
RECENT SEDIMENTS: ENVIRONMENTAL CHEMISTRY, ECOTOXICOLOGY AND ENGINEERING
Isolation and characterization of a hydrocarbonoclastic bacterial enrichment from total petroleum hydrocarbon contaminated sediments: potential candidates for bioaugmentation in bio-based processes Simona Di Gregorio 1 & Giovanna Siracusa 1 & Simone Becarelli 1 & Lorenzo Mariotti 1 & Alessandro Gentini 2 & Roberto Lorenzi 1
Received: 30 July 2015 / Accepted: 7 December 2015 # Springer-Verlag Berlin Heidelberg 2016
Abstract Seven hydrocarbonoclastic new bacterial isolates were isolated from dredged sediments of a river estuary in Italy. The sediments were contaminated by shipyard activities since decades, mainly ascribable to the exploitation of diesel oil as the fuel for recreational and commercial navigation of watercrafts. The bacterial isolates were able to utilize diesel oil as sole carbon source. Their metabolic capacities were evaluated by GC-MS analysis, with reference to the depletion of both the normal and branched alkanes, the nC18 fatty acid methyl ester and the unresolved complex mixture of organic compounds. They were taxonomically identified as different species of Stenotrophomonas and Pseudomonas spp. by the combination of amplified ribosomal DNA restriction analysis (ARDRA) and repetitive sequence-based PCR (REP-PCR) analysis. The metabolic activities of interest were analyzed both in relation to the single bacterial strains and to the combination of the latter as a multibacterial species system. After 6 days of incubation in mineral medium with diesel oil as sole carbon source, the Stenotrophomonas sp. M1 strain depleted 43–46 % of Cn-alkane from C28 up to C30, 70 % of the nC18 fatty acid methyl ester and the 46 % of the unresolved complex mixture of organic compounds. On the other hand, the Pseudomonas sp. NM1 strain depleted the 76 % of the nC18 fatty acid methyl ester, the 50 % of the unresolved complex mixture of organic compounds. The bacterial multispecies Responsible editor: Robert Duran * Simona Di Gregorio
[email protected]
1
Department of Biology, University of Pisa, 56126 Pisa, Italy
2
Teseco Spa, Via Carlo Ludovico Ragghianti 12, 56121 Pisa, Italy
system was able to completely deplete Cn-alkane from C28 up to C30 and to deplete the 95 % of the unresolved complex mixture of organic compounds. The isolates, either as single strains and as a bacterial multispecies system, were proposed as candidates for bioaugmentation in bio-based processes for the decontamination of dredged sediments. Keywords Alkanes . Bacterial consortium . Diesel oil . Dredged sediment . nC18 fatty acid methyl ester . Unresolved complex mixture
Introduction River estuaries in urbanized area are most of the time navigable and sites for several industrial activities. Their navigability depends on the periodical dredging of sediments that actually are sinks for contaminants produced by surrounding industrial and urban settlements (Meybeck et al. 2007). Most of these sediments are principally contaminated by diesel oil, the main fuel for recreational and commercial navigation of small and medium watercrafts. Dredged sediments are usually disposed in dedicated area and the natural attenuation of the contamination is the more common strategy adopted to face their management. However, the long-term disposal strategy can be associated to significant risks for the community, because of possible contaminant leakages and the consequent deterioration of the surrounding environment. The acceleration of the decontamination and the fast and safe reallocation of decontaminated sediments are actually a priority for the protection of the environment. In this context, many different approaches were adopted (Di Gregorio et al. 2013, 2014; Li and Yu 2014). Results obtained showed that the target of the intervention consists in the optimization of the environmental
Environ Sci Pollut Res
conditions to favor the metabolic activity of the autochthonous bacterial community able to transform the contaminants. Among the approaches for accelerating the depletion of contaminants, the bioaugmentation of specific bacterial strains is considered a consistent strategy (Nikolopoulou et al. 2013). In the case of contamination by organic compounds, the main physiological trait that the bioaugmented strain is supposed to have is the capacity to transform the contaminants. Ideally, the strain should be able to mineralize the organic contamination. Most of the time, the selected strains are able only to partially oxidize the contaminants. However, even a partial oxidation decreases the contaminant recalcitrance to biodegradation and favors their depletion by co-metabolic processes. Moreover, the bioaugmented strains must be adapted to the stress condition they encounter in the contaminated matrices, and they must be able to successfully compete with the autochthonous microbial community for nutrients. Both the capacity to transform contaminants, being adapted to stress condition, and the capacity to compete for nutrients are metabolic traits that can actually be recovered mostly among the strains already adapted to the contaminated environment, as the autochthonous candidates. In this context, the aim of the present study was the isolation of bacterial candidates colonizing the contaminated sediments, capable to utilize diesel oil as a sole carbon source to be eventually exploited for bio-based processes dedicated to the decontamination of these latter. The bacterial candidates were isolated from the sediments as a bacterial enrichment composed by diverse species, and they were analyzed for their capacity to use diesel oil as a sole carbon source. To envisage the application of the bacterial isolates in bioaugmentation approaches, their catabolic capacities were analyzed with respect to the single bacterial strains and to the bacterial enrichment as a multispecies system. Their catabolic capacities were analyzed with reference to both the diesel oil saturated fraction (normal and branched alkanes), a fatty acid methyl ester, and the unsaturated fraction, the unresolved complex mixture (UCM). The UCM is actually the chemical fraction responsible for the toxicity of the contamination by crude oil and total petroleum hydrocarbon (TPH) (Scarlett et al. 2007; Thomas et al. 1995). The fraction includes thousands of compounds, such as alkenes, alkynes, cycloalkanes, monoaromatics, polycyclic aromatic hydrocarbons (PAHs), steranes, and also polychlorinated biphenyls
Table 1 Primers used for the genotyping of the bacterial isolates
(PCBs) (Booth et al. 2007, 2008). Usually, these compounds cannot be successfully identified by target analysis (Samanipoura et al. 2015) and the recalcitrance to the biodegradation of the UCM fraction is not precisely defined because of the undetermined chemical structure of the component elements. However, the depletion of the UCM fraction is mandatory to accelerate the processes of both decontamination and detoxification of environmental matrices contaminated by crude oil. In this context, the selection of bacterial candidates for bioaugmentation was performed envisaging the capacity of the bacterial isolates to transform both the saturated and unsaturated fraction of environmental contaminations by TPH.
Material and methods Sediment, diesel oil, and chemicals The contaminated sediments were sampled from the Navicelli channel, Pisa, Italy (43°41′55.90″N; 10°22′50.80″E). The diesel oil was purchased from a local service station. All other chemicals used in this study were of analytical grade. Isolation and identification of the bacterial strains Bacterial strains able to use diesel oil as sole carbon sources were isolated from 1 g of homogenized dredged sediment in 100 mL of basal salt medium (BSM). BSM contains per liter Na2HPO4 2.2 g, KH2PO4 0.8 g, and NH4NO3 3.0 g, and it was supplemented with 1 % v/v of diesel oil as the sole carbon source. The flasks were incubated for 15 days at 250 rpm on rotary shaker at 28 ± 1 °C in the dark. An aliquot was transferred to fresh BSM. After five passages of 5 days of subculturing, each bacterial candidate was isolated on Agar LB plates. A total of nine different morphotypes at visual inspection were identified. The different morphotypes were clustered in different operational taxonomic units (OTUs) by amplified ribosomal DNA restriction analysis (ARDRA) (Weisburg et al. 1991) and repetitive sequence-based PCR (REP-PCR) (Dombek et al. 2000, Versalovic et al. 1991). The primers used for the genotyping of the isolates are reported in Table 1. The ARDRA analysis was performed digesting the amplification products with Sau 3A, Alu I e Hae III
Primer
Sequence
Application
Reference
27F 1492R ERIC 2 BOX A1R
AGAGTTTGATCMTGGCTCAG GGTTACCTTGTTACGACTT AAGTAAGTGACTGGGGTGAGCG CTACGGCAAGGCGACGCTGACG
ARDRA ARDRA REP-PCR REP-PCR
Muyzer et al. 1993 Muyzer et al. 1993 Versalovic et al. 1991 Dombek et al. 2000
Environ Sci Pollut Res
restriction enzymes. All analyses were performed at least twice for each isolate. The gene encoding for the 16S rRNA of one microorganism for each OTU was amplified, sequenced on both strands, and aligned to the sequence databases using BLASTN (Altshul et al. 1997). The bacterial enrichment and the nine different bacterial morphotypes were inoculated in liquid BSM amended with 1 % diesel oil (v/v) on an orbital shaker at 100 rpm at 28 ± 1 °C in the dark for routine maintenance. Depletion of diesel oil The depletion of diesel oil in liquid culture was monitored in 100 ml of BSM amended with 1 % (v/v) of diesel oil in Erlenmeyer flasks closed with a tight rubber stopper, maintained on an orbital shaker at 100 rpm at 28 ± 1 °C in the dark. Three Erlenmeyer flasks for each bacterial morphotypes and three flasks for the bacterial enrichment were inoculated with 103 colony forming units/milliliter (CFU/ml) of each bacterial strain. As negative control, three not inoculated flasks containing diesel oil at 1 % (v/v) were incubated in the same condition and analyzed in parallel. After 3 and 6 days of incubation, three Erlenmeyer flasks for each bacterial morphotypes and three flasks for the bacterial enrichment were analyzed by GCMS as reported by Klein et al. (2012). The nine bacterial morphotypes and the bacterial enrichment were analyzed for their capacity to grow on BSM with 1 % v/v diesel oil by counting the colony forming units of serial dilution on Agar LB plates. The serial dilutions were prepared in triplicates for each flask analyzed, at the beginning of the experimentation and after 6 days of incubation. After 6 days of incubation, the total volume of each flask was acidified (pH = 2.8), amended with 6 μg of deuterated alkanes with 16 (C16) and 24 (C24) carbons as surrogate standard and extracted at room temperature with dichloromethane (30 % v/v). This procedure was repeated three times, and the dichloromethane phase was concentrated by rotary evaporation at 40 °C, followed by evaporation under a stream of nitrogen. The concentration of total extracted and resolved hydrocarbons was determined by highresolution GC-MS analysis by a Saturn 2200 quadrupole ion trap mass spectrometer coupled to a CP-3800 gas chromatograph (Varian Analytical Instruments, Walnut Creek, CA, USA) equipped with a MEGA 1 MS capillary column (30 m; 0.25 mm i.d., 0.25 lm film thickness, MEGA s.n.c., Milan, Italy. The carrier gas was helium, which was dried and air free, with a linear speed of 60 cm/s. The oven temperature was maintained at 50 °C for 2 min, increased to 300 °C at a rate of 5 °C/min. Full-scan mass spectra were obtained in EI+ mode with an emission current of 10 μA and an axial modulation of 4 V. Data acquisition was from 10 to 550 Da at a speed of 1.4 scan/s. Chromatogram peaks were identified by comparing their
mass spectra with NIST library database and standards of the components. Quantification was performed using the retention time, response factors of these compounds and adjusted for surrogate recoveries, correlating chromatographic areas to concentrations (Klein et al. 2012). Repeated measurement (three times) on each sample showed that precision was, in all cases, within 10 %. Statistical analysis All the data were analyzed with the aid of one-way ANOVA, and the means were separated using the Bonferroni correction test (p ≤ 0.001), by applying the specific software Statgraphics 5.1 (Statistical Graphics Corp., USA).
Results Isolation of the bacterial candidates and depletion of diesel oil in liquid culture The bacterial enrichment, capable to utilize diesel oil as a sole carbon source, was obtained after five successive passages of cultures from homogenized dredged sediments maintained at 28 °C in BSM medium containing 1 % (v/v) diesel oil. The depletion of diesel oil in BSM was analyzed by GC-MS after 3 and 6 days of incubation. Results obtained are shown in Fig. 1. No depletion of the diesel oil was recorded in noinoculated flasks (data not shown), while a progressive depletion of the different normal alkanes (Cn-alkane, C12–C30) was observed only in the flasks inoculated with the bacterial enrichment. Figure 2 shows the chromatograms of diesel oil at the beginning of the incubation and at the successive two times of incubation in the presence of the bacterial enrichment. The chromatograms at the beginning of the incubation (Fig. 2, panel a) showed the major picks corresponding to the different normal alkanes (Cnalkane, C12–C30), the minor picks, corresponding to the branched alkanes (Cb-alkane) that distilled before the nalkane characterized by the same number of carbons and the unresolved complex mixture (UCM) underlying the Cn- and Cb-alkane profile. A peak corresponding to the nC18 fatty acid methyl ester (methyl esters of stearic acid) (C18 FAME) was part of the profile of the saturated fraction of the diesel oil. The chromatograms after 3 (panel b) and 6 (panel c) days of incubation showed a progressive depletion of the different n-alkanes (Cn-alkane, C12–C30). The depletion of the branched (Cb-alkanes) and of the nC18 fatty acid methyl ester can also be observed. Moreover, the depletion of the UCM was evident. The percentages of the depletion of the Cn-alkane varied from 78.81 to 100 % (Table 4).
Environ Sci Pollut Res
Fig. 1 Progressive depletion of the different normal alkanes (Cn-alkane, C12–C30) by the bacterial enrichment as a multispecies system after 3 (T3) and 6 (T6) days of incubation. T0, beginning of the incubation. For
each alkane, the presence of different letters on the corresponding bar indicates differences from samples at p < 0.001
Molecular identification of the bacterial strains composing the enrichment
capacity to grow in BSM with 1 % v/v diesel oil. Results obtained indicated that only seven morphotypes were capable to utilize diesel in BSM as the sole carbon source. The morphotypes that were not capable to grow in BSM with diesel oil as a sole carbon source (Con2 and NM2) were no longer investigated in the present study. The genotyping of the seven morphotypes able to utilize diesel oil as sole carbon source was performed by REP-PCR analysis (Fig. 3). The genus Pseudomonas was represented by three different REP-PCR profiles corresponding to three distinct bacterial strains, and the genus Stenotrophomonas was represented by four different REP-PCR profiles corresponding to four distinct bacterial strains.
Strains capable to grow on LB were isolated in axenic culture, and they were grouped on the base of their morphotypes. A total of nine bacterial morphotypes (Con1, Con2, Con3, M1, M2, NM1, NM2, G1, G2) were recovered and screened by ARDRA. The nine morphotypes were grouped in two ARDRA profiles corresponding to two operational taxonomic units (OTU). The sequencing of the corresponding 16S rDNA gene indicated that the morphotypes belong to the Stenotrophomonas and Pseudomonas spp. (Table 2). The nine bacterial morphotypes were analyzed for their Fig. 2 Example of chromatograms of diesel oil at the beginning of the incubation (T0), after 3 (T3) and 6 (T6) days of incubation of the bacterial enrichment as a multispecies system. The nC18 fatty acid methyl ester is indicated in the chromatograms as C18 FAME. The UCM is the portion of the chromatograms underlying the Cn-alkane profile
Environ Sci Pollut Res Table 2 Taxonomic characterization of the nine bacterial morphotypes
Bacterial morphotypes
Homology (%)
Organism showing greatest similarity
Con1, G2, Con3, M1 Con2, NM1, NM2, M2, G1
99 99
Stenotrophomonas sp. I_64-LFP1A9B2 Pseudomonas clororaphis isolate BFDP-S17
Stenotrophomonas sp. I_64-LFP1A9B2 (GeneBank Accession number JQ917828); Pseudomonas clororaphis isolate BFDP-S17 (GeneBank Accession number HF585008, Marasco et al. 2013)
Diesel oil depletion by the bacterial strains in axenic culture The capacity of the seven morphotypes to remove diesel oil from BSM in axenic culture was analyzed by GC-MS. In Table 3, the increments in cell density recorded for each isolates and for the enrichment as a multispecies system are reported. The results obtained for the percentage of depletion of the Cn-alkane, C12–C30, and of the UCM, after 6 days of incubation (Table 4), indicated that the seven morphotypes can be divided in five different groups. The first group comprised the M2 morphotype, belonging to the Pseudomonas sp. that was able to deplete alkanes from C12 to C22 with efficiency ranging from 2.98 to 48.70 %, respectively. No depletion of the nC18 fatty acid methyl ester was recorded; a 15 % depletion of the UCM fraction was observed. The second group comprised the G1 morphotype, belonging to the Pseudomonas sp., depleted alkanes between C12 and C25 with percentages of depletion between 3.04 and 55.12 %. A 40 % depletion of the nC18 fatty acid methyl ester and 45 % of depletion of the UCM fraction was also observed. A third group, Con1 and G2, belonging to the Stenotrophomonas sp. depleted alkanes between C12 and C28 with percentages of depletion between 58.99 and 88.83 %, respectively. Con1 and G2 depleted the 8.4 and NM2
a
NM1
G1
MM
CON1
CON3
G2
M1
MM
b
Fig. 3 REP-PCR profile of the different morphotypes. a The Pseudomonas spp. candidates profile obtained with the BOX A1R primer. b The Stenotrophomonas spp. candidate profiles obtained with the ERIC 2 primer
14.78 % of C29, respectively. Con1 showed 70 % of depletion of nC18 fatty acid methyl ester and 10 % of UCM depletion. G2 showed 33 % of depletion of the nC18 fatty acid methyl ester and 20 % of UCM. The fourth group, Con3 and M1, belonging to the Stenotrophomonas sp., depleted alkanes between C12 and C30 with a preference for alkanes with higher number of carbons (C28–C30), with percentages of depletion between 41.31 and 52.07 %. The M1 morphotype showed 70 % of depletion of nC18 fatty acid methyl ester and the 46 % of UCM. The Con3 morphotype showed 50 % of depletion for the nC18 fatty acid methyl ester and 30 % of the UCM. The fifth group (NM1), belonging to the Pseudomonas sp., depleted alkanes between C12 and C30 with percentages of depletion between 12.70 and 44.56 %, showing a percentage of depletion for C28–C30 between 15.32 and 30.02 %. The NM1 morphotypes showed 76 % of depletion for the nC18 fatty acid methyl ester and the 50 % of the UCM. On the other hand, the bacterial enrichment was able to deplete 100 % of both the nC18 fatty acid methyl ester and of the UCM. At the same time, the percentage of depletion of the Cn-alkane, C12– C30, was between 78.81 and 100 %.
Discussion In relation to the environmental contamination by mineral oil, many microorganisms were isolated from different matrices, including sediments, for their capacity to use the hydrocarbons as a sole carbon source (Hassanshahian et al. 2013, 2014; Liu et al. 2014). The isolation and characterization of autochthonous bacterial strains from different contaminated matrices is actually crucial, both for the improvement of our knowledge on the microbial communities involved in the depletion of contaminants and for the development of biotechnological approaches exploitable in bio-based strategies for decontamination of different matrices. In fact, the bioaugmentation of competent microbial strains for the transformation of organic contaminants is a promising strategy, with encouraging results when autochthonous strains are used, because of their capability to compete with the indigenous microbial community. The bacterial candidates for bioaugmentation can be exploited both as single components and as a consortium. In fact, while a single species can metabolize only a
Environ Sci Pollut Res Table 3 The CFU of the different bacterial strains and of the consortium in BSM amended with 1 % diesel oil at the beginning of the experimentation (T0) and after 6 days of incubation (T6)
T0 T6
Con1
Con3
M1
M2
NM1
G1
G2
Consortium
1 × 103 ± 61 9 × 104 ± 52
1 × 103 ± 43 8 × 8.104 ± 51
1 × 103 ± 82 1.2 × 105 ± 82
1 × 103 ± 20 4.7 × 105 ± 31
1 × 103 ± 52 9.9 × 104 ± 72
1 × 103 ± 73 5.6 × 105 ± 85
1 × 103 ± 61 6.8 × 105 ± 71
1 × 103 ± 74 3 × 106 ± 61
limited range of hydrocarbon substrates, a consortium of many different bacterial species, with broader and different enzymatic capacities, can be competent for the depletion of complex contaminations (Röling et al. 2002). As previously stated, the mineral oil contamination of environmental matrices is characterized by the presence of both the saturated fraction composed by alkanes and the more recalcitrant unsaturated fraction, the UCM. In this context, the capacity of putative bacterial candidates for bioaugmentation to use diesel oil as the sole carbon source is of interest, because diesel oil is composed by both saturated alkanes and the UCM fraction. The recalcitrance of the saturated fraction of the mineral oil, composed by branched and linear alkane, increases with the increase in the number of carbons and branching of the carbon chains. Our results showed that after only 6 days of incubation, the isolated bacterial enrichment
degraded Cn-alkanes from 12 to 30 carbons, with percentage of depletion spanning from 78.81 to 100 %. A concomitant nearly complete depletion of the branched alkanes and the UCM fraction was observed. Moreover, the bacterial enrichment depleted also the methyl ester of the C18 saturated alkane, whose presence can be reasonably ascribed to the blending of diesel oil and biodiesel. Even though recent studies showed that in comparison with the diesel oil, biodiesel is more readily degraded by microorganisms (De Mello et al. 2007; Makareviciene and Janulis 2003); some authors observed that biodiesel blending decrease the biodegradation rate of diesel oil, because of co-metabolic inhibition by the more degradable components (Owsianiak et al., 2009). In fact, our results showed that the bacterial enrichment is able to deplete all the fractions of diesel oil, suggesting its potential exploitation for bioaugmentation approaches in the
Table 4 Percentages of the depletion of the Cn-alkanes C12-C30 and C18 FAME, UCM of the seven morphotypes, and the consortium in BSM amended with 1 % diesel oil after 6 days of incubation. n-alkane
Con1 % depletion
Con3 % depletion
M1 % depletion
M2 % depletion
NM1 % depletion
G1 % depletion
G2 % depletion
Consortium % depletion
C12 C13 C14 C15
74.63 73.78 62.09 73.24
34.05 33.36 32.75 37.08
39.43 11.37 3.80 9.18
2.98 25.36 22.94 8.84
44.56 39.65 21.63 36.43
45.39 55.12 19.03 32.14
88.83 85.66 79.84 79.87
95.58 83.01 78.81 80.16
C16 C17 C18
69.38 73.31 50.58
34.98 36.23 38.68
18.48 19.75 22.71
31.69 48.70 16.03
30.42 30.84 33.07
36.55 27.24 40.53
80.07 80.22 63.18
88.91 87.35 86.40
C19 C20 C21 C22 C23 C24 C25 C26 C27 C28 C29 C30 C18FAME UCM
69.26 71.76 68.16 68.23 71.01 66.53 65.99 62.10 62.33 58.99 8.41 0.00 5.00 10.00
24.25 45.46 27.92 32.24 27.56 26.23 26.12 28.47 37.11 41.31 45.98 52.07 50.00 30.00
19.47 34.75 18.44 7.33 26.84 23.65 27.26 26.57 39.45 46.17 45.99 43.06 70.00 46.00
33.30 42.24 40.48 20.59 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.00 15.00
29.01 12.70 30.97 16.48 35.46 27.61 31.94 22.64 24.87 15.32 12.24 30.02 76.00 50.00
25.12 33.57 15.78 25.36 13.75 10.66 3.04 0.00 0.00 0.00 0.00 0.00 40.00 45.00
78.46 67.31 77.98 78.07 80.02 80.46 79.16 74.91 78.19 76.48 14.78 0.00 33.00 20.00
91.51 95.81 95.35 95.75 95.43 94.31 94.70 94.41 100.00 100.00 100.00 100.00 100.00 95.00
Percentage values represent the mean values of percentages of depletion derived from three flasks per morphotype and by the bacterial enrichment. The coefficient of variation was ≤10 %
Environ Sci Pollut Res
management of decontamination and detoxification of dredged sediments. In this context, it should be mentioned that several technical hitches can be encountered for the quantitative and functional monitoring of a bacterial multispecies system during its exploitation in bioaugmentation approach. The main one is the recovery of strain-specific barcode for numerical and functional quantifications of the bioaugmented strains during the processes. The recovery of strain-specific barcode in complex environmental matrices can be a chimera. In this context, it is reasonable to assume that a bacterial multispecies system, designed with a limited number of barcoded candidates, competent for the transformation of targeted fractions of crude oil, is recommended for the sustainability of the bioaugmentation approach in terms of both rational design and general costs. Thus, this study evaluated also the contribution of the different bacterial strains, composing the enrichment, to the depletion of the diesel oil. This proposition to eventually envisage, on a real scale, the bioaugentation of a hydrocarbonoclastic bacterial consortium, composed by a low number of bacterial species, is characterized for their capacity to transform all the fractions of crude oil. In this context, the morphotypes visually identified as component of the bacterial enrichment were further characterized, grouped in different OTUs, and assigned to different species of the Pseudomonas and Stenotrophomonas genera. Moreover, they were grown in axenic culture with diesel oil as a sole carbon source, and the depletion of the corresponding saturated and unsaturated fractions of diesel oil were quantified. Actually, both Pseudomonas and Stenotrophomonas spp. were described as able to degrade alkane with interesting potentials in the treatment of different matrices contaminated by crude oils and derivatives, comprising diesel/biodiesel blending (Al-Mailem et al. 2014; Hassanshahian et al. 2013, 2014). Both genera were isolated from environmental matrices contaminated by the most recalcitrant fractions of organic contamination like PAHs and PCBs, and both microbial genera were described as able to transform the corresponding chemical structures recalcitrant to biodegradation (Bezza and Nkhalambayausi 2015; Koubek et al. 2013; Dudášová et al. 2014; Molina et al. 2009). The co-presence of the two genera in the same contaminated environmental matrices is frequent, suggesting a possible interaction between Pseudomonas and Stenotrophomonas spp. in the context of the biodegradation of recalcitrant contaminants. Our results show that the here isolated morphotypes can be sub-divided in different groups not only in terms of taxonomic classification but also of metabolic capacities. In fact, among the new isolates, the highest number of strains able to deplete Cn-alkane up to C30 with a concomitant higher percentage of depletion of the C18 methyl ester and of the UCM fraction was ascribed to the Stenotrophomonas sp. More in details, the Stenotrophomonas sp. strains combine the capacity to deplete significant percentages of the most recalcitrant fraction of
alkanes in diesel oil, the C28-C30 portion, with the capacity to deplete the UCM. With reference to the different functional groups associated to the Stenotrophomonas and Pseudomonas spp., here isolated, it is reasonable to assume that the metabolic activity of the bacterial enrichment was mainly determined by the Stenotrophomonas sp. strains. In relation to the Pseudomonas sp., it should be mentioned that two out of the six bacterial morphotypes, taxonomically classified as Pseudomonas sp. did not use diesel as a sole carbon source. Their intervention in the depletion of diesel oil as single candidates can be excluded, but it is reasonable to assume a potential synergistic activity with bacterial candidates able to use diesel as a sole carbon source. However, as a general observation, the Pseudomonas sp. strains here isolated limited their capacity to deplete the saturated fraction of diesel oil to the Cn-alkane C12–C25 fraction. Nevertheless, the Pseudomonas sp. NM1 depleted the Cn-alkane up to C30, combining this catabolic capacity of interest to the capacity to deplete the 76 % of the nC18 fatty acid methyl ester and to the 50 % of the UCM.
Conclusions A bacterial enrichment was obtained by TPH-contaminated sediment from a river estuary in Italy. The multibacterial species system is able to completely deplete Cn-alkane from C28 up to C30 and to deplete the 95 % of the unresolved complex mixture of organic compounds. The enrichment was composed by new isolates taxonomically identified as different species of Pseudomonas and Stenotrophomonas genera. Among the new isolates, the Stenotrophomonas sp. M1 strain was able to deplete 43–46 % of Cn-alkane from C28 up to C30, 70 % of the nC18 fatty acid methyl ester, and 46 % of the unresolved complex mixture of organic compounds. At the same time, the Pseudomonas sp. strains, the NM1, was able to deplete the highest percentages of both the UCM and the nC18 fatty acid methyl ester, respectively, the 50 % and the 76 %. Both the enrichment as a multispecies system and the M1 and NM1 strains are proposed as candidates for bioaugmentation in bio-based approaches to the treatment of dredged sediments. Acknowledgments This work is part of the results of the Bioresnova project 135/11 Ricerca, co-financed by the Fondazione Pisa and the Department of Biology, University of Pisa.
References Al-Mailem D, Kansour MK, Radwan SS (2014) Hydrocarbonoclastic biofilms based on sewage microorganisms and their application in hydrocarbon removal in liquid wastes. Can J Microbiol 60:477–486 Altshul SF, Madden TL, Shaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSIBLAST: a new
Environ Sci Pollut Res generation of protein database search programs. Nucl Acids Res 25: 3389–3402 Bezza FA, Nkhalambayausi CEM (2015) Biosurfactant-enhanced bioremediation of aged polycyclic aromatic hydrocarbons (PAHs) in creosote contaminated soil. Chemosphere 144:635–644 Booth AM, Sutton PA, Lewis CA, Scarlett A, Chau W, Widdows J, Rowland SJ (2007) Unresolved complex mixtures of aromatic hydrocarbons: thousands of overlooked persistent, bioaccumulative, and toxic contaminants in mussels. Environ Sci Technol 41:457–464 Booth AM, Scarlett AG, Lewis CA, Belt ST, Rowland SJ (2008) Unresolved complex mixtures (UCMs) of aromatic hydrocarbons: branched alkyl indanes and branched alkyl tetralins are present in UCMs and accumulated by and toxic to, the mussel Mytilus edulis. Environ Sci Technol 42:8122–8126 De Mello JA, Carmichael CA, Peacock EE, Nelson RK, Arey JS, Reddy CM (2007) Biodegradation and environmental behavior of biodiesel mixtures in the sea: an initial study. Mar Pollut Bull 54:894–904 Di Gregorio S, Azaizeh H, Lorenzi R (2013) Biostimulation of the autochthonous microbial community for the depletion of polychlorinated biphenyls (PCBs) in contaminated sediments. Environ Sci Pollut Res Int 20:3989–3999 Di Gregorio S, Gentini A, Siracusa G, Becarelli S, Azaizeh H, Lorenzi R (2014) Phytomediated biostimulation of the autochthonous bacterial community for the acceleration of the depletion of polycyclic aromatic hydrocarbons in contaminated sediments. Biomed Res Int Dombek PE, Johnson LK, Zimmerley ST, Sadowsky MJ (2000) Use of repetitive DNA sequences and the PCR to differentiate Escherichia coli isolates from human and animal sources. Appl Environ Microbiol 66:2572–2577 Dudášová H, Lukáčová L, Murínová S, Puškárová A, Pangallo D, Dercová K (2014) Bacterial strains isolated from PCBcontaminated sediments and their use for bioaugmentation strategy in microcosms. J Basic Microbiol 54:253–260 Hassanshahian M, Ahmadinejad M, Tebyanian H, Kariminik A (2013) Isolation and characterization of alkane degrading bacteria from petroleum reservoir waste water in Iran (Kerman and Tehran provenances). Mar Pollut Bull 73:300–305 Hassanshahian M, Zeynalipour MS, Musa FH (2014) Isolation and characterization of crude oil degrading bacteria from the Persian Gulf (Khorramshahr provenance). Mar Pollut Bull 82:39–44 Klein AG, Sweet ST, Wade TL, Sericano J, Kennicutt MC (2012) Spatial patterns of total petroleum hydrocarbons in the terrestrial environment at McMurdo Station, Antarctica. Antarct Sci 24:450–466 Koubek J, Mackova M, Macek T, Uhlik O (2013) Diversity of chlorobiphenyl-metabolizing bacteria and their biphenyl dioxygenases in contaminated sediment. Chemosphere 93: 1548–1555 Li WW, Yu HQ (2014) Stimulating sediment bioremediation with benthic microbial fuel cells. Biotechnol Adv 33:1–12 Liu H, Yao J, Yuan Z, Shan Y, Chen H, Wang F, Masakorala K, Yu C, Cai M, Blake RE, Choi M (2014) Isolation and characterization of
crude-oil-degrading bacteria from oil-water mixture in Dagang oilfield, China. Int Biodeterior Biodegradation 87:52–59 Makareviciene V, Janulis P (2003) Environmental effect of rapeseed oil ethyl ester. Renew Energ 28:2395–2403 Marasco R, Roll E, Fusi M, Cherif A, Abou-Hadid A, El-Bahairy U, Borin S, Sorlini C, Daffonchio D (2013) Plant growth promotion potential is equally represented in diverse grapevine root-associated bacterial communities from different biopedoclimatic environments. Biomed Res Int. doi:10.1155/2013/491091 Meybeck M, Lestel L, Bonte P, Moilleron R, Colin JL, Rousselot O, Herve D, de Ponteves C, Grosbois C, Thevenot DR (2007) Historical perspective of heavy metals contamination (Cd, Cr, Cu, Hg, Pb, Zn) in the Seine River basin (France) following a DPSIR approach (1950–2005). Sci Total Environ 375:204–231 Molina MC, González N, Bautista LF, Sanz R, Simarro R, Sánchez I, Sanz JL (2009) Isolation and genetic identification of PAH degrading bacteria from a microbial consortium. Biodegradation 20:789–800 Muyzer G, de Waal EC, Uitterlinden AG (1993) Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl Environ Microbiol 59:695–700 Nikolopoulou M, Eickenbusch P, Pasadakis N, Venieri D, Kalogerakis N (2013) Microcosm evaluation of autochthonous bioaugmentation to combat marine oil spills. N Biotechnol 30:734–742 Owsianiak M, Łukasz C, Szulc A, Staniewski J, Olszanowski A, Agnieszka K, Olejnik-Schmidt HJ, Heipieper (2009) Biodegradation of diesel/biodiesel blends by a consortium of hydrocarbon degraders: effect of the type of blend and the addition of biosurfactants. Bioresour Technol 100:1497–1500 Röling WF, Milner MG, Jones DM, Lee K, Daniel F, Swannell RJ, Head IM (2002) Robust hydrocarbon degradation and dynamics of bacterial communities during nutrient-enhanced oil spill bioremediation. Appl Environ Microbiol 68:5537–5548 Samanipoura S, Dimitriou-Christidisa P, Grosa J, Grangea A, Samuel AJ (2015) Analyte quantification with comprehensive two-dimensional gas chromatography: assessment of methods for baseline correction, peak delineation, and matrix effect elimination for real samples. J Chromatogr A 1375:123–139 Scarlett A, Galloway T, Rowland S (2007) Chronic toxicity of unresolved complex mixtures (UCM) of hydrocarbons in marine sediments. J Soil Sediment 7:200–206 Thomas KV, Donkin P, Rowland SJ (1995) Toxicity enhancement of an aliphatic petrogenic unresolved complex mixture (UCM) by chemical oxidation. Water Res 29:379–382 Versalovic J, Koeu T, Lupski JR (1991) Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucl Acids Res 19:6823–6831 Weisburg WG, Barns SM, Pelletier DA, Lane DJ (1991) 16S Ribosomal DNA amplification for phylogenetic study. J Bacteriol 173:697–703
