Isolation and Characterization of Bacillus sp. with

1 downloads 0 Views 1MB Size Report
One of the most acceptable and environmentally ... organic production of tomato is now being considered. .... phosphorus and potassium (NPK) analysis of plant.

Indian J Agric Biochem 27 (2), 193-201, 2014

Isolation and Characterization of Bacillus sp. with Their Effect on Growth of Tomato Seedlings ANJALI CHAUHAN, SHIWANI GULERIA, ABHISHEK WALIA1, RISHI MAHAJAN, SEEMA VERMA and CK SHIRKOT* Department of Basic Science, Dr YS Parmar University of Horticulture and Forestry, Nauni, Solan-173230, HP, India 1 DNA Unit (Biology Division), Forensic Science Laboratory, Rohini, Sector-14, New Delhi, India

Downloaded From IP - 165.123.34.86 on dated 14-May-2015

www.IndianJournals.com

Members Copy, Not for Commercial Sale

The use of plant growth-promoting rhizobacteria (PGPR) is steadily increasing in agriculture and offers an attractive way to replace chemical fertilizers, pesticides, and supplements. In search of efficient PGPR with multifarious traits, thirty bacterial strains were isolated from tomato rhizosphere of District Solan, Himachal Pradesh using modified replica plating technique. The isolates were screened in vitro for their plant growth promoting (PGP) activities. Five isolates, with a score greater than sixty per cent, exhibiting multiple activities, were evaluated quantitatively for PGP traits. All the five isolates with multifarious PGP activities were selected for net house studies. Among them, three isolates i.e. CKT1, CKT4 and CKT5 showed growth promotional effects and other two isolates i.e CKT2 and CKT3 were found to have detrimental effects on plant growth. Phylogenetic analysis has confirmed that five isolates though showing simil arity to Bacillus subtilis yet were clustered as two different groups, thus highlighting their strain level differences. Multip le regression analysis, carried out to estimate the overall impact of PGP activities (Phosphate solubilization, Indole acidic acid and siderophore production) on morphological characters viz. root length and dry weight, shoot length and dry weight was resulted in highly significant r 2 values. Key words: Plant growth promoting rhizobacteria, 16S rDNA sequence, Bacillus sp., endophytes, tomato (Solanum lycopersicum L.)

Tomato (Solanum lycopersicum L.) is most remunerative cash crop of mid hills of Himachal Pradesh being grown as an important off-season vegetable for fresh market supply to the plains of northern India. For production to keep pace with the growing global population, the use of chemical fertilizers will continue in regards to its nutrient requirements. Moreover, in order to palliate sudden pathogen attacks, large amounts of chemicals are used. For environmentally safe agricultural practices, sustainable alternatives need to be developed which aim at management techniques that are designed and implemented against the chemical pollutants being used in the agricultural sector. One of the most acceptable and environmentally conscious approaches to solve these problems is the use of naturally occurring microbial inoculants. Use of rhizosphere-associated microorganisms as biofertilizers derived from indigenous plant growth promoting rhizobacteria (PGPR) for use in organic production of tomato is now being considered. To increase the crop yield so as to meet the appetite of world population without drastically hurting the environment, a visionary new approach is required. Combining biofertilizer technology with the conventional

fertilizer can help to grow crops in a sustainable way. Soil bacteria living in the rhizosphere can enhance a plant growth by several mechanisms like solubilization of phosphates (1), production of phytohormones (2), siderophores production (3-4), antibiotic production (5), inhibition of plant ethylene synthesis (6) and induction of plant systemic resistance to pathogens. Therefore, several organisms such as Cyanobacteria, Azolla, Bacillus, Pseudomonas, Rhizobium, endophytic diazotrophs and P-solubilizing microorganisms are presently being used as biofertilizers (7). The potential of P-solubilizing Bacillus circulans MTCC 8983 for simultaneous synthesis of IAA and release of pathogen suppressing metabolites has been reported from our laboratory (8). Asymbiotic nitrogen fixing bacteria are known to replace 60% of the nitrogen requirements of sugarcane amounting to 200 kg N/ha (9). Azospirillium spp. are commonly isolated bacteria from the rhizosphere of various grasses and cereals, and are well characterized as plant growth promoting rhizobacteria (10). Bacillus spp. has been found to be effective in increasing the yield of wheat to 43% (11) and also for other crops (12).

*Author for correspondence : Email : [email protected]

Plant growth promoting bacterial strains must be rhizosphere competent, able to survive and colonize (13).

Downloaded From IP - 165.123.34.86 on dated 14-May-2015

www.IndianJournals.com

Members Copy, Not for Commercial Sale

194

Indian J Agric Biochem 27(2), 2014

The interaction between associative PGPR and plants can be unstable. Therefore, the PGPR showing good results in in vitro cannot always be dependently reproduced under field conditions (14). In order to achieve the maximum interaction between PGPR and nursery seedlings it is important to know how the rhizobacteria exerts effects on plants and whether the effects are altered by environmental factors or due to microorganisms. Hence, it is necessary to explore soil microbial diversity for PGPR having combination of PGP activities. Therefore, keeping in view of the above constraints, the present communication, we discuss in the phylogenetic variability among the Bacillus subtilis strains in relation to their effect on growth of tomato seedlings. Moreover emphasis was made on isolation of bacterial strains with multifarious PGP traits that can be used for growth promotion of tomato seedlings. These isolates used in the present study have been preserved in 30% glycerol and kept for future use at -20ºC in Microbiology laboratory, Department of Basic Sciences, UHF, Nauni, Solan, Himachal Pradesh.

Materials and Methods Origin of bacteria: Seventy tomato seedlings randomly selected were uprooted in the month of March and April from seven sites (Dharja, Tickri, Kandaghat, Chail, Shogi, Nauni, Nando and Kufri) falling in the mid-hill region of Himachal Pradesh. Soil intimately adhering to roots and the thinner roots (diameter 1-2 mm) of each plant were brought to the lab in plastic bags at 4°C. Replica plating technique (15) was used to isolate PGPR with multiple PGP activities. Briefly, the technique involved, spreading of 100 µl of serially diluted suspension of 1 gm soil/ roots on enriched soil extract medium. The isolated colonies that were developed on the enriched medium (master plate) were replica plated onto the selective media, nitrogen free medium for N 2 -fixing ability, Pikovskaya medium (16) for P-solubilizing ability and chrome azurol S medium (17) for siderophore production. At the end of incubation period, the colonies that appeared on selective media plate were compared to that on master plate and characterized morphologically. In vitro screening of bacterial isolates for plant growth promoting activities: All isolates were screened for

phosphate solubilization (18), IAA production (19), nitrogen fixing ability (growth on nitrogen free medium), HCN production (20), siderophore production (17) and antifungal activity (21) against four fungi (Fusarium oxysporum, Rhizoctonia solani, Sclerotinia sclerotiorum and Alternaria spp). Based on the ability of the bacterial isolates to exhibit multifarious plant growth promoting (PGP) traits, they were ranked on the basis of score that each bacterial isolate achieved. A hypothetical bacterial isolate with maximum multifarious PGP traits was considered to have achieved a score of 26 points i.e.100%. Comparison of all other isolates with this hypothetical isolate helped in computing the per cent score accomplished by each isolate. Growth promotion assay: The biological effect of five selected strains based on their in vitro measured capacities on the growth of Solanum lycopersicum L. seedlings was determined. For this purpose, surface sterilized seeds of tomato, variety Him Sona, were soaked in culture suspensions of individual cultures 48 h old (108 cfu/ml). Effect of bacterial cultures on the growth of tomato seedlings was tested by growing seedlings in an axenic culture using sterilized vermiculite moistened with Hoagland’s nutrient solution. The vermiculite was autoclaved at 121ºC, 1.5 kg cm-2 pressure for 30 minutes thrice, on alternate days in heat resistant polypropylene bags plugged with non-absorbent cotton. Ten seeds (sterilized, treated or untreated), were sown at equidistance and at a uniform depth in sterilized vermiculite moistened with Hoagland’s nutrient solution. After 3-4 days of seedling emergence, thinning was done and 3 plants per cup were maintained. Nine replicate cups per treatment with 3 plants in each cup were placed in randomized block design in the plant growth chamber. Plant growth response was observed for 30 days after sowing in plant growth chamber (25/20ºC, 14/10 h. light/ dark, 75% humidity). Subsequently evaluation of plant growth study was also carried out under net house conditions. Soil obtained from a depth of 0-20 cm from a fallow area in forest block of the Department of Silviculture and Agro forestry, UHF, Solan was sieved through 2 mm sieve and used for pot culture experiment. The sand, soil and farm yard manure (FYM) was mixed in a ratio of 1:1:1 in order to make the potting mixture. The mixture

Downloaded From IP - 165.123.34.86 on dated 14-May-2015

www.IndianJournals.com

Members Copy, Not for Commercial Sale

Isolation & Characterization of Bacillus sp. with Their Effect on Tomato

was then filled in the pots and moistened to one third saturation capacity. Seeds were sown in pots containing potting mixture. Twenty-five seeds treated or untreated with cell suspension of 1.5 O.D (108 cfu/mL) of each single culture were sown at equidistance and covered with moss grass till emergence of plumule. After 3-4 days of seedlings emergence thinning was done and three plants per pot were maintained. Six replicate pots per treatment, with 3 plants in each pot were placed in a randomized block design in net house. Tomato seedlings obtained from plant growth chamber, net house and in nurseries under field conditions were analyzed for shoot and root characteristics, root-shoot ratio, and nitrogen, phosphorus and potassium (NPK) analysis of plant biomass. The controls were designed in the same way but in this case, the tomato seeds were mock-inoculated with sterilized water. Biochemical and molecular identification of selected bacterial isolates: Those strains that demonstrated a positive effect on plant growth were identified based biochemical test and molecular identification of strains was done by 16S rDNA sequencing and phylogenetic analysis. Biochemical identification of the selected bacterial isolates was done based on their colony morphology, microscopic observations, and biochemical tests (22). Colony morphology and cell morphology was observed on nutrient agar medium and nutrient broth, respectively. The biochemical characterization of the isolates was done by using Indole test, Methyl red test, Citrate utilization, Starch hydrolysis, Casein hydrolysis, Gelatin hydrolysis, Hydrogen sulphide production, Catalase test, Voges Proskauer test, Urea hydrolysis and Fermentation of carbohydrates (Glucose). PCR amplification of bacterial 16S rDNA, sequencing and phylogenetic analysis: Each bacterial strain was amplified with 16S rDNA primers designed from Bacillus spp. For this purpose, GeneBank available sequences of 16S rDNA reported from different parts of the world were downloaded from the NCBI data base (web site: http://www.ncbi.nlm.nih.gov). These sequences were then aligned with MULTIALIN program (web site: http:// prodes.toulouse.inra.fr/multialin/multialin.html) based on algorithm as reported by Corpet (23). Based on the

195

conserved regions in the aligned sequences the primers (25 mer F 5’GCAAGTCGAGCGGACAGATGGGAGC3’ and 25 mer R 5’AACTCTCGTGGTGTGACGGGCGGTG 3’) were designed keeping in mind the average GC content and the annealing temperature of the primer pairs. The designed primers were synthesized from Sigma Aldrich. DNA was isolated from selected bacterial isolates by growing them at 37ºC in nutrient broth at 200 rpm. The cells were harvested and processed for DNA isolation. Genomic DNA was isolated using total DNA isolation kit (Real genomic DNA extraction kit as per manufacturer’s instructions. The isolated DNA was finally suspended in 100 µl of elution buffer and quantified on 1% agarose gel. PCR reaction was carried out in 20 µl reaction containing ~50ng of template DNA, 20 picomoles of each primers, 0.2 mM dNTPs and 1 U Taq polymerase (MP Biomedical, USA) in 1x PCR buffer. Reaction were cycled 35 times at 94ºC for 30 s, 58ºC for 30 s, 72ºC for 90 s followed by final extension at 72ºC for 10 min. The PCR products were analyzed on 1% agarose gel. The amplified PCR products were eluted from the gel using gel extraction kit (Real genomic gel Hi yieldTM Gel/PCR). The eluted fragment was sequenced using automated DNA sequencing system. The 16S rDNA sequence of the isolates (CKT1, CKT2, CKT3, CKT4 and CKT5) were compared with same phylogenetic groups obtained from the GenBank database and from a BLAST search of the National Centre for Biotechnology Information (NCBI) (24). Multiple alignments were generated by the MULTALIN program (23). The Phylogenetic tree was constructed based on neighborjoining method with the help of ClustalW (25).

Results and Discussion Isolation of plant growth promoting bacteria: In the present study, the task of transferring several hundred colonies to test isolates with multiple functions is simplified by the use of a one step replica plating technique. The most predominant rhizobacteria were initially isolated and enumerated on enriched soil extract medium that supported the growth of many soil microorganisms. After determining the location of colonies with multiple activities on replica plates with selective media and comparing with master plate, the organisms

196

Indian J Agric Biochem 27(2), 2014

Downloaded From IP - 165.123.34.86 on dated 14-May-2015

www.IndianJournals.com

Members Copy, Not for Commercial Sale

with multiple plant growth promoting activities were isolated (Thirty bacterial isolates in total; twenty three from rhizosphere; and seven from endorhizosphere of tomato). The advantage of this method is that it enables the selection of biocontrol PGPR that promote plant growth directly (biofertilizers) as well as indirectly (biopesticides). On the contrary, the conventional procedures employed for isolation and screening of PGPR strains for multiple plant growth promoting activity are both time consuming and limited in that they only select, bacteria for one type of biological trait and this entail isolating a large number of bacterial strains (often hundreds or even thousands) from rhizosphere soil/roots.

phosphates, thereby facilitating plant growth (27). The phosphate solubilizing microorganisms (PSM) render insoluble phosphate into available forms by the process of acidification, chelation, and exchange reaction (28). Results in the present study, indicates towards a significant P- solubilization by all the isolates, accompanied by a significant decrease in pH of the medium from neutral to acidic after 72 h of incubation (data not shown). The decrease in pH clearly indicates the production of acids, which is considered to be responsible for P-solubilization (29).

Screening of bacteria for multifarious plant growth promoting traits: During the initial screening process using replica plating techniques, all the thirty bacterial isolates showed variation in their ability for different plant growth promoting activities and thus, were ranked accordingly (Table 1). Most of the isolates exhibited two or more than two common traits. However, bacterial isolates CKT1, CKT2, CKT3, CKT4 and CKT5 exhibited higher levels of multifarious plant growth promoting activities (evident from their high score, >60%, Table 1) in comparison to other isolates and hence, were selected for further studies and of these five isolates, CKT1, CKT2 and CKT3 were endophytic whereas, CKT4 and CKT5 were rhizospheric in origin. These five bacterial isolates were further evaluated, quantitatively for production of plant growth promoting activities, before their application in growth chamber and net house conditions (Fig. 1). In the present study, maximum Psolubilization (210.0 µg/ml) was observed with isolate CKT3 which was significantly higher than the other isolates. P- solubilization by all the isolates was accompanied by a significant decrease in pH of the medium from neutral to 4.66 after 72 h of incubation (data not shown). Thereafter, the pH of the medium remained stable. P-solubilization ability of the microorganisms is considered to be one of the most important traits associated with plant P-nutrition (26). Low levels of soluble phosphate can limit the growth of plants. Some plant-growth promoting bacteria solubilize phosphate from either organic or inorganic bound

Fig. 1: Quantitative estimation of plant growth promoting traits exhibited by rhizobacterial isolates

Isolate, CKT1 produced a significantly higher concentration of IAA (30.27 µg/ml) and siderophore (40.00%SU) along with HCN after 72 hour of incubation. Maximum siderophore produced by isolate CKT1 was observed to be statistically at par with that of isolate CKT4 (38.75%SU). However, similar trend was not observed for IAA production in case of isolate CKT4, which exhibited a significantly lower production of IAA (1.17 µg/ml). All the bacterial isolates exhibited variation in their inhibition towards different fungal pathogens used in the study. Isolate CKT3 showed maximum growth of inhibition (83.72%) against Fusarium oxysporum, whereas it was isolate CKT1 which showed maximum growth of inhibition (79.07%) against Rhizoctonia solani and (73.50%) against Alternaria spp. Isolates CKT2 and CKT4 showed maximum growth of inhibition (73.26%) against S. sclerotiorum which was found to be statistically at par to each other.

197

Isolation & Characterization of Bacillus sp. with Their Effect on Tomato Table 1: Screening of selected bacterial isolates for multifarious plant growth promoting activities by spot plate assay

Downloaded From IP - 165.123.34.86 on dated 14-May-2015

www.IndianJournals.com

Members Copy, Not for Commercial Sale

Isolates

@

Phosphate Growth on Antifungal activity against fungal pathogens Siderophore IAA ? ? Solubilization** nitrogen F. R. S. Alternaria production production free oxysporum solani sclerotiorum spp. ¥ medium CKT1* +++ +++ ++ ++ +++ +++ ++ ++++ CKT2* +++ ++ ++ ++ + ++ +++ +++ CKT3* ++ + ++ +++ ++ + +++ +++ CKT4 +++ ++ +++ +++ +++ ++ +++ + CKT5 ++ ++ +++ ++ ++ ++ +++ ++ CKT6* ++ ++ + + + ++ ++ ++ CKT7 + + + ++ ++ + CKT8 + + + + + + ++ CKT9 + + ++ ++ + ++ CKT10 + + + + ++ ++ + CKT11 + ++ ++ ++ +++ ++ + CKT12 + + + ++ + ++ + CKT13 + + + ++ +++ ++ ++ ++ CKT14 + + ++ ++ ++ ++ ++ + CKT15 ++ ++ ++ ++ + ++ ++ ++ CKT16 + ++ ++ + ++ ++ ++ CKT17 + ++ ++ + +++ ++ + CKT18 + ++ ++ ++ +++ + + CKT19 + ++ ++ ++ ++ ++ + CKT20 + ++ ++ + +++ + + CKT21 + + ++ ++ ++ + ++ CKT22 + ++ ++ ++ +++ ++ + CKT23 + ++ ++ + +++ + CKT24 + ++ ++ +++ + CKT25 + + ++ + +++ ++ + CKT26 + + ++ + ++ ++ ++ CKT27 + ++ + ++ +++ + CKT28* ++ ++ ++ ++ + ++ ++ ++ CKT29* ++ + + + + ++ CKT30* ++ + ++ ++ ++ + ++

HCN @@ production

Score (%)

+ + + + -

88.46 65.38 61.54 73.08 65.38 46.15 26.92 23.08 23.08 26.92 42.31 30.77 50.00 50.00 53.85 38.46 38.46 38.46 42.31 34.62 34.62 42.31 26.92 19.23 30.77 34.62 26.92 53.85 26.92 38.46

* Endophytic **P-solubilization in vitro: + :: 5 wide halo zone ¥

Growth on nitrogen free medium: + ::< 3 mm colony dia; ++:: 3-6 mm colony dia; +++ :: >6 mm colony dia

@

Antibiosis by agar streak assay: + :: < 50 % inhibition; ++:: 50-70 % inhibition; +++:: >70 % inhibition

?

IAA production: + :: 20-30µg/ml; ++++::>30µg/ml

?

Siderophore activity: +:: 10 mm yellowish orange zone

@@

HCN production: +:: Colour change; -

Growth promotion assay: Significantly higher levels of P-solubilization, IAA production (a growth promoting hormone), siderophore (iron-chelating compound) production, HCN production and antagonism towards fungal pathogens, unequivocally underline the importance of these microbes in direct plant growth promotion (as bio-fertilizers and bio-stimulants) and indirect plant growth promotion (as bio-protectants) (30, 31). Plant growth response to seed treatment with liquid culture on tomato seedlings was studied in growth

attributes was observed. Graphical representation of data (Fig. 2) reveals a significantly higher NPK content of whole shoot system in bacterial inoculated tomato seedlings as compared to un-inoculated seedlings. The shoot analysis of phosphorus and potassium revealed a significantly higher level of per cent phosphorus (0.44%) and per cent potassium (2.87%) content in seedlings inoculated with CKT1 bacterial isolate as compared to untreated. However, maximum per cent nitrogen (0.72%) content was observed for tomato seedlings inoculated

chamber under axenic conditions. Ten seedlings (one month old) from each treatment, selected at random were uprooted and the effect on various shoot and root

with isolate CKT3. Graphical representation of the data (Fig. 3) reveals that the inoculation of isolate CKT1 resulted in maximum per cent increase in shoot length

198

Indian J Agric Biochem 27(2), 2014

Downloaded From IP - 165.123.34.86 on dated 14-May-2015

www.IndianJournals.com

Members Copy, Not for Commercial Sale

(24.93%), shoot dry weight (74.76%) and root length (107.4%) of tomato seedlings which was significantly higher as compared to other isolates. However, among the four isolates studied, significant decrease in shoot dry weight was observed for isolates CKT2 (-8.66%) and CKT3 (-21.68%). A significant decrease in root dry weight (-7.54%) over uninoculated control was observed only for isolate CKT3. Due to the variability of results in direct plant growth promotion, all the five isolates were further evaluated under net house conditions. Especially, the isolates CKT2 and CKT3 which resulted in significant decrease in shoot and root dry weight, inspite of the fact that isolate CKT3 resulted in maximum P-solubilization and appreciable siderophore and IAA production in comparision to other isolates. These results, envisage the need to test maximum bacterial isolates under net house and field conditions. Thus, in the present study all the five isolates are further evaluated under net house conditions.

weight (57.02%) which was significantly higher than the other isolates. However, a significant decrease in shoot length (-5.36%) was observed in case of isolate CKT2 inoculation over uninoculated control. Maximum per cent increase in shoot dry weight (63.50%) was found with CKT1 inoculation which was significantly higher than other isolates. Significant decrease in shoot dry weight (-6.23%) and root dry weight (-8.08%) was observed in case of isolate CKT3 inoculation over uninoculated control. Maximum per cent increase in root length (42.22%) was observed when tomato seeds were inoculated with CKT5.

Fig. 4: Effect on per cent growth promotion of tomato seedlings by inoculation of rhizobacterial isolates under net house conditions

Negative effect on growth, by isolates CKT2 and CKT3 (under both axenic and green house conditions) may be attributed to the production of certain metabolites which Fig. 2: Effect of rhizobacterial isolates inoculation on nutrient uptake by tomato seedlings

are deleterious to the plant health. This highlights the necessity of evaluating maximum number of isolates under net house conditions (32) and if not all, then at least the ones which exhibit plant growth promoting activities above 60% under laboratory conditions. Auxin production is known to stimulate root development, which result in better absorption of water and nutrients

Fig. 3: Effect on per cent growth promotion of tomato seedlings by inoculation of rhizobacterial isolates under axenic conditions

Five seedlings (two months old) from each treatment selected at random were uprooted and the effect on various shoot and root parameters was observed. Data appended in graphical form (Fig. 4) reveal that among five isolates, CKT5 inoculation showed maximum per cent increase in shoot length (49.62%) and root dry

from soil (33). They are quantitatively the most abundant phytohormones secreted by the PGPRs and it is generally agreed that auxin production rather than phosphate solubilization and siderophore production is major factor responsible for the stimulation of root growth. However, in the present study, P-solubilization ability and siderophore production could have also positively influenced the growth of tomato seedlings. Thus, emphasizing on the need to isolate a plant growth promoting rhizobacterium, possessing multifarious plant growth promoting activities.

Downloaded From IP - 165.123.34.86 on dated 14-May-2015

www.IndianJournals.com

Members Copy, Not for Commercial Sale

Isolation & Characterization of Bacillus sp. with Their Effect on Tomato

The shoot analysis of plants revealed that maximum per cent nitrogen (0.72%) content was observed for tomato seedlings inoculated with isolate CKT3. This increase may have been caused by nitrogen fixation and phosphate solubilization ability of PGPR used in this study. Increased nutrient uptake associated with seed treated plants may be the results of more root-shoot ratio resulting in enhanced nutrition because of seed treatment with bacteria. The increased uptake of phosphorus by inoculated tomato plants in the present study suggests that bacterial isolates supply phosphorus in a soluble form. Phosphorus uptake increase significantly (13-23%) in rice when inoculated with plant growth promoting rhizobial isolates (34). In earlier study it has been well demonstrated that phosphate solubilization is an effective mechanism of maize growth promotion and root colonization by the phosphatesolubilizing Rhizobium leguminosarum pv. phaseoli (35).

error and adjusted r2 have been given below:

Relationship between P-solubilization, IAA and per cent

(vi)

199

Regression equations for Growth Chamber studies: (i)

Y1= 442.27 - 1.07X1 - 2.67X2 + 4.41X3 - 14.1X4 (0.076)

(ii)

(0.120)

(0.735)

Adj. r2= 0.98

(0.227)

Y2= 13.87–0.143X1–0.416X2+1.306X3 +0.236X4 (0.007)

(0.012)

(0.071)

Adj. r2= 0.99

(0.22)

Y3= 51.74+0.026X1* -0.291X2+0.950X3-0.294X4

(iii)

(0.026)

(-0.291)

(-0.950)

Adj. r2= 0.94

(0.294)

Regression equations for Net House studies: (iv)

Y1= 202.07 – 3.64X1 – 5.48X2 + 1.63X3 + 5.55X4 (0.163)

(v)

(0.166)

(0.080)

Adj. r2= 0.99

(0.142)

Y2= 20.06 + 1.75X1 – 1.32X2 + 0.943X3 + 0.780X4 (0.04)

(0.04)

(0.02)

(0.35) Adj. r2= 0.99

Y3= 39.98 - 0.87X1 – 1.32X2* + 0.943X3* + 0.780X4

siderophore unit on plant growth promotion under growth chamber and net house conditions

(0.14)

(0.14)

(0.07)

(0.12) Adj. r2= 0.91

*non-significant

To estimate the overall impact of P-solubilization (Y1), IAA (Y 2 ) and per cent siderophore unit (Y 3 ) on morphological characters viz. root length (X1), root dry weight (X2), shoot length (X3) and shoot dry weight (X4) under growth chamber and net house conditions; the

Morphological,

biochemical

and

molecular

characterization: On the basis of the results obtained from preliminary characterization, in vitro screening for plant growth promoting activities in growth chamber and net house studies, all the isolates were tentatively identified as strains of Bacillus spp. based on morphological and biochemical characterization (Table 2) according to Bergey’s Manual of Systemic Bacteriology. The 16S rDNA sequence of CKT1, CKT2, CKT3, CKT4 and CKT5 strains has been deposited in the Genbank database (NCBI) under accession number

data recorded have been subjected to multiple regression analysis. The fitted estimation equations have been presented below. The adjusted r2 values are greater than 0.9 and hence these equations can be regarded as best fit. The variables affecting significantly to P-solubilization, IAA and per cent siderophore unit have been star (*) marked. The fitted regression lines along with standard

Table 2: Identification of selected bacterial isolates based on morphological, biochemical and molecular technique of 16S rDNA sequences

Morphological

-

-

-

-

*Endo-Spore position for all isolates was observed to be Sub-terminal

+ + + + +

-

+ + + + +

+ + + + +

+ + + + +

+ + + + +

GQ379201 GQ390251 GQ980010 GQ980011 GQ980012

Most significant alignment

-

Gene-bank accession number

+ve +ve +ve +ve +ve

Fermentation (Glucose) Urea hydrolysis Voges Proskauer Catalase test

Chains Chains Chains Chains Chains

16S rDNA sequences

H2 S production Gelatin hydrolysis Casein hydrolysis Starch hydrolysis Citrate utilization Methyl red test Indole test

G+ G+ G+ G+ G+

Endo-Spore*

Rods Rods Rods Rods Rods

Arrangement

Gram’s reaction Cell shape

Strain CKT1 CKT2 CKT3 CKT4 CKT5

Biochemical

AB383135Bsubt AB383135Bsubt AB383135Bsubt AB383135Bsubt AB383135Bsubt

200

Indian J Agric Biochem 27(2), 2014

Table 3: Alignment score of isolated rhizobacterial isolates with Bacillus isolates reported from different parts of the world

Downloaded From IP - 165.123.34.86 on dated 14-May-2015

www.IndianJournals.com

Members Copy, Not for Commercial Sale

Bacillus isolates FJ009394Bvalli AB383135Bsubt EU884649Bflex EU869282Bpumi EU879090Bmega EU118756Bsubt EU143680Balka EU869263Bpumi EU869262Bliche EU869261Bmega EU869250Bclau EU733231Bcirc EU373401Bcirc EU855195Bamyl EU855192Bamyl X94194Baneu AB271755Aaneu

Isolated rhizobacterial isolates CKT1 CKT2 CKT3 CKT4 CKT5 99 99 99 99 99 99 99 99 99 99 93 93 93 93 93 97 96 97 97 97 93 93 93 93 93 99 99 99 99 99 93 93 93 93 93 96 96 96 96 96 98 98 98 98 93 93 93 93 93 93 92 92 92 92 92 93 93 93 93 93 93 93 93 93 93 99 99 99 99 99 99 99 99 99 99 89 89 89 89 89 89 89 89 89 89

and GQ980012, respectively. 16S rDNA sequence of all the five isolates were aligned with the similar sequences in the GenBank database and a phylogenetic tree was constructed. All five Bacillus isolates showed maximum homology (99%) with Vietnam (AB383135) and Chinese (EU118756) isolates GQ379201, GQ390251, GQ980010, GQ980011

of Bacillus subtilis and with Chinese (EU855192 & EU855195) isolate of Bacillus amyloliquefaciens, while all showed minimum homology (89%) with Japanese isolate of Aneurinibacillus aneurinilyticus (Table 3). Phylogenetic analysis of all five isolates with other 17 different Bacillus isolates revealed that all five isolates clustered together with Bacillus subtilis. Within this same cluster isolate CKT2 and CKT3 clustered together which had detrimental effect on plant growth and other three isolates CKT1, CKT4 and CKT5 clustered separately which exhibited growth promotional effects (Fig. 5). Sequence analysis of all five selected isolates with 17 different Bacillus isolates reported from different parts revealed that all belong to Genus Bacillus and species subtillis, which is in confirmation with data from biochemical tests. Bacillus subtilis were earlier reported to have positive effects on plant growth promotion on different crop plants (36). Growth experiments on tomato seedlings revealed that isolate CKT1, CKT4 and CKT5 have positive effect on plant growth under growth chamber

Fig. 5: The Unrooted UPGMA phylogenetic tree of rhizobacterial isolates based on 16S rDNA sequences

and net house and these isolates were also clustered together in phylogenetic tree and the isolate CKT2 and CKT3 which does not promote tomato growth under growth chamber and net house conditions were clustered together as B. subtilis yet showing variation at strain level. Phylogenetic analysis also confirms that the isolates showing same properties of growth under given conditions were also similar at molecular level. In summary, based on the results presented here, the hypothesis to use maximum PGPR isolates with multifarious plant growth promoting activities, using rapid screening procedures, viz. use of replica plating technique, have proved to be suitable for our objective, resulting in five effective strains to enhance tomato plants growth. Except CKT2 and CKT3, all other strains enhanced tomato plants growth effectively. Further studies need to be carried out to unravel underlying mechanism and optimize performance to develop biofertilizers to be used under field conditions.

Isolation & Characterization of Bacillus sp. with Their Effect on Tomato

Defenses Against Pathogens and Herbivores Biochemistry, Ecology and Agriculture, (AA Agarwal, S Tuzun and E Bent Editors), St Paul: APS Prin MN, p 33.

Acknowledgement W e thank the All India Network Project on Soil Biodiversity and Biofertilizer (ICAR) for providing necessary funds to carry out this research work.

15

Shirkot CK & Vohra I (2007) Proceedings of XVI International Plant Protection Congress, (BCPC, SECC, Glasgow, Scotland, UK) 1, 272.

Receivd April 16, 2014; accepted October 20, 2014

16

Pikovskaya RI (1948) Mikrobiologiya, 7, 362.

17

Schwyn B & Neilands JB (1987) Anal Biochem, 160, 47.

18

Sundara Rao WVB & Sinha MK (1963) Indian J Agric Sci, 33, 272.

19

Gorden SA & Paleg LG (1957) Physiol Plant, 10, 37.

20

Baker PD & Schippers (1987) Soil Biol Biochem, 9, 451.

21

Vincent MN (1991) Appl Environ Microbiol, 57, 2928.

22

Holt JG, Krieg NR, Sneath PHA, Staley JT & Wlillams ST (1994) Bergey’s Manual of Determinative Bacteriology, 90, 307.

23

Corpet F (1998) Nucl Acids Res, 16, 10881.

24

Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W & Lipman DJ (1997) Nucl Acids Res, 25, 3389.

25

Higgins DG (1994) Methods Mol Biol, 25, 307.

26

Rodriguez H, Fraga R, Gonzalez T & Bashan Y (2006) Plant Soil, 287, 15.

27

Vassilev N, Vassileva M & Nikolaeva I (2006) Appl Microbiol Biotechnol, 71, 137.

28

Trivedi P & Tongmin S (2008) Curr Micobiol, 56, 140.

29

Pareek & Gaur (1973) Curr Sci, 42, 278.

30

Blumer C & Hass D (2000) Archae Microbiol, 173, 170. Selvakumar G, Kundu S, Gupta AD, Shouche YS & Gupta HS (2008) Curr Microbiol, 56, 134.

Downloaded From IP - 165.123.34.86 on dated 14-May-2015

www.IndianJournals.com

References

Members Copy, Not for Commercial Sale

201

1

De Freitas JR, Banerjee MR & Germida JJ (1997) Biol Fertility Soils, 24, 358.

2

Arshad M & Frankenberger WT (1998) Adv Agron, 62, 45.

3

Kloepper JW, Leong J, Terntze M & Schroth MN (1980) Nature, 286, 885.

4

Raaska L, Viikari L & Mattila ST (1993) J Indian Microbiol, 11, 181.

5

Schinder U, Blumer C, Troxler J, Defago G & Haas D (1994) In: Improving Plant Productivity with Rhizosphere Bac teria, (Ryder, Stephens and Bowen, Editors), Commonwealth Scientific and Indus trial Research Organization, pp 120-125.

6

Glick BR, Jacobson CB, Schwarze MMK & Pasternak JJ (1994) Can J Microbiol, 40, 911.

7

Kannaiy an S, Kumar K & Govindarajan K (2004) Biofertilizers Technology for Rice Based Cropping. Jodhpur, Scientific, XVIII, p 450.

8

Mehta P, Chauhan A, Mahajan R, Mahajan PK & Shirkot CK (2010) Curr Sci, 98, 538.

9

Urquiaga, C & Boddey RM (1992) Proc Soil Sci Soc Am, 56, 105.

31

10

Lucy M , Reed E & Glick BR (2004) Antonie v an Leeuwenhoek, 86, 1.

32

Jagadeesh KS, Krishnaraj PU & Kulkarni JH (2006) Curr Sci, 91, 1458.

11

Kloepper JW, Lifshitz R & Zablotowicz RM (1989) Trends Biotechnol, 7, 39.

33

Hoflich G, Weihe W & Kuhn G (1994) Experientia, 50, 897.

34

Biswas JC, Ladha JK & Dazzo FB (2000) Soil Biol Biochem, 64, 1644.

12

Capper AL & Campbell R (1986) Appl Bacteriol, 69, 155.

13

Cattelan ME, Hartel PG & Fuhrmann JJ (1999) Soil Sci Soc Am, 63, 1670.

35

Chabot R, Beauchamp CJ, Kloepper JW & Antoun H (1998) Soil Biol Biochem, 30, 1615.

14

Zhender GW, Yao C, Murphy JF, Sikora ER, Kloepper JW, Schuster D J & Polston JE (1999) In: Induced Plant

36

Nihorimbere VM , Ongena H, Cawoy Y & Brostaux Kakana P (2010) Afr J Microbiol Res, 4, 1135.

Suggest Documents