Isolation and characterization of eleven novel polymorphic ...

1 downloads 5 Views 161KB Size Report
Apr 10, 2012 - protocols of Smith and Burgoyne (2004) for processing. FTA cards ... Collection grant from Wildlife Preservation Canada to C.D. and a. National ...

Conservation Genet Resour (2012) 4:759–761 DOI 10.1007/s12686-012-9638-1

TECHNICAL NOTE

Isolation and characterization of eleven novel polymorphic microsatellite loci in the spiny softshell turtle (Apalone spinifera) Christina M. Davy • Ida M. Conflitti • Daniel M. L. Storisteanu • Robert W. Murphy

Received: 17 March 2012 / Accepted: 26 March 2012 / Published online: 10 April 2012 Ó Springer Science+Business Media B.V. 2012

Abstract We isolate and characterize 11 microsatellite loci for the spiny softshell turtle (Apalone spinifera) from a partial genomic library obtained using 454 sequencing technology. Genotypes of 15 individuals from southern Ontario and 30 individuals of unknown origin contain 6–20 alleles per locus and the level of heterozygosity ranges from 0.229 to 0.800. These loci will be useful for population genetics studies and enforcement activities such as assignment of illegally traded individuals to their population of origin. Keywords Turtle

Microsatellite  Next-generation sequencing 

The spiny softshell turtle (Apalone spinifera) is a widely distributed species ranging from south-eastern Canada to north-eastern Mexico (Ernst and Lovich 2009). The species is listed as Least Concern by the International Union for the Conservation of Nature (IUCN). However, particular populations are considered to be at risk (van Dijk 2011) and the Canadian populations of A. spinifera are listed as Threatened (COSEWIC 2002). Despite lack of data on harvest

C. M. Davy (&)  I. M. Conflitti  R. W. Murphy Department of Ecology and Evolutionary Biology, University of Toronto, 25 Willcocks St., Toronto, ON M5S 3B2, Canada e-mail: [email protected] C. M. Davy  I. M. Conflitti  R. W. Murphy Department of Natural History, Royal Ontario Museum, 100 Queen’s Park, Toronto, ON M5S 2C6, Canada D. M. L. Storisteanu Department of Medicine, Addenbrooke’s Hospital, University of Cambridge, Hills Road, Cambridge CB2 2QQ, UK

levels in many parts of the species’ range, recorded exports of A. spinifera from the North America to Asian food markets increased dramatically in recent years and doubled between 2006 and 2008 (IUCN/SSC Tortoise and Freshwater Turtle Specialist Group 2010). Illegal harvest poses a significant threat to at-risk populations of A. spinifera. Here, we present a suite of variable microsatellite markers for A. spinifera that could be used to answer a range of research questions as well as for conservation enforcement (for example, development of assignment tests). We used phenol–chloroform extraction (Sambrook et al. 1989) to isolate genomic DNA from a whole blood sample of A. spinifera stored in 95 % EtOH and cleaned the DNA using standard EtOH precipitation. We obtained a partial genomic library by sequencing on a Roche GS Junior (Roche, Branford, CT) using the next generation sequencing facilities at Trent University’s Natural Resources DNA Profiling and Forensics Centre. The GS Junior run produced 137,054 sequences averaging 415 base pairs in length. We searched sequences for tri-, tetra- and penta-nucleotide microsatellites with the program MSTACOMMANDER (Faircloth 2008) and designed 40 primer pairs using the software Primer 3 (Rozen and Skaletsky 2000). We added a 50 M13 tail to forward primers to facilitate fluorescent labelling, and a 50 pigtail (GTTTCTT; Brownstein et al. 1996) to reverse primers to facilitate adenylation. PCR amplification followed the method of Schuelke (2000) and cycling parameters followed King and Julian (2004) with annealing temperatures adjusted for each locus (Table 1). We used a 3730 DNA Analyzer (Applied Biosystems) to visualize length of the amplified fragments by comparison to GS(500) Liz size standard (Applied Biosystems). We scored genotypes using GENEMARKER (SoftGenetics, State College, PA, USA).

123

760

Conservation Genet Resour (2012) 4:759–761

Table 1 Primer sequences and amplification conditions for 11 novel polymorphic loci for Apalone spinifera Locus

Primer sequence (50 –30 )

Repeat motif

Annealing temperature (°C)

As07

F: TGTAAAACGACGGCCAGTACGACGCCAAAATTTGAGTT

AGAT

52

ATGGT

52

CTTT

60

F: TGTAAAACGACGGCCAGTGTGGCTGAAAAGGCAAGACT R: GTTTCTTTGCAAAATGGACCTTGAACA

GATT

58

F: TGTAAAACGACGGCCAGTTGGCCTTAGGCAAGTCTTTT

GTTT

54

GTTT

58

AAC

61

AAC

58

ATC

58

AAT

58

AAT

58

R: GTTTCTTACTTTTGTTCCTCCGGGTTT As12

F: TGTAAAACGACGGCCAGTTGATCATTGTCTCTTGGCAGTC R: GTTTCTTGTGATTGCAGCAGCGAAATA

As13

F: TGTAAAACGACGGCCAGTCCCACTGGGATTGCTAACTT R: GTTTCTTTGGATGAAGAAATTGCATGG

As14 As15

R: GTTTCTTGAGCCTACATCTGCAATGGTT As18

F: TGTAAAACGACGGCCAGTTTTAATTCCTGAGAGGGACACTG R: GTTTCTTGCAGTAAAGGGCAAAACCAG

AsB07

F: TGTAAAACGACGGCCAGTTTCAGTAAGAAAGTTGTAAATCTTGAA R: GTTTCTTATATGGCCCTTGACCTCACA

AsB08

F: TGTAAAACGACGGCCAGTGCCGCATCAGCTTTGTTAAG R: GTTTCTTTTCCCTGTGCTTACCTGGTC

AsB09

F: TGTAAAACGACGGCCAGTCTGCTTCACCCCTTCTCTGA R: GTTTCTTAGGCATCGGATACAAACAGG

AsB12

F: TGTAAAACGACGGCCAGTTGCCAGAATCTTCAAAAGCA R: GTTTCTTCTCCTGTGAGCCAGGTCAGT

AsB14

F: TGTAAAACGACGGCCAGTTGTTGCAAACACAGTTGGAA R: GTTTCTTTGCCAGAAAGAAATCACCAA

Primer sequences shown include a 50 M13 tail (50 -TGT AAA ACG ACG GCC AGT-30 ) on forward primers and a 50 pigtail (GTTTCTT) on reverse primers

Eleven of the 40 primer pairs amplified unambiguous, replicable alleles. We used GENALEX v6.0 (Peakall and Smouse 2006) to quantify the number of alleles per locus (k), calculate observed and expected heterozygosity (Ho and He) and probability of identity (PI) for each locus. We used GENEPOP 4.0.10 (Raymond and Rousset 1995; Rousset 2008) to test for linkage disequilibrium and deviations from Hardy–Weinberg equilibrium (HWE). We obtained blood from 15 individual A. spinifera from southern Ontario by caudal venipuncture following approved Animal Use Protocols and stored it on FTA cards (Whatman Inc.). We prepared DNA for PCR following the protocols of Smith and Burgoyne (2004) for processing FTA cards containing blood with nucleated erythrocytes. Because the sampled Ontario population is near the northern limit of the species’ range we expected genetic variation to be relatively low. Thus, we also collected 30 tissue (muscle) samples from A. spinifera carcasses confiscated by Ontario wildlife enforcement staff. We isolated DNA from the muscle samples using phenol–chloroform extraction (Sambrook et al. 1989). The exact origin of these individuals was unknown, but we assumed that they represented a wider geographic distribution than our samples from Ontario and included them to better investigate

123

polymorphism in these markers. We genotyped a total of 45 individuals at 11 loci. We also sequenced alleles from homozygous loci to confirm that the amplified fragments were homologous to those obtained through 454 sequencing. Table 2 summarizes the characteristics of each locus for the samples from Ontario and those of unknown origin. The overall number of alleles per locus ranges from 6 to 20 and the level of heterozygosity ranges from 0.229 to 0.800. No linkage disequilibrium is detected when the population from Ontario is analyzed separately. However, when considering the entire dataset, 5 of the 55 pairwise comparisons between loci show evidence of linkage disequilibrium after Bonferroni correction for multiple comparisons (As18 and As07; As18 and As15; As15 and AsB12; AsB09 and As12; and As15 and AsB09). All loci are in HWE in the samples from Ontario (p \ 0.05) with the exception of AsB14 (p = 0.048). Only one locus (AsB08) meets the expectations of HWE in the 30 samples of unknown origin (p \ 0.05). However, these samples probably do not represent a single population and should not be treated as such. These 11 polymorphic loci will facilitate studies of the population genetics of A. spinifera. Due to our

Conservation Genet Resour (2012) 4:759–761

761

Table 2 Characteristics of 11 novel polymorphic loci for 15 A. spinifera from Southern Ontario and 30 individuals of unknown origin Locus

Size (bp)

Southern Ontario (N = 15) N

k

Ho

Confiscated individuals (unknown origin; N = 30) He

PI

N

k

Ho

He

PI

As07

191–307

14

11

0.714

0.860

0.034

27

14

0.556

0.767

0.069

As12

243–309

15

5

0.600

0.638

0.178

30

7

0.700

0.733

0.113

As13

172–236

15

5

0.600

0.702

0.146

30

17

0.900

0.925

0.011

As14

216–224

15

1

0.000

0.000

1.000

26

6

0.308

0.567

0.229

As15

262–342

15

9

0.867

0.820

0.056

27

16

0.630

0.833

0.045

As18

252–305

13

5

0.385

0.337

0.453

27

12

0.630

0.871

0.029

AsB07 AsB08

179–205 209–230

15 15

2 3

0.333 0.333

0.358 0.380

0.476 0.423

30 28

9 8

0.367 0.821

0.527 0.844

0.250 0.044

AsB09

142–180

15

3

0.333

0.640

0.206

30

10

0.500

0.814

0.055

AsB12

256–283

15

5

0.667

0.709

0.136

27

5

0.259

0.628

0.197

AsB14

237–252

13

6

0.385

0.589

0.195

30

6

0.667

0.821

0.057

N number of individuals genotyped, k number of alleles, Ho observed heterozygosity, He expected heterozygosity, PI probability of identity

unconventional use of individuals for whom the exact location of origin is not known, our results are not intended to provide a robust genetic profile of any particular population. Rather, our results demonstrate the utility of these variable loci for population genetics studies in this species, including population assignment tests and potential conservation enforcement. Acknowledgments This project was made possible by a Canada Collection grant from Wildlife Preservation Canada to C.D. and a National Science and Engineering Research Council (NSERC) Discovery Grant A3148 to R.W.M. Generous assistance from the Schad Foundation offset genotyping costs. C.D. and I.D. are funded by NSERC Canada Graduate Scholarships; D.S. was funded by an NSERC Undergraduate Summer Research Award. We thank Dr. C. Kyle, E. Kerr and M. Harnden at the NRDPFC (Trent University) for assistance with 454 sequencing. Sample collection was conducted with the permission of the Government of Ontario following Animal Use Protocol 2010–14 (Royal Ontario Museum, Toronto, Canada). We thank R. Andrews and the Lake Ontario Enforcement Unit for providing tissues from confiscated turtles.

References Brownstein MJ, Carpten JD, Smith JR (1996) Modulation of nontemplated nucleotide addition by tag DNA polymerase: primer modifications that facilitate genotyping. Biotechnol 20:1004–1010 COSEWIC (2002) COSEWIC assessment and update status report on the spiny softshell turtle Apalone spinifera in Canada. Committee on the Status of Endangered Wildlife in Canada. Ottawa, VII, 17 p Ernst C, Lovich J (2009) Turtles of the United States and Canada, 2nd edn. Johns Hopkins University Press, Baltimore, MD Faircloth BC (2008) Msatcommander: detection of microsatellite repeat arrays and automated, locus-specific primer design. Mol Ecol Resour 8:92–94

IUCN/SSC Tortoise and Freshwater Turtle Specialist Group (2010) A study of progress on conservation of and trade in CITES-listed tortoises and freshwater turtles in Asia. In: CoP15, Inf. 22. Convention on international trade in endangered species of wild fauna and flora. Fifteenth meeting of the conference of the parties, Doha (Qatar). 13–25 March. http://www.cites.org/ common/cop/15/inf/E15i-22.pdf King TL, Julian SE (2004) Conservation of microsatellite DNA flanking sequences across 13 Emydid genera assayed with novel bog turtle (Glyptemys muhlenbergii) loci. Conserv Genet 5:719–725 Peakall R, Smouse PE (2006) GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Mol Ecol Notes 6:288–295 Raymond M, Rousset F (1995) GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. J Hered 86:248–249 Rousset F (2008) Genepop’007: a complete reimplementation of the Genepop software for Windows and Linux. Mol Ecol Resour 8:103–106 Rozen S, Skaletsky HJ (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp 365–386. Source code available at http://fokker.wi.mit.edu/primer3/ Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning—a laboratory manual, 2nd edn. Cold Spring Harbor Laboratory Press, New York, NY Schuelke M (2000) An economic method for the fluorescent labeling of PCR fragments. Nat Biotechnol 18:233–234 Smith LM, Burgoyne LA (2004) Collecting, archiving and processing DNA from wildlife samples using FTAÒ databasing paper. BMC Ecol 4:4: http://www.biomedcentral.com/1472-6785/4/4 van Dijk PP (2011) Apalone spinifera. In: IUCN 2011. IUCN Red List of Threatened Species. Version 2011.2. http://www.iucnredlist. org. Downloaded on 19 December 2011

123

Suggest Documents