Isolation and characterization of a novel Dehalobacter species strain ...

3 downloads 3 Views 802KB Size Report
Aug 31, 2013 - from a digester sludge sample, which is able to dechlorinate 2,4,6-trichlorophenol (2,4,6-TCP) to. 4-monochlorophenol (4-MCP) with H2 as the ...

Biodegradation (2014) 25:313–323 DOI 10.1007/s10532-013-9662-1

ORIGINAL ARTICLE

Isolation and characterization of a novel Dehalobacter species strain TCP1 that reductively dechlorinates 2,4,6-trichlorophenol Shanquan Wang • Weijie Zhang Kun-Lin Yang • Jianzhong He



Received: 8 March 2013 / Accepted: 26 August 2013 / Published online: 31 August 2013 Ó Springer Science+Business Media Dordrecht 2013

Abstract Chlorophenols are widely used as biocides, leading them to being prevalent environmental contaminants that pose toxic threats to ecosystems. In this study, a Dehalobacter species strain TCP1 was isolated from a digester sludge sample, which is able to dechlorinate 2,4,6-trichlorophenol (2,4,6-TCP) to 4-monochlorophenol (4-MCP) with H2 as the sole electron donor and acetate as the carbon source. Strain TCP1 also distinguishes itself from other Dehalobacter species with its capability to dechlorinate tetrachloroethene or trichloroethene (TCE) to both cis- and trans-dichloroethenes in a ratio of 5.6 (±0.2):1. The growth yields of strain TCP1 on TCE and 2,4,6-TCP were 4.14 9 1013 and 5.77 9 1013 cells mol-1 of Clreleased, respectively. Strain TCP1 contains five unusually long 16S rRNA gene copies per genome,

and the extra length is due to the *110 bp insertion sequences at their 50 -ends. This suggests that strain TCP1 may represent a novel Dehalobacter species. A putative chlorophenol reductive dehalogenase gene— debcprA—was identified to catalyze the ortho-chlorine removal from 2,4,6-TCP. Both the culture-dependent and housekeeping rpoB gene-based approaches indicate the purity of the culture. Strain TCP1 can serve as a promising candidate for the bioremediation of 2,4,6-TCP contaminated sites, and its discovery expands our understanding of metabolic capabilities of Dehalobacter species.

Electronic supplementary material The online version of this article (doi:10.1007/s10532-013-9662-1) contains supplementary material, which is available to authorized users.

Introduction

S. Wang  J. He (&) Department of Civil and Environmental Engineering, National University of Singapore, Block E2-02-13, 1 Engineering Drive 3, Singapore 117576, Singapore e-mail: [email protected] S. Wang e-mail: [email protected] W. Zhang  K.-L. Yang Department of Chemical and Biomolecular Engineering, National University of Singapore, Singapore 117576, Singapore

Keywords Dehalobacter  Reductive dechlorination  2,4,6-TCP  Chloroethenes  Reductive dehalogenase

Chlorophenols are widely used as biocides because of their broad spectrum of anti-microbial properties. Among them, 2,4,6-trichlorophenol (2,4,6-TCP) is commonly used as fungicide, herbicide, and insecticide leading to its prevalence in ground or surface water (ATSDR 1990), which endangers the public health due to its toxicity and carcinogenicity (U.S. EPA 1984). Currently, the removal of 2,4,6-TCP by either aerobic biodegradation or anaerobic microbial dechlorination processes has been reported (Ha¨ggblom 1990; Bouchard et al. 1996; Adrian et al. 2007), in

123

314

which the latter was reported to be conducted only by microbes of the genus Desulfitobacterium or Dehalococcoides. Several strains (e.g., PCP-l, and DCB2) of the genus Desulfitobacterium are capable of reductively dechlorinating 2,4,6-TCP to 4-monochlorophenol (4-MCP) (Ha¨ggblom 1990; Villemur et al. 2006). In comparison, only one Dehalococcoides species strain CBDB1 has been reported to be able to dechlorinate 2,4,6-TCP to 2,4-dichlorophenol (2,4DCP), while further dechlorination of 2,4-DCP to 4-MCP was found to be slow and incomplete (Adrian et al. 2007). Therefore, information is still limited on microbial reductive dechlorination of 2,4,6-TCP. Dehalobacter is phylogenetically related to Desulfitobacterium in Firmicutes phylum, which can only grow in the presence of halogenated compounds. Thus far, only three Dehalobacter strains (i.e., strains PERK23, TEA and TCA1) have been isolated and characterized, and each of them has a narrow substrate range (Wild et al. 1997; Holliger et al. 1998; Sun et al. 2002). In bacterial isolation and characterization processes, the 16S rRNA gene-based molecular techniques play key roles in characterizing culture purity (Ding and He 2012). However, it may not be applicable to Dehalobacter species due to their multiple 16S rRNA gene copies per genome (Grostern and Edwards 2009; Nelson et al. 2011). And it might be insufficient to differentiate between any two similar Dehalobacter strains based only on their cell/colony (agar shakes) morphology and their metabolic characteristics (Wild et al. 1997; Holliger et al. 1998; Sun et al. 2002; Ding and He 2012). Therefore, it is imperative to find an appropriate target gene to confirm the purity of bacteria with multiple 16S rRNA genes. In this study, we describe a new Dehalobacter isolate that dechlorinates 2,4,6-TCP to 4-MCP and PCE/TCE to cis-/trans-DCEs. A putative reductive dehalogenase (rdh) gene for 2,4,6-TCP dechlorination and a rpoB gene (encoding b subunit of RNA polymerase) were identified by employing new degenerate primers, and these were further employed to confirm the culture purity.

Materials and methods Chemicals Unless stated otherwise, chemicals were purchased from Sigma-Aldrich at the highest purity available. H2

123

Biodegradation (2014) 25:313–323

was obtained from a hydrogen generator (NM-H250, Schmidlin-DBS AG, Neuheim, Switzerland). The DNA and RNA extraction kits were obtained from Qiagen (QIAGEN, Hilden, Germany), and the GoldTaq DNA polymerase and related PCR reagents were purchased from Applied Biosystems (Foster City, CA, USA). Culture and growth conditions A mixed culture dechlorinating 2,4,6-TCP and TCE was enriched from a 2,4,6-TCP-dechlorinating microcosm established with the digester sludge from an industrial wastewater treatment plant at Jurong Island, Singapore. Further enrichment was conducted by serial dilutions and agar shakes in 20-ml vials filled with 10 ml of mineral salts medium (Wang and He 2013) spiked with 2,4,6-TCP (0.1 mM) or TCE (0.8 mM), acetate (10 mM) and hydrogen (5 9 104 Pa or 0.40 mM). During the isolation process, an active culture inoculated from a single colony was subjected to subsequent dilution-to-extinction series. After obtaining a pure culture, dechlorination time-course studies were conducted in 160-ml serum bottles (in triplicate) containing 100 ml of mineral salts medium (Wang and He 2013) amended with 2,4,6-TCP (*0.1 mM) or TCE (*0.8 mM), acetate (10 mM)/hydrogen (5 9 104 Pa or 0.40 mM), a vitamin solution (Wolin et al. 1963) containing 0.05 mg l-1 of vitamin B12 (He et al. 2007), and 5 % inoculum. The following compounds were tested as electron acceptors on this isolate: chlorinated ethenes (PCE, DCE isomers and vinyl chloride) (0.2 mM), chloroethanes (1,1-dichloroethane and 1,2-dichloroethane) (0.2 mM), pentachlorophenol (0.05 mM), Aroclor 1260 (0.05 mM), polybrominated diphenyl ethers (PBDEs) (an octa-BDE mixture and a penta-BDE mixture) (0.5 lM), sulfate (5–10 mM), sulfite (0.5–5 mM), nitrate (5–10 mM), and nitrite (1–10 mM). If the compound was in powder form, it was first dissolved in inert isooctane/nonane solvent before injected into medium bottles. In addition, the isolate’s fermentation capability was tested with 10 mM following compounds: fumarate, malate, lactate, pyruvate, glucose, and glutamate. All bottles were incubated quiescently in the dark at 30 °C. Two cultures (i.e., culture AD14-TCP and AD14PCE) containing Dehalobacter species were selected for the rpoB gene sequences studies, which could dechlorinate 2,4,6-TCP and PCE, respectively.

Biodegradation (2014) 25:313–323

Analytical methods Headspace samples of chloroethenes, chloroethanes and ethene were injected manually with a glass gastight luer lock syringe (Hamilton Co., Reno, NV, USA) into a gas chromatography (GC) 6890N equipped with a flame ionization detector (Agilent, Wilmington, DE, USA) and a GS-GasPro column (30 m 9 0.32 mm 9 0.25 lm film thickness; J&W Scientific, USA). Polychlorinated biphenyls (PCBs) (i.e., Aroclor 1260) were extracted with isooctane and tested on the same GC coupled with an electron capture detector (ECD) and an HP-5 column (30 m 9 0.32 mm 9 0.25 lm film thickness; J&W Scientific, USA) as described previously (Wang and He 2011). PBDEs were tested on a gas chromatograph/ mass spectrometer (GC–MS) (Agilent, Wilmington, DE, USA) (Lee and He, 2010). Chlorophenols were extracted with isooctane, which were analyzed on another GC–MS (QP 2010, Shimadzu Corporation, Japan) equipped with an HP-5 capillary column (30 m 9 0.32 mm 9 0.25 lm film thickness, J&W Scientific, USA). The oven temperature of the GC–MS was initially set at 40 °C, increased at 15 °C min-1 to 200 °C, and held for 3 min. Helium was used as the carrier gas, with a column flow of 1.92 ml min-1. DNA and RNA extraction, PCR, clone library, and sequencing Total genomic DNA was extracted from 1 ml of cell pellets collected from 2,4,6-TCP- or TCE-dechlorinating cultures and the controls according to the method described previously (Chow et al. 2010). The concentration of the nucleic acid was determined by a Nanodrop-1000 (NanoDrop Technologies, Wilmington, DE, USA). Cultures for RNA analysis were harvested when cells reached the exponential growth phase. Total RNA was extracted from cell pellets of 1.5 ml culture by using RNeasy extraction kit as described previously (Chow et al. 2010), which was further converted to cDNA with a two-step reverse transcription-PCR Sensiscript kit. PCR (Eppendorf, Hamburg, Germany) amplifications of 16S rRNA, putative rdh and rpoB gene sequences were conducted with their specific primers (Table 1). The degenerate primers were designed as described previously (Chow et al. 2010). The rpoB gene-targeted CrpoBF/CrpoBR primers were generated based on the conserved

315

regions through aligning all available rpoB gene sequences from genera of Clostridiales order. Subsequent clone libraries were established with purified PCR products by using TOPO-TA cloning kit (Invitrogen, Carlsbad, CA, USA), and all further clonebased experiments were carried out as described previously (Ho¨lscher et al. 2004). Purified plasmids or PCR products were sequenced and aligned by using MEGA4 (Tamura et al. 2007). DGGE PCR products amplified with the primer sets 341FGC/ 518R or DebrpoBFGC/DebrpoBR (Table 1) were separated on an 8 % polyacrylamide gel with a gradient range of 30–60 % (100 % denaturant consisted of 7 M urea and 40 % deionized formamide) in 0.5 9 TAE buffer. Gradient gels were cast with BioRad’s Model 475 gradient delivery system (Bio-Rad, Hercules, CA, USA). The electrophoresis was performed for 12 h at a constant electric current of 50 mA and a temperature of 60 °C with the D-Code Mutation Detection System (Bio-Rad, Hercules, CA, USA) as described previously (Wang and He 2011). Gel images of SYBRÒ Gold (Invitrogen, Carlsbad, CA, USA) stained DNA were taken by using a Molecular Imager Gel Doc XR System (Bio-Rad, Hercules, CA, USA). Bands of interest were excised and DNA fragments were extracted using the QIAEX II Gel Extraction Kit (QIAGEN, Hilden, Germany). The captured DNAs were then PCR re-amplified using the primer set 341FGC/518R or DebrpoBFGC/DebrpoBR, and reanalyzed by DGGE to confirm that single band was obtained before sending the PCR re-amplified products for sequencing. qPCR Quantitative real-time PCR (qPCR) (ABI 7500 Fast real-time PCR system; ABI, Foster City, CA, USA) assays were used to measure culture growth. The experiments were performed in triplicates for cultures grown with 2,4,6-TCP or TCE by using SYBR green assays with bacterial 16S rRNA, rpoB, debcprA genespecific primers (Table 1). SYBR green dye would bind to amplified double-stranded DNA during qPCR amplification process and the fluorescently tagged DNA in turn would be detected by the qPCR system. The specificity of such assays was ensured by the use

123

316

Biodegradation (2014) 25:313–323

Table 1 Primers used in this study Primer

Target

Orientation

Sequence (50 –30 )

Reference or source

8F

Bacteria 16S rRNA genes

Forward

AGAGTTTGATCCTGGCTCAG

Reysenbach et al. (1994)

341F

Bacteria 16S rRNA genes

Forward

CCTACGGGAGGCAGCAG

Muyzer et al. (1993)

518R

Bacteria 16S rRNA genes

Reverse

ATTACCGCGGCTGGCTGG

Ovreas et al. ((1997)

1541R

Bacteria 16S rRNA genes

Reverse

AAGGAGGTGATCCAGCC

Paster et al. (2002)

BacF1

Bacteria 16S rRNA genes

Forward

TCCTACGGGAGGCAGCAG

Holmes et al. (2006)

BacR1

Bacteria 16S rRNA genes

Reverse

GGACTACCAGGGTATCTAATCCTGTT

Holmes et al. (2006)

BacR1

Bacteria 16S rRNA genes

Reverse

GGACTACCAGAGTATCTAATTCTGTT

Holmes et al. (2006)

CrpoBF

Clostridia rpoB gene

Forward

GARGGHCCBAACATYGG

This study

CrpoBR

Clostridia rpoB gene

Reverse

CCANACYTCCATYTCHCC

This study

DebrpoBF

Dehalobacter rpoB gene

Forward

TAAGCGAAAAGATCGAAGCG

This study

DebrpoBR

Dehalobacter rpoB gene

Reverse

TCAACAGCAGCCTTATACTC

This study

TCP1rpoBF

Dehalobacter sp. TCP1 rpoB gene

Forward

GCGCCCTGGAGATATCTTAGTG

This study

TCP1rpoBR

Dehalobacter sp. TCP1 rpoB gene

Reverse

TCAGCCGTAAGCTCCGTTTC

This study

RRF2

rhd gene

Forward

SHMGBMGWGATTTYATGAARR

KrajmalnikBrown et al. (2004)

ceRD2Sf

rhd gene

Forward

GCAGCACGCCTTTTTGGIGCIKMIWSIGTIGG

Regeard et al. (2004)

ceRD2Lf

rhd gene

Forward

GCAGCACGCCTTTTTGGIGCIKMIYTNGTIGG

Regeard et al. (2004)

RD7r

rhd gene

Reverse

AANGGRCAIACIGCIWCRCA

Regeard et al. (2004)

DebfrdhF

rhd gene

Forward

ATGGGNGARATHAAYMG

This study

DebfrdhR

rhd gene

Reverse

TCNGCRCAYTTYTTRCA

This study

debcprAF

debcprA gene

Forward

CATCAGCTGTGCCAATGGAA

This study

debcprAR

debcprA gene

Reverse

CGGATACAGCTCGCGTCTTT

This study

Forward

CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGG

Muyzer et al. (1993)

GC-clampa a

The GC-clamp was attached to the 50 -end of the 341F and DebrpoBF to get primers 341FGC and DebrpoBFGC, respectively

of stringent HotStar Taq DNA polymerase (QIAGEN, Hilden, Germany) as well as the inclusion of melt curve analysis at the end of the entire amplification

123

process. Calibration curves were obtained by using 10-fold serial dilutions of plasmid DNA with corresponding cloned gene inserts. The standard curves

Biodegradation (2014) 25:313–323

spanned a range of 102–108 gene copies per ll of template DNA.

317

sections. Dehalobacter sp. strain TCP1 could dechlorinate TCE to cis-DCE/trans-DCE (ratio: 5.6 (±0.2):1) and 2,4,6-TCP to 4-MCP (Fig. 1a, b).

Nucleotide sequence accession numbers The 16S rRNA gene sequences of culture TCP1 The sequences were deposited in GenBank with accession numbers: JX999720-JX999724 for the five 16S rRNA genes of Dehalobacter sp. strain TCP1, JX999725 for the debcprA gene of strain TCP1, JX999726 for the rpoB gene of strain TCP1, and JX999727 for the rpoB gene of Dehalobacter sp. strain AD14-TCP.

Results Isolation of a 2,4,6-TCP-dechlorinating microbe: Dehalobacter sp. strain TCP1 An enrichment culture obtained from an industrial digester sludge sample exhibited reductive dechlorination of 2,4,6-TCP to 4-MCP and TCE to cis-DCE/ trans-DCE (ratio: 5.0–6.0:1) in defined mineral salts medium amended with acetate and hydrogen. Dilution-to-extinctions were performed to enrich the 2,4,6TCP dechlorinator(s) while the dechlorination activities were only observed in the vials with dilutions less than 10-3. However, the dechlorination activities were repeatedly detected in 10-7 dilution vials amended with TCE, which replaced 2,4,6-TCP in following dilution series. After 21 times of serial dilutions, a culture dechlorinating TCE to cis-/trans-DCEs at a ratio of *5.6:1 was obtained, which could also dechlorinate 2,4,6-TCP (*0.1 mM) completely to 4-MCP. The 16S rRNA gene-targeted DGGE analysis showed the sole presence of Dehalobacter in this culture (Fig. S1). To further purify strain TCP1, agar shakes were prepared (Holliger et al. 1998), from which single colonies capable of dechlorinating TCE/ 2,4,6-TCP were subjected to subsequent transfers. Eventually, pure Dehalobacter sp. strain TCP1 was obtained. Light microscope revealed uniform rodshaped morphology of strain TCP1 with a size of 1–3 lm in length and 0.3–0.6 lm in diameter (Fig. S2), which is similar to the size of other reported Dehalobacter species. Strain TCP1’s purity was further confirmed by using the housekeeping rpoB gene-based analysis with DGGE (lane 1 in Fig. S3), clone library and qPCR as shown in following

The 16S rRNA gene sequences of culture TCP1 were PCR amplified by using the primer set, 8F and 1541R (Table 1), resulting in *1,700 bp amplicons (data not shown). Subsequent clone library construction generates five distinct full-length 16S rRNA gene sequences (JX999720-JX999724) (Table 2). Dehalobacter sp. strain TCP1 shares the highest 16S rRNA gene sequence (JX999720) identity (99 % over 1,657 bp) with the uncultured Dehalobacter bacterium clone SJA-19 (AJ009454) from an anaerobic trichlorobenzene-dechlorinating microbial consortium (von Wintzingerode et al. 1999). As shown in the phylogenetic tree (Fig. 2a), Dehalobacter sp. strain TCP1 cannot be closely clustered with other characterized Dehalobacter isolates due to their unusually long 16S rRNA gene sequences with an insertion of approximately 110 bp in the 50 region, which is present in the 16S rRNA gene sequences of two recently released Dehalobacter genomes assembled from metagenomic data (Tang et al. 2012). All the insertion sequences of the five 16S rRNA genes shares high similarity with that of several Desulfitobacterium species, e.g., one (JX999720) of the inserted partial 16S rRNA gene sequences (from base 8–206) of Dehalobacter sp. strain TCP1 possesses 82 % similarity with the corresponding positions in the 16S rRNA gene sequence of Desulfitobacterium chlororespirans clone IAFDc7 (DQ224233). Apart from the insertion sequences, the remaining sequences share the highest of 99 % similarity with that of Dehalobacter restrictus strain TEA (Y10164) and have sequence heterogeneity as shown in Fig. S4. Confirmation of culture purity The rpoB gene is a single copy gene in bacterial genomes, and could provide comparable phylogenetic resolution to that of 16S rRNA gene at all taxonomic levels (Dahllo¨f et al. 2000; Case et al. 2007). Therefore, the rpoB gene was utilized as a targeting gene to test culture purity of strain TCP1. A degenerate primer set CrpoBF/CrpoBR (Table 1) was designed to target the conserved regions of rpoB gene

123

318

Biodegradation (2014) 25:313–323

(A)

(B) Concentrations ( M)

Concentration ( M)

1000 800 600 400 200 0 0

1

2

3

4

5

120 100 80 2,4,6-TCP 2,4-DCP 4-MCP

60 40 20 0 0

6

2

Time (d)

6

8

(D) rpoB gene copies/ml

(C) rpoB gene copies/ml

4

Time (d)

4e+7 Dehalobacter sp. TCP1

3e+7 2e+7 1e+7

0

2

4

6

1.4e+7

Dehalobacter sp. TCP1

1.2e+7 1.0e+7 8.0e+6 6.0e+6 4.0e+6 2.0e+6 0

8

2

4

6

8

Time (d)

Time (d)

Fig. 1 Reductive dechlorination of a TCE and b 2,4,6-TCP by Dehalobacter sp. strain TCP1, and increase in rpoB gene copies as quantified by qPCR during reductive dechlorination of c TCE and d 2,4,6-TCP. Error bars indicate standard deviations. d days

Table 2 Comparison of Dehalobacter isolates Strain

Electron donor(s)

Electron acceptor(s)

Dechlorination product(s)

Size of 16S rRNA gene (bp)a

Reference(s) or source

Dehalobacter restrictus strain PER-K23

Formate/H2

PCE, TCE

cis-DCE

1,556

Holliger et al. (1998)

Dehalobacter restrictus strain TEA

H2

PCE, TCE

cis-DCE

1,559

Wild et al. (1997)

Dehalobacter sp. strain TCA1

Formate/H2

1,1,1-Trichloroethane

Chloroethane

1,549

Sun et al. (2002)

Dehalobacter sp. strain TCP1

H2

2,4,6-TCP, PCE, TCE

4-MCP, trans/cis-DCE

1,664/1,712

This study

a

Sequence size were obtained based on primer set, 8F and 1541R

b

Sizes of four 16S rRNA genes (JX999720, JX999722–JX999724) are 1,664 bp with one exception (JX999721) at 1,712 bp

sequences (*1,650 bp amplicons) from genera of the Clostridiales order. The rpoB gene clone library (72 clones) of strain TCP1 generated only one rpoB gene sequence (JX999726), sharing the highest similarity of 99 % (over 1,653 bp) with that of Dehalobacter sp. strain CF and strain DCA. By using the same primer set, another Dehalobacter rpoB gene sequence (JX999727) was obtained from a Dehalobacter-containing culture AD14-TCP (Fig. 2b). Based on these sequences, a Dehalobacter genus-specific primer set

123

DebrpoBFGC/DebrpoBR (Table 1) was designed for DGGE analysis of Dehalobacter diversity, which was further employed to identify a Dehalobacter rpoB gene (lane 2 in Fig. S3) from a PCE-dechlorinating culture AD14-PCE. The rpoB gene-targeting DGGE analysis confirmed the presence of only a single Dehalobacter strain in the pure culture (lane 1 in Fig. S3). To further corroborate culture TCP1’s purity, qPCR assays were performed using primers (Table 1)

Biodegradation (2014) 25:313–323

319

(A)

(B)

Fig. 2 Phylogenetic tree of Dehalobacter sp. strain TCP1 based on a the 16S rRNA gene and b the rpoB gene. Phylogenetic analyses are conducted in MEGA4 (Tamura et al. 2007)

targeting either the 16S rRNA gene, rpoB gene, or the debcprA gene (reductive dehalogenase gene for removing ortho-chlorines from 2,4,6-TCP, identified in a following section) in the genomic DNA of culture TCP1. As shown in Fig. 3, gene copies of rpoB and debcprA are approximately equal to each other. The 16S rRNA gene copies as measured by universal bacteria primers are five times of that of rpoB and debcprA genes. This is consistent with the five distinct 16S rRNA gene sequences retrieved from the clone library, suggesting that culture TCP1 is a single debcprA gene-containing Dehalobacter species of which the genomic DNA contains five distinct 16S rRNA gene copies.

Characterization of Dehalobacter sp. strain TCP1 Dechlorination of TCE/2,4,6-TCP was coupled to an increase of rpoB gene copies of Dehalobacter sp. strain TCP1 as measured by qPCR with strain-specific rpoB gene-targeting primers (Table 1). Following the consumption of 85.1 ± 4.23 lmol TCE (in 100 ml) and 11.0 ± 0.15 lmol 2,4,6-TCP (22.0 lmol chlorine removal in 100 ml due to two chlorines removal from each 2,4,6-TCP), rpoB gene copy numbers of strain TCP1 increased from 3.24 9 106 to 3.86 9 107 and from 3.48 9 105 to 1.31 9 107 copies ml-1, respectively (Fig. 1c, d). The growth yields of strain TCP1 on TCE and 2,4,6-TCP were 4.14 9 1013 and

123

320

Biodegradation (2014) 25:313–323

Total gene copies (10 7 /mL)

20

15

16S rRNA

10

5

0

Fig. 3 Quantification of 16S rRNA, rpoB and debcprA gene copies in TCE-dechlorinating pure culture TCP1 by qPCR

5.77 9 1013 cells mol-1 of Cl- released, respectively, which are comparable with the reported growth yields of Dehalobacter species on 1,1,2-TCA (i.e., 1.53 9 1014 cells mol-1 of Cl- released) (Grostern and Edwards 2006a) and Dehalococcoides sp. strain CBDB1 on 2,3-DCP (i.e., 7.6 9 1013 cells mol-1 of Cl- released) (Adrian et al. 2007). A doubling time of 9.6 h was estimated from the linear portion of a semilogarithmic plot of the qPCR growth curves during 2,4,6-TCP-dechlorination. No increase in Dehalobacter rpoB gene copy number was observed with cultures grown under the same conditions without TCE or 2,4,6-TCP amendment. Among the potential electron acceptors tested, PCE also supported the growth of strain TCP1 to produce cis-DCE/trans-DCE at a ratio of *5.6:1 (data not shown). PCE, TCE, and 2,4,6-TCP could not be replaced by DCE isomers, vinyl chloride, 1,1-dichloroethane, 1,2-dichloroethane, pentachlorophenol, Aroclor 1260, PBDEs, sulfate, sulfite, nitrate, and nitrite. Strain TCP1 was not fermentative as it is incapable of utilizing fumarate, malate, lactate, pyruvate, glucose, or glutamate. No dechlorination occurred with cultures lacking the electron donor hydrogen or the carbon source acetate, suggesting that strain TCP1 depends strictly on the energy from reductive dechlorination of PCE/TCE/2,4,6-TCP. The putative chlorophenol reductive dehalogenase (rdh) gene in strain TCP1 The previously reported rdh gene-targeting degenerate primers (i.e., RRF2/RD7r, ceRD2Sf/RD7r and

123

ceRD2Lf/RD7r shown in Table 1) were utilized to pull out putative chlorophenol rdh gene(s) in strain TCP1 by targeting its genomic DNA. However, no positive PCR products were observed (data not shown). Therefore, a new set of degenerate primers—DebfrdhF/DebfrdhR (Table 1)—was designed based on known rdh gene sequences found in Dehalobacter or Desulfitobacterium, which generated *1,100 bp PCR amplicons as expected by targeting the genomic DNA of strain TCP1. The clone library constructed with the PCR products generated only one rdh gene homologue (i.e. debcprA) which shares 63 % similarity at amino acid level with the o-chlorophenol rdh gene sequence (AAL84925) of Desulfitobacterium chlororespirans (Fig. S5). This suggests that the debcprA gene of strain TCP1 is responsible for 2,4,6TCP dechlorination. To further confirm the above, the transcription of debcprA was indicated by observing the expression of RNA extracted from both active 2,4,6-TCP and TCE dechlorinating cultures. The culture was firstly starved for 72 h and then amended with either 2,4,6-TCP or TCE. The transcription product of debcprA was only observed in the TCP1 culture showing 2,4,6-TCP dechlorination (lane 2 in Fig. 4) and was absent in TCP1 culture showing active TCE dechlorination (lane 3 in Fig. 4). The 16S rRNA genes from both cultures were used as loading controls (lanes 5 and 6 in Fig. 4) to show that the rRNA in purified RNA samples was in similar amount in both cultures.

Discussion To date, Dehalobacter species in both pure and mixed cultures have been reported to be able to dechlorinate diverse halogenated compounds, such as PCE/TCE (Wild et al. 1997; Holliger et al. 1998), 1,1,1-TCA (Sun et al. 2002; Grostern and Edwards 2006b), 1,1,2TCA (Grostern and Edwards 2006a), 1,1-DCA (Grostern and Edwards 2006b), 1,2-DCA (Grostern and Edwards 2006a), chloroform (Grostern et al. 2010), beta-hexachlorocyclohexane (van Doesburg et al. 2005), PBDEs (Robrock et al. 2008), chlorobenzenes (Nelson et al. 2011), and 4,5,6,7-tetrachlorophthalide (Yoshida et al. 2009). However, only three Dehalobacter strains (i.e., strains PER-K23, TEA, and TCA1) have been isolated and characterized, and each of them is only known to dechlorinate a narrow substrate range

Biodegradation (2014) 25:313–323

Ladder

1

2

3

321

4

5

6

7

212bp

60bp

Fig. 4 Transcription of debcprA during dechlorination of 2,4,6-TCP. Lane 1–4 are the RT-PCR results using debcprAspecific primers (debcprAF/debcprAR). Lane 5–7 are the RTPCR results using Dehalobacter genus-specific 16S rRNA gene targeted primers (Deb433F/Dre645R) as positive controls for extracting total RNA from 2,4,6-TCP- and TCE-dechlorinating cultures. Lane 1, Dehalobacter sp. strainTCP1 genomic DNA as the PCR template; Lanes 2 and 5, cDNA of 2,4,6-TCP dechlorinating culture as templates; Lanes 3 and 6, cDNA of TCE dechlorinating culture as templates; Lanes 4 and 7, PCR water control

(Table 2). In this study, a novel Dehalobacter species strain TCP1 has been isolated from a digester sludge sample, which is physiologically and phylogenetically different from other characterized Dehalobacter species (Table 2). For example, Dehalobacter sp. strain TCP1 is the first Dehalobacter bacteria to display the ability to couple its growth with the reductive dechlorination of 2,4,6-TCP, which is a promising candidate for 2,4,6-TCP bioremediation. Additionally, strain TCP1 is different from previously reported Dehalobacter species as it is able to generate transDCE from PCE/TCE dechlorination (Table 2) (Wild et al. 1997; Holliger et al. 1998). Previous studies demonstrate that all bacteria capable of producing significant amounts of trans-DCE belong to the Chloroflexi phylum, e.g., Dehalococcoides sp. strain MB (Cheng and He 2009), Dehalobium chlorocoercia DF-1 (Miller et al. 2005), and other Dehalococcoides

species in mixed cultures (Griffin et al. 2004; Kittelmann and Friedrich 2008). Strain TCP1 possesses a strict metabolism in utilizing H2 as the electron donor and halogenated compounds (i.e., 2,4,6-TCP, PCE and TCE) as electron acceptors. Insertion of short sequences or intervening sequences (IVS) has been reported to be widespread in the 16S rRNA genes of prokaryotes (e.g., Thermoanaerobacter and Desulfitobacterium) that normally have multiple 16S rRNA genes (Pei et al. 2010). Similar inserts were also found in 16S rRNA genes of Dehalobacter sp. strain CF and strain DCA (Tang et al. 2012) and uncharacterized Dehalobacter bacteria in chlorobenzene-utilizing cultures (von Wintzingerode et al. 1999; Nelson et al. 2011). In this study, the rpoB gene was shown to be an appropriate targeting gene to confirm the culture purity and to quantify the cell growth of Dehalobacter bacteria. Recently, Rupakula and colleagues employed rpoB gene as a reference biomarker to quantify the rdhA gene expression in Dehalobacter restrictus strain PER-K23 (Rupakula et al. 2013). Previously, 16S rRNA gene-based molecular tools (e.g., clone library and DGGE) have been widely employed to monitor the enrichment and isolation of dechlorinating bacteria (Ding and He 2012). However, this may not be applicable to the bacteria (e.g., Dehalobacter and Desulfitobacterium) with multiple 16S rRNA genes due to their sequence heterogeneity. The 16S rRNA gene-based analysis has limitations in characterizing the diversity of Dehalobacter species/ strains present in samples due to the 16S rRNA gene intraspecies heterogeneity (Dahllo¨f et al. 2000). For example, Dehalobacter bacteria were enriched in a 1,2-dichlorobenzene (1,2-DCB) dechlorinating culture, and their relative abundance account for 97 % (80 of 82 clones) of total microbial community assessed by a 16S rRNA gene clone library (Nelson et al. 2011). However, multiple Dehalobacter species may coexist in this culture, and their further isolation was hindered due to limitations in discriminating and monitoring them at species/strain level when using 16S rRNA genes as targeting biomarkers. Compared to the 16S rRNA gene assays, the single copy rpoB gene-based analysis is able to differentiate the coexisting Dehalobacter strains as shown in this study. Although sequence information of Dehalobacter rpoB genes is still limited, degenerate primers can be designed to target the conserved sites of rpoB gene

123

322

sequences from other bacterial genera in the same order/family. The same strategy can also be utilized to characterize other dechlorinating bacteria with multiple 16S rRNA genes. Overall, a novel Dehalobacter species strain TCP1 was isolated for 2,4,6-TCP and PCE/TCE dechlorination, of which a putative chlorophenol rdh gene was identified to remove ortho-chlorines from 2,4,6-TCP. The culture purity and cell growth were assessed by using rpoB gene-based molecular tools (i.e., degenerate primers, DGGE and qPCR) which could be useful for characterizing other Dehalobacter species pertaining to their population diversity, culture purity and cell growth rate. Acknowledgments This study was supported by Singapore Agency for Science, Technology and Research (A*STAR) of the Science and Engineering Research Council under Project No: 102 101 0025.

References Adrian L, Hansen SK, Fung JM, Go¨risch H, Zinder SH (2007) Growth of Dehalococcoides strains with chlorophenols as electron acceptors. Environ Sci Technol 41:2318–2323 Agency for Toxic Substances and Disease Registry (ATSDR) (1990) Toxicological profile for 2,4,6-trichlorophenol. U.S. Public Health Service, U.S. Department of Health and Human Services, Atlanta, GA Bouchard B, Beaudet R, Villemur R, McSween G, Lepine F, Bisaillon JG (1996) Isolation and characterization of Desulfitobacterium frappieri, sp. nov., an anaerobic bacterium which reductively dechlorinates pentachlorophenol to 3-chlorophenol. Int J Syst Bacteriol 46:1010–1015 Case RJ, Boucher Y, Dahllo¨f I, Holmstro¨m C, Doolittle WF, Kjelleberg S (2007) Use of 16S rRNA and rpoB genes as molecular markers for microbial ecology studies. Appl Environ Microbiol 73:278–288 Cheng D, He J (2009) Isolation and characterization of ‘‘Dehalococcoides’’ sp. strain MB, which dechlorinates tetrachloroethene to trans-1,2-dichloroethene. Appl Environ Microbiol 75:5910–5918 Chow WL, Cheng D, Wang S, He J (2010) Identification and transcriptional analysis of trans-DCE-producing reductive dehalogenases in Dehalococcoides species. ISME J 4:1020–1030 Dahllo¨f I, Baillie H, Kjelleberg S (2000) rpoB-based microbial community analysis avoids limitations inherent in 16S rRNA gene intraspecies heterogeneity. Appl Environ Microbiol 66:3376–3380 Ding C, He J (2012) Molecular techniques in the biotechnological fight against halogenated compounds in anoxic environments. Microb Biotechnol 5:347–367

123

Biodegradation (2014) 25:313–323 Griffin BM, Tiedje JM, Lo¨ffler FE (2004) Anaerobic microbial reductive dechlorination of tetrachloroethene to predominately trans-1,2-dichloroethene. Environ Sci Technol 38:4300–4303 Grostern A, Edwards EA (2006a) Growth of Dehalobacter and Dehalococcoides spp. during degradation of chlorinated ethanes. Appl Environ Microbiol 72:428–436 Grostern A, Edwards EA (2006b) 1,1,1-Trichloroethanedegrading anaerobic mixed microbial culture enhances biotransformation of mixtures of chlorinated ethenes and ethanes. Appl Environ Microbiol 72:7849–7856 Grostern A, Edwards EA (2009) Characterization of a Dehalobacter coculture that dechlorinates 1,2-dichloroethane to ethene and identification of the putative reductive dehalogenase gene. Appl Environ Microbiol 75:2684–2693 Grostern A, Duhamel M, Dworatzek S, Edwards EA (2010) Chloroform respiration to dichloromethane by a Dehalobacter population. Environ Microbiol 12:1053–1060 Ha¨ggblom M (1990) Mechanisms of bacterial degradation and transformation of chlorinated monoaromatic compounds. J Basic Microbiol 30:115–141 He J, Holmes VF, Lee PKH, Alvarez-Cohen L (2007) Influence of vitamin B12 and cocultures on the growth of Dehalococcoides isolates in defined medium. Appl Environ Microbiol 73:2847–2853 Holliger C, Hahn D, Harmsen H, Ludwig W, Schumacher W, Tindall B, Vazquez F, Weiss N, Zehnder AJ (1998) Dehalobacter restrictus gen. nov. and sp. nov., a strictly anaerobic bacterium that reductively dechlorinates tetraand trichloroethene in an anaerobic respiration. Arch Microbiol 169:313–321 Holmes VF, He J, Lee PKH, Alvarez-Cohen L (2006) Discrimination of multiple Dehalococcoides strains in a trichloroethene enrichment by quantification of their reductive dehalogenase genes. Appl Environ Microbiol 72:5877–5883 Ho¨lscher T, Krajmalnik-Brown R, Ritalahti KM, von Wintzingerode F, Go¨risch H, Lo¨ffler FE, Adrian L (2004) Multiple nonidentical reductive-dehalogenase-homologous genes are common in Dehalococcoides. Appl Environ Microbiol 70:5290–5297 Kittelmann S, Friedrich MW (2008) Novel uncultured Chloroflexi dechlorinate perchloroethene to trans-dichloroethene in tidal flat sediments. Environ Microbiol 10:1557–1570 Krajmalnik-Brown R, Ho¨lscher T, Thomson IN, Saunders FM, Ritalahti KM, Lo¨ffler FE (2004) Genetic identification of a putative vinyl chloride reductase in Dehalococcoides sp. strain BAV1. Appl Environ Microbiol 70:6347–6351 Lee LK, He J (2010) Reductive debromination of polybrominated diphenyl ethers by anaerobic bacteria from soils and sediments. Appl Environ Microbiol 76:794–802 Miller GS, Milliken CE, Sowers KR, May HD (2005) Reductive dechlorination of tetrachloroethene to trans-dichloroethene and cis-dichloroethene by PCB-dechlorinating bacterium DF-1. Environ Sci Technol 39:2631–2635 Muyzer G, De Waal EC, Uitterlinden AG (1993) Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reactionamplified genes coding for 16S rRNA. Appl Environ Microbiol 59:695–700

Biodegradation (2014) 25:313–323 Nelson JL, Fung JM, Cadillo-Quiroz H, Cheng X, Zinder SH (2011) A role for Dehalobacter spp. in the reductive dehalogenation of dichlorobenzenes and monochlorobenzene. Environ Sci Technol 45:6806–6813 Ovreas L, Forney L, Daae FL, Torsvik V (1997) Distribution of bacterioplankton in meromictic Lake Saelenvannet, as determined by denaturing gradient gel electrophoresis of PCR-amplified gene fragments coding for 16S rRNA. Appl Environ Microbiol 63:3367–3373 Paster BJ, Falkler WA Jr, Enwonwu CO, Idigbe EO, Savage KO, Levanos VA, Tamer MA, Ericson RL, Lau CN, Dewhirst FE (2002) Prevalent bacterial species and novel phylotypes in advanced Noma Lesions. J Clin Microbiol 40:2187–2191 Pei AY, Oberdorf WE, Nossa CW, Agarwal A, Chokshi P, Gerz EA, Jin Z, Lee P, Yang L, Poles M, Brown SM, Sotero S, Desantis T, Brodie E, Nelson K, Pei Z (2010) Diversity of 16S rRNA genes within individual prokaryotic genomes. Appl Environ Microbiol 76:3886–3897 Regeard C, Maillard J, Holliger C (2004) Development of degenerate and specific PCR primers for the detection and isolation of known and putative chloroethene reductive dehalogenase genes. J Microbiol Methods 56:107–118 Reysenbach AL, Wickham GS, Pace NR (1994) Phylogenetic analysis of the hyperthermophilic pink filament community in Octopus Spring, Yellowstone National Park. Appl Environ Microbiol 60:2113–2119 Robrock K, Koryta´r P, Alvarez-Cohen L (2008) Pathways for the anaerobic microbial debromination of polybrominated diphenyl ethers. Environ Sci Technol 42:2845–2852 Rupakula A, Kruse T, Boeren S, Holliger C, Smidt H, Maillard J (2013) The restricted metabolism of the obligate organohalide respiring bacterium Dehalobacter restrictus: lessons from tiered functional genomics. Philos Trans R Soc Lond B Biol Sci 368:20120325 Sun B, Griffin BM, Ayala-del-Rı´o HL, Hashsham SA, Tiedje JM (2002) Microbial dehalorespiration with 1,1,1-trichloroethane. Science 298:1023–1025

323 Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 24:1596–1599 Tang S, Gong Y, Edwards EA (2012) Semi-automatic in silico gap closure enabled de novo assembly of two Dehalobacter genomes from metagenomic data. PLoS ONE 7:e52038 U.S. EPA (1984) Health effects assessment for 2,4,6-trichlorophenol. U.S. Environmental Protection Agency, Washington, D.C., EPA/540/1-86/047 (NTIS PB86134582) van Doesburg W, van Eekert MH, Middeldorp PJ, Balk M, Schraa G, Stams AJ (2005) Reductive dechlorination of beta-hexachlorocyclohexane (beta-HCH) by a Dehalobacter species in coculture with a Sedimentibacter sp. FEMS Microbiol Ecol 54:87–95 Villemur R, Lanthier M, Beaudet R, Le´pine F (2006) The Desulfitobacterium genus. FEMS Microbiol Rev 30:706–733 von Wintzingerode F, Selent B, Hegemann W, Gobel UB (1999) Phylogenetic analysis of an anaerobic, trichlorobenzenetransforming microbial consortium. Appl Environ Microbiol 65:283–286 Wang S, He J (2011) Separation of fluorescence-labelled terminal restriction fragment DNA on a two-dimensional gel (T-RFs-2D)—an efficient approach for microbial consortium characterization. Environ Microbiol 13:2565–2575 Wang S, He J (2013) Phylogenetically distinct bacteria involve extensive dechlorination of Aroclor 1260 in sediment-free cultures. PLoS ONE 8:e59178 Wild A, Hermann R, Leisinger T (1997) Isolation of an anaerobic bacterium which reductively dechlorinates tetrachloroethene and trichloroethene. Biodegradation 7:507–511 Wolin EA, Wolin MJ, Wolfe RS (1963) Formation of methane by bacterial extracts. J Biol Chem 238:2882–2886 Yoshida N, Ye L, Baba D, Katayama A (2009) A novel Dehalobacter species is involved in extensive 4,5,6,7-tetrachlorophthalide dechlorination. Appl Environ Microbiol 75:2400–2405

123

Suggest Documents