Isolation and Characterization of Microsatellite ... - Semantic Scholar

HORTSCIENCE 44(7):2043–2045. 2009.

Isolation and Characterization of Microsatellite Markers in the Endangered Species Taxus wallichiana Using the FIASCO Method Jun-Bo Yang, Hong-Tao Li, De-Zhu Li, Jie Liu, and Lian-Ming Gao1 Germplasm Bank of Wild Species, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming, Yunnan 650204, China De-Zhu Li and Lian-Ming Gao Key Laboratory of Biodiversity and Biogeography, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming, Yunnan 650204, China Jie Liu The Graduate School of Chinese Academy of Sciences, Beijing 100049, China Additional index words. Himalayan yew, population genetics, linkage disequilibrium Abstract. The Himalayan yew, Taxus wallichiana Zucc., is an endangered species with a scatted distribution in the Eastern Himalayas and southwestern China. In the present study, 10 microsatellite markers from the genome of T. wallichiana were developed using the protocol of fast isolation by amplified fragment length polymorphism of sequences containing repeats (FIASCO). Polymorphism of each locus was assessed in 28 samples from four wild populations of the Himalayan yew. The allele number of the microsatellites ranged from two to five with an average of 2.9 per allele. The observed and expected heterozygosity varied from 0.00 to 1.00 and from 0.3818 to 0.7552, respectively. Cross-species amplification in another two yew species showed eight of them holding promise for sister species. Two of the 10 loci (TG126 and TC49) significantly deviated from Hardy-Weinberg expectations. No significant linkage disequilibrium was detected between the comparisons of these loci. These polymorphic microsatellite markers would be useful tools for population genetics studies and assessing genetic variations to establish conservation strategy of this endangered species.

The Himalayan yew, Taxus wallichiana Zucc., is an endangered, dioecious, and windpollinated tree species, which is restricted to the Eastern Himalayas and southwestern China (Fu et al., 1999; Möller et al., 2007; Shah et al., 2008). This species usually grows scattered in the understory of montane broadleaved, coniferous, and mixed forests between 2000- to 3500-m altitudes (Fu et al., 1999; Li and Fu, 1997). Yew is economically important as the source of paclitaxel, a cancerReceived for publication 29 July 2009. Accepted for publication 18 Sept. 2009. This study was supported by the National Natural Sciences Foundation of China (grant no. 30700042), the Natural Sciences Foundation of Yunnan (grant no. 2007C088M), the Knowledge Innovation Program of the Kunming Institute of Botany of CAS (540806321211) and GBOWS, the West Light Foundation of The Chinese Academy of Sciences (9223111W1), and the Talent Project of the Yunnan Province of China (grant no. 2008PY064). We are grateful to J. Yang and Y. Zhao for their help with laboratory work and data analyses. We also thank Dr. Michael Möller, Royal Botanic Garden Edinburgh, for improving English. 1 To whom reprint requests should be addressed; e-mail [email protected].

HORTSCIENCE VOL. 44(7) DECEMBER 2009

inhibiting compound first found in the bark of the Pacific yew, Taxus brevifolia (Wani et al., 1971) and later found in T. wallichiana as well (Appendino, 1993; Mukherjee et al., 2002). Currently, taxol is difficult to synthesize on an industrial scale (Kikuchi and Yatagai, 2003) and still relies heavily on natural resources (Denis et al., 1988; Schippmann, 2001; Takeya, 2003). This has led to an overexploitation of the natural resources of T. wallichiana along the Himalayas and in southwestern China and the natural resources have become scarce and the plants seriously threatened with extinction in this region (Gao et al., 2007; Schippmann, 2001). Consequently, T. wallichiana was listed in Appendix II of CITES in 1995 and listed as the first class-protected wild species in China (The State of Council of the People’s Republic of China, 1999). As a result of these developments, the plants are in danger of genetic erosion and increased inbreeding (by consanguineous mating, i.e., mating among closely related individuals; see Zhang et al., 2009). To quantify the effects of these stochastic genetic events, accurate estimations of the levels of genetic diversity are required. This provides baseline data for future conservation programs.

In previous studies, random amplified polymorphic DNA (RAPD), intersimple sequence repeat (ISSR), and amplified fragment length polymorphism (AFLP) data (Mohapatra et al., 2008, 2009; Saikia et al., 2000; Zhang et al., 2009) have been used to investigate the genetic diversity of T. wallichiana. However, the dominant nature of these genetic markers can lead to an underestimation of the recessive allele frequency in a population causing bias in the estimate of genetic diversity and genetic differentiation (Nybom, 2004). This problem does not occur with microsatellite markers. Compared with other, random fingerprinting techniques such as RAPDs, ALFPs, and ISSRs, microsatellites show numerous advantages because they are locus-specific, codominant, highly reproducible and usually highly polymorphic (Powell et al., 1996). The development of microsatellite makers of congeneric species was recently reported for Taxus sumatrana (Miq.) de Laub. (Huang et al., 2008), T. yunnanensis W.C. Cheng & L.K. Fu (Miao et al., 2008), and T. baccata L. (Dubreuil et al., 2008) although no nuclear microsatellite primers hitherto have been reported for T. wallichiana Zucc. Therefore, we set out to develop microsatellite markers (simple sequence repeat) for this species using the fast isolation by AFLP of sequences containing repeats (FIASCO) protocol of Zane et al. (2002). We describe the development of 10 microsatellite loci for T. wallichiana. DNA was extracted from dried leaf tissues and ground in liquid nitrogen using a modified CTAB method (Doyle and Doyle, 1987). Total genomic DNA (500 ng) was completely digested with MseI and then ligated to an MseI AFLP adaptor. A diluted digestion– ligation mixture (1:10) was amplified with an adaptor-specific primer (5#-GATGAGTCCT GAGTAAN-3#). Amplified DNA fragments, with a size range of 200 to 800 bp, were enriched for repeats by magnetic bead selection with a 5#-biotinylated (AC)15 and (AG)15 and (AAG)10 probe. The enriched fragments were amplified again with the previously mentioned adaptor-specific primer. Polymerase chain reaction (PCR) products were purified using an EZNA Gel Extraction Kit (Omega Bio-Tek, Guangzhou, China). The purified DNA fragments were ligated into the pGEM-T vector (Promega, USA) and transformed into Dh5a cells (TaKaRa, Dalian, China). Positive clones were tested by PCR using (AC)10 /(AG)10/(AAG)7 and T7/Sp6 as primers. In total, 425 clones with positive inserts were sequenced on an ABI PRISM 3730xl DNA sequencer (Applied Biosystems Inc., USA) according to the manufacturer’s protocols. A total of 183 (42%) sequences were found to contain microsatellite repeats, and 80 of them were suitable for designing locus-specific primers using the primer 5.0 program (Clarke and Gorley, 2001). The levels of polymorphisms of all the 64 microsatellite loci were assessed in 28 DNA samples from four natural populations of T. wallichiana. The PCR reactions were

2043

Table 1. Specific primer sequences, characteristics, and results of a population genetic survey for 10 microsatellite loci isolated from Taxus wallichiana. GenBank HE Primer sequences (5#–3#) Ta (C) Allele size (bp) A HO accession no. F: CTCTTAGTTGTGAAGGCAATG 53 111–125 5 0.2500 0.7552 FJ839824 R: ATGAGTGGGCCATGAAAT F: TGGTTGGCAGAAATAGAG 52 220–232 3 0.5679 0.5588 FJ839820 TG129 (AG)6AT(AG)6 R: GGTCTGATAATCTGAGGG F: TGGGAGTAGGTGGTTATT 51 201–207 2 0.7143 0.4675 FJ839826 TC59 (TG)5 R: ACCAGACATTCCCTCAAT F: CGGAGATTGTCCTCATAC 52 365–373 3 0.3571 0.6136 FJ839823 TG47 (AC)10 R: ACTTCTTCTGTCCCACCC F: CATACTACTACACTCCACCTA 50 299–303 2 0.5000 0.3818 FJ839821 TG126 (AC)5z R: TAATCTCAGCCGCTAAAC F: GACTGGCACTAGGGAAAC 54 135–141 4 0.2857 0.7162 FJ839819 TG144 (TC)7(AC)7 R: TCAGACTGACCTCGACAA F: TAACTAAGCGTTGCACTA 50 177–179 2 0.5714 0.4156 FJ839827 TC49 (TG)7z R: CACAACATAGGAGGGAAT F: CCTTATTTCGAGGTTGGC 50 191–197 3 1.0000 0.6357 FJ839822 TG118 (AG)9 R: ATGCTCCCGTGAAGACAG F: GTGTCATCTATCTATCACGGTTTC 50 252–256 3 0.5357 0.6318 FJ839825 TC121 (AC)6 R: AAGGTAGCGTTACTTTCG F: TCCCAGAATACTCCTTAT 53 212–214 2 0.0000 0.5091 FJ839828 TA114 (AAG)4 R: CTGGCTTCCTCTAGCATTTCAT z Significant departure from Hardy–Weinberg equilibrium. Ta = Polymerase chain reaction annealing temperature; A = number of alleles revealed; HO = observed heterozygosity; HE = expected heterozygosity.

Locus TG41

Repeat motif (TC)11

performed in a total volume of 15 mL containing, 30 to 50 ng genomic DNA, 0.6 mM of each primer pair (Table 1), 7.5 mL 2 · Taq PCR MasterMix [Tiangen (Tiangen Biotech Co., Ltd, Beijing, China); 0.1 U Taq polymerase/mL, 0.5 mM dNTP each, 20 mM Tris-HCl (pH 8.3), 100 mM KCl, 3 mM MgCl2]. PCR amplifications were conducted on an MJ PTC-200 Thermal Cycler (Waltham, MA) under the following conditions: 97 C for 3 min followed by 30 to 36 cycles at 94 C for 30 s followed by the annealing temperature for each specific primer (Table 1) for 30 s, 72 C for 1 min, and a final extension step at 72 C for 7 min. The PCR products were separated on 8% polyacrylamide denaturing gels using a 20-bp or 10-bp ladder molecular size standard (O’rangeRulerä; Fermentas, Shenzhen, China) visualized by silver staining. In the end, 10 of the 64 screened primer pairs displayed polymorphisms. The sequences of the 10 microsatellite markers are submitted to GenBank (Table 1). Standard genetic diversity parameters, Hardy– Weinberg equilibrium (HWE) and linkage disequilibrium (LD) between pairs of loci were estimated using GENEPOP Version 3.4 (Raymond and Rousset, 1995; http:// genepop.curtin.edu.au/). The number of alleles per locus (A) was two to five with an average of 2.9. The values for observed heterozygosity (HO) and expected heterozygosity (HE) ranged from 0.00 to 1.00 and from 0.3818 to 0.7552 with averages of 0.4782 and 0.5685, respectively (Table 1). Two of the 10 loci (TG126 and TC49) significantly deviated from HWE proportions. This might have been the result of the small population sizes and isolated samples used in this survey. No significant LD was detected between the loci (P < 0.001) in our analysis. To test for cross-species/variety application, these 10 primer pairs were used on samples of Taxus fuana and T. chinensis var. mairei. Eight of the 10 primer pairs

2044

successfully amplified fragments in these two taxa, also showing microsatellite polymorphisms (data not shown). The microsatellite markers isolated here detected polymorphisms even in our small set of DNA samples. They will be very useful for further investigating the spatial genetic structure, genetic diversity, and gene flow of T. wallichiana, which will provide additional insight into population genetics and help to develop viable strategies for the conservation and management of this threatened medicinal plant. The promising cross-taxa applicability indicates their usefulness in allied taxa of this genus. Literature Cited Appendino G. 1993. Taxol (Paclitaxol): Historical and ecological aspects. Fitoterapia Lxiv:5–25. Clarke, K.R. and R.N. Gorley. 2001. PRIMER Version 5: User manual/tutorial. PRIMER-E Ltd., Plymouth, UK. Denis, J.N., A.E. Greene, D. Guenard, F. GueritteVoegelein, L. Mangatal, and P. Potier. 1988. A highly efficient, pratical approach to natural taxol. J. Amer. Chem. Soc. 110:5917–5919. Doyle, J.J. and J.L. Doyle. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull 19:11–15. Dubreuil, M., F. Sebastiani, M. Mayol, C.S. Gonza´lezMartıńez, M. Riba, and G.G. Vendramin. 2008. Isolation and characterization of polymorphic nuclear microsatellite loci in Taxus baccata L. Conserv. Genet. 9:1665–1668. doi: 10.1007/ s10592-007-9515-3. Fu, L.K., N. Li, and R.R. Mill. 1999. Taxaceae. 89–96. In: Wu, Z.Y. and P.H. Raven (eds.). Flora of China. Vol. 4. Science Press, Beijing, China, and Missouri Botanical Garden, St. Louis, MO. Gao, L.M., M. Möller, X.M. Zhang, M.L. Hollingsworth, J. Liu, R.R. Mill, M. Gibby, and D.Z. Li. 2007. High variation and strong phylogeographic pattern among cpDNA haplotypes in Taxus wallichiana (Taxaceae) in China and North Vietnam. Mol. Ecol. 16:4684–4689. Huang, C.C., T.Y. Chiang, and T.W. Hsu. 2008. Isolation and characterization of microsatellite

loci in Taxus sumatrana (Taxaceae) using PCR-based isolation of microsatellite arrays (PIMA). Conserv. Genet. 9:471–473. doi: 10.1007/s10592-007-9341-z. Kikuchi, Y. and M. Yatagai. 2003. The commercial cultivation of Taxus species. In: Itokawa, H. and K.H. Lee (eds.). Taxus. Taylor & Francis, London, UK, and New York, NY. Li, N. and L.K. Fu. 1997. Notes on gymnosperms I. Taxonomic treatments of some Chinese conifers. Novon 7:261–264. Miao, Y.C., J.R. Su, Z.J. Zhang, H. Li, J. Luo, and Y.P. Zhang. 2008. Isolation and characterization of microsatellite markers for the endangered Taxus yunnanensis. Conserv. Genet. 9: 1683–1685. doi: 10.1007/s10592-008-9532-2. Mohapatra, K.P., S.N. Sehgal, R.K. Sharma, and T. Mohapatra. 2008. Evaluation of genetic variation in West Himalayan yew and its associates using RAPD and AFLP markers. J. Plant Biochem. Biotechnol. 17:161–165. Mohapatra, K.P., S.N. Sehgal, R.K. Sharma, and T. Mohapatra. 2009. Genetic analysis and conservation of endangered medicinal tree species Taxus wallichiana in the Himalayan region. New For. 37:109–121. Möller, M., L.M. Gao, R.R. Mill, D.Z. Li, M.L. Hollingsworth, and M. Gibby. 2007. Morphometric analysis of the Taxus wallichiana complex based on herbarium material. Bot. J. Linn. Soc. 155:307–335. Mukherjee, S., B. Ghosh, T.B. Jha, and S. Jha. 2002. Variation in content of taxol and related taxanes in eastern Himalayan populations of Taxus wallichiana. Planta Med. 68:757–759. Nybom, H. 2004. Comparison of different nuclear DNA markers for estimating intraspecific genetic diversity in plant. Mol. Ecol. 13:1143– 1155. Powell, W., M. Morgante, C. Andre, M. Hanafey, J. Vogel, S. Tingey, and A. Rafalski. 1996. The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis. Mol. Breed. 2:119–122. Raymond, M. and F. Rousset. 1995. Genepop (Version 1.2): Population genetics software for exact tests and ecumenicism. J. Hered. 86:248–249. Saikia, D., S.P.S. Khanuja, A.K. Shasany, M.P. Darokar, A.K. Kukreja, and S. Kumar. 2000. Assessment of Diversity among Taxus


wallichiana accessions from Northeast India using RAPD analysis. Plant Genet. Resour. Newsl. 121:27–31. Schippmann, U. 2001. CITES medicinal plants significant trade study. Project S 109. German Federal Agency for Nature Conservation, Bonn, Germany. Shah, A., D.Z. Li, M. Möller, L.M. Gao, M.L. Hollingsworth, and M. Gibby. 2008. Delimitation of Taxus fuana Nan Li & R.R. Mill (Taxaceae) based on morphological and molecular data. Taxon 57:211–222.


Takeya, K. 2003. Plant tissue culture of taxoids. In: Itokawa, H. and K.H. Lee (eds.). Taxus. Taylor & Francis, London, UK, and New York, NY. The State Council of the People’s Republic of China. 1999. Records of main conservative plants in China. Sept. 1999. . Wani, M.C., H.L. Taylor, M.E. Wall, P. Coggon, and A.T. McPhail. 1971. Plant antiumor agents: VI. The isolation and structure of taxol, a novel

antileukemic and antitumor agent from Taxus brevifolia. J. Amer. Chem. Soc. 93:2325– 2327. Zane, L., L. Bargelloni, and T. Patarnello. 2002. Strategies for microsatellite isolation: A review. Mol. Ecol. 11:1–16. Zhang, X.M., L.M. Gao, M. Möller, and D.Z. Li. 2009. Molecular evidence for fragmentation among populations of Taxus wallichiana var. mairei, a highly endangered conifer in China. Can. J. For. Res. 39:755–764.

2045