Isolation and characterization of ten novel ...

0 downloads 0 Views 2MB Size Report
Sep 15, 2011 - amplification of these loci and other ten loci previously developed for the great tinamou (Tinamus major) in other tinamous. Genetic variability ...

Isolation and characterization of ten novel microsatellite loci in the red-winged tinamou (Rhynchotus rufescens, Tinamiformes, Aves) and crossamplification in other tinamous Dimas O. Santos, Lucas R. Moreira, Humberto Tonhati & Renato Caparroz

Molecular Biology Reports An International Journal on Molecular and Cellular Biology ISSN 0301-4851 Mol Biol Rep DOI 10.1007/s11033-011-1277-1

1 23

Your article is protected by copyright and all rights are held exclusively by Springer Science+Business Media B.V.. This e-offprint is for personal use only and shall not be selfarchived in electronic repositories. If you wish to self-archive your work, please use the accepted author’s version for posting to your own website or your institution’s repository. You may further deposit the accepted author’s version on a funder’s repository at a funder’s request, provided it is not made publicly available until 12 months after publication.

1 23

Author's personal copy Mol Biol Rep DOI 10.1007/s11033-011-1277-1

Isolation and characterization of ten novel microsatellite loci in the red-winged tinamou (Rhynchotus rufescens, Tinamiformes, Aves) and cross-amplification in other tinamous Dimas O. Santos • Lucas R. Moreira • Humberto Tonhati • Renato Caparroz

Received: 16 August 2011 / Accepted: 15 September 2011 Ó Springer Science+Business Media B.V. 2011

Abstract We describe the isolation and characterization of ten microsatellite loci from the red-winged tinamou (Rhynchotus rufescens) and also evaluated the crossamplification of these loci and other ten loci previously developed for the great tinamou (Tinamus major) in other tinamous. Genetic variability was assessed using 24 individuals. Six loci were polymorphic with moderate to high number of alleles per locus (2–12 alleles) and showed expected heterozygosity (HE) ranging from 0.267 to 0.860. All loci conformed to the Hardy–Weinberg expectation and linkage disequilibrium was not significant for any pair of loci. This battery of polymorphic loci showed high paternity exclusion probability (0.986) and low genetic identity probability (4.95 9 10-5), proving to be helpful for parentage tests and population analyses in the red-winged tinamou. The cross-amplification was moderate where of the 160 locus/taxon combinations, 46 (28.75%) successfully amplified. Keywords Microsatellite  Neotropical  Rhyncothus rufescens  Tinamiformes  Tinamous

D. O. Santos  H. Tonhati Faculdade de Cieˆncias Agra´rias e Veterina´rias de Jaboticabal, UNESP, Sa˜o Paulo, Brazil L. R. Moreira  R. Caparroz Laborato´rio de Gene´tica e Biodiversidade, Instituto de Cieˆncias Biolo´gicas, Universidade Federal de Goia´s, Goiaˆnia, Brazil R. Caparroz (&) ´ rea Faculdade UnB Planaltina, Universidade de Brası´lia, A Universita´ria 1, Vila Nossa Senhora de Fa´tima, Planaltina, Distrito Federal CEP 73340-710, Brazil e-mail: [email protected]

Introduction The order Tinamiformes comprises 47 species grouped in 9 genera, distributed in the Neotropical region from Northwest Mexico to southern South America [1]. These birds are terrestrial with limited flight capabilities and occur in a wide range of habitats. Tinamiformes is the only order of birds where exclusive male parental care is found in all known species, while mating systems are varied [2]. Around 6% of tinamous are considered near threatened and 11% vulnerable by the World Conservation Union [3]. However, little is known about their natural history and few long-term studies have been conducted on these species (for review see [1]). The red-winged tinamou (Rhynchotus rufescens) is a medium-sized (38–42 cm) ground-living species and has an extremely large range from central and eastern South America [1]. The population size of this species has not been quantified, but the population trend appears to be decreasing [3], indicating that population studies are required to evaluate the conservation status of this species. Furthermore, due to its broad geographic dispersion, omnivorous feeding habit, and the taste of its meat, this species has become attractive for economic purposes [4]. However, the reproductive performance of this species in captivity is still a problem that needs to be solved. Thus, several biological aspects related to breeding behavior and population genetic structured need to be clarified in tinamous and microsatellite markers could be really helpful for this purpose. However, at the present time, only eighteen microsatellite loci have been developed in tinamous [5]. Here, we described ten novel microsatellite in the redwinged tinamou and tested these markers on the other eight species of tinamous. We also tested cross-amplification of previously described tinamou microsatellite primers (Tinamus major [5]) in all tinamou species studied.

123

Author's personal copy Mol Biol Rep

Materials and methods The enrichment of a microsatellite library was undertaken using the methodology described by Billotte et al. [6]. High quality genomic DNA was fragmented using a restriction enzyme Rsa I. The fragmented DNAs were ligated to specific adapters (Rsa21 50 CTCTTGCTTACGCGTGGACTA30 and Rsa25 50 TAGTCCACGCGTAAGCAAGAGCACA30 ). The polymerase chain reaction (PCR) products were size-selected to preferentially obtain small fragments (300–1,200 bp), which were hybridized to two streptavidin-biotinylated oligo simple sequence repeats: (CT) and (GT). The enriched DNAs were ligated into pGEM-T easy vector (Promega) and used to transform XL1-Blue MRF super competent cells (Stratagene). The recombinant clones were directly sequenced and flanking regions were recovered to design primers for the amplification of each microsatellite sequence using websat [7] and Primer3 [8] programs. In total, 96 positive clones were obtained through the enrichment method, but only 59 sequences were confirmed to carry microsatellite sequences. Among these, only 34 distinct microsatellite loci were identified, and 10 were selected and used to evaluate genetic variation in the redwinged tinamou. We selected the loci which showed perfect or uninterrupted motifs and more than five repeat units long. Genomic DNAs from 24 adult red-winged tinamou samples

were used for PCR amplification of ten microsatellite loci shown in Table 1. PCR reactions were carried out on a Perkin Elmer Gene Amp PCR System 9,700 in 10 ll volumes containing 50 ng of genomic DNA, 20 mM Tris–HCl (pH 8.4), 50 mM KCl, 1.5 mM MgCl2, 0.2 mM of each dNTP, 0.8 lM of each primer and 0.5 unit of Taq DNA polymerase (Phoneutria). Details of the thermal profile for all loci consisted of an initial denaturation at 96°C for 7 min, followed by 35 cycles of 96°C for 1 min, 53–61°C for 45 s depending on the locus and 72°C for 45 s and a final extension at 72°C for 20 min. The PCR products were subsequently separated on 6% denaturing polyacrylamide gel and visualized by silverstaining, as described by Creste et al.[9]. The alleles were sized based on the 10-bp DNA ladder standard (Invitrogen). The Hardy–Weinberg expectation (HWE) and gametic disequilibrium were tested using Genepop 4.1 [10]. Sequential Bonferroni corrections were applied using a nominal P value of 0.05 [11]. We also estimated the genetic identity (I) [12] and paternity exclusion probabilities (Q) [13] for each polymorphic locus and overall loci using Identity 1.0 [14]. Microchecker version 2.2.3 [15] was used to identify possible null alleles, large allele dropout, scoring errors, and typographic errors. To evaluate cross-species amplification, we tested the 10 primer pairs described here and ten previously described for the great tinamou (T. major [5]) in eight tinamou

Table 1 Characterization of the ten microsatellite loci developed for Rhynchotus rufencens Locus ID (GenBank)

Anneal (°C)

Repeat motif

Primer sequences (50 –30 )

A

Size–range (bp)

HE

HO

P-EHW

Q

I

RruGT12A (JN391512)

58

(GT)7

F: GGTTCTTCTTGAGGTTCCTG

5

190–200

0.791

0.579

0.0152

0.582

0.077

5

196–204

0.605

0.700

0.8496

0.350

0.214

12

222–260

0.860

0.696

0.0279

0.730

0.032

2

282–288

0.496

0.273

0.0340

0.186

0.377

11

270–292

0.857

0.818

0.2528

0.717

0.036

2

196–204

0.267

0.318

1.0000

0.116

0.572

1

192

1

204

1

258

1

258

R: TTTTCCTTCCCCCAGTT RruGT12B (JN391513)

50

(GT)8

F: ACTGCACTTTTGCAGTTAGC R: GCTGCAGATACAAGGCTACA

RruGT10D (JN391516)

60

(GT)24

F: GTGACACATTCCAGATTTGC R: CATGCTCAGGATGAAGACAC

RruGT06G (JN391519)

54

(AT)5(GT)7(AT)4

F: CCTGTGCCCCTCTGCGGGTC R: GGCAGCTTTCAGGAGCTTAG

RruGT04F (JN391517)

54

(AT)3(AC)8(AT)3

F: CCTCCTCTCCTCAACACTTC R: CCAATGGAGTCTTTTCCTTC

RruGT12F (JN391518)

60

(GT)25

F: GCACGTGGATACACCACAGG R: ACAGCCCCTGCAATGTCCGC

RruGT08A (JN391511)

54

(GT)16

F: GGGTAGCTGTGACCCTTTGC R: GATGCAAAGATGATGGTGAG

RruGT09C (JN391514)

58

(GT)7

F: AAGATGACAGTGGGACTGAA R: AGAGGGAGCTGTATCCTTTG

RruGT09D (JN391515)

56

(GT)7

F: CCACCTCCCTTCATCTCAAT R: TGCCTCATTCCACCTCTTCT

RruGT11G (JN391520)

54

(GT)8

F: RGTGTGCCTGTGATTTTCTGC R: CACACACGCATGTATGTAGC

F forward primer; R reverse primer; A number of alleles; HE expected heterozygosities; HO observed heterozygosities; P-HWE P-values for the Hardy–Wienberg Expectation test; Q paternity exclusion probability; I genetic identity

123



Rhynchotus rufescens Solitary Tinamou























58





58

12A

50

50

50

50

50

50

50

50

50

12B

















58

09C

The annealing temperature in Celsius degree was shown

Crypturellus noctivagus

Yellow-legged Tinamou

Crypturellus undulatus

Undulated Tinamou

Crypturellus variegatus

Variegated Tinamou

Crypturellus tataupa

Tataupa Tinamou

Crypturellus parvirostris

Small-billed Tinamou

Crypturellus obsoletus

Brown Tinamou

Tinamus tao

Gray Tinamou



54

Red-winged tinamou

Tinamus solitarius

08A

Species

RruGT

56

56

56

56

56

56

56

56

56

09D

















60

10D









52





54

04F

















60

12F

















54

06G









56

56





54

11G







53

55



53

51



A01

51













51



A11

53





53

53

53

53

53



A104







53





53

51



A106

Loci developed for T. major [5]















53



A108

51



51







51

51

53

E101

53



53

53

53

53

53

53



E105













51

53

53

E111

Table 2 Cross-species amplification for the ten microsatellite loci developed for Rhynchotus rufescens (RruGT) and ten for Tinamous major in eight tinamous species

51





51

51



51

53



E118

51





51

53



51

53



E119

Author's personal copy

Mol Biol Rep

123

Author's personal copy Mol Biol Rep

species of two genera: Tinamus solitarius, T. tao, Crypturellus notivagus, C. tataupa, C. parvirostris, C. variegatus, C. obsoletus and C. undulatus. Two individuals of each species were analyzed. Three annealing temperatures (50, 53, and 56°C) were used with the same PCR conditions described above. Amplification products were visualized in 1.5% agarose gels, and fragments were sized by comparison with a 1 kb Plus DNA ladder (Invitrogen). Primer pairs that amplified fragments with similar sizes than those observed in source species were considered as successful cross-species amplification. For most of positive amplifications, one individual was sequenced and the presence of microsatellites was confirmed.

Results and discussion In total, 41 alleles were obtained from all loci. The number of alleles per locus ranged from 2 to 12 (Table 1). No evidence of significant linkage disequilibrium was found among the tests for each pair of loci. Of these 10 microsatellite loci, four displayed no polymorphism and only two polymorphic loci had two alleles (RruGT06G and RruGT12F). Among polymorphic loci, the observed heterozygosity (HO) ranged from 0.273 to 0.818, whereas the expected heterozygosity (HE) ranged from 0.267 to 0.860 (Table 1). All loci conformed to HWE after sequential Bonferroni correction (P [ 0.006). However, Microchecker detected two loci (RruGT12A and RruGT10D) which scoring errors or null alleles may be present. On considering all the loci, the potential of paternity/maternity exclusion was greater than 98% and probability of identity was lightly low (4.95 9 10-5), indicating the suitability of these loci for parentage testing and genetic population studied in the red-winged tinamou. Overall, a moderate level of cross-species amplication was observed across the eight tinamou species tested (Table 2). Of the 160 locus/taxon combinations, 46 (28.75%) successfully amplified. The best cross-amplification results were observed in the T. solitarius and T. tao using T. major primers pairs (Table 2). These results are not surprising considering that those species belong to the same genus. Before developing R. rufencens primers, we tested ten primer pairs CAU1, CAU7, CAU14, CAU17, CAU40, CAU83, CAU85 [16], OSM4, OSM5 and OSM6 [17] previously developed from ostrich (Struthio camelus), one of the sister species of the red-winged tinamou. Although some primers amplified R. rufencens DNA, multiple undefined and unwanted products were obtained and the optimization of PCRs was not possible. Some ostrich primers have been previously tested to amplify in great tinamou and optimization of PCRs was also not possible [5].

123

Acknowledgments The authors are very grateful to researchers and technicians of the Centro de Biologia Molecular e Engenharia Gene´tica (CBMEG -Unicamp) for assistance to build a tinamou library, Gislaine Aparecida Fernandes of the Laborato´rio de Gene´tica e Biodiversidade da UFG for technical assistance in bird genotypings, and two anonymous reviewers for helpful suggestions and comments on a previous version of this paper. We thank Dr. Mariana Pires de Campos Telles for technical suggestions.

References 1. Cabot J (1992) Order Tinamiformes. In: Hoyo JD, Elliott A, Sargatal J (eds) Handbook of the birds of the world, vol 1. Lynx Ediciones, Barcelona, pp 112–138 2. Handford P, Mares MA (1985) The mating system of ratites and tinamous: an evolutionary perspective. Biol J Linn Soc 25:77–104 3. IUCN (2011) IUCN Red List of Threatened Species version 2011.1. http://www.iucnredlist.org. Accessed 11 July 2011 4. Cromberg VU, Stein MS, Boleli IC, Tonhati H, Queiroz SA (2007) Reproductive and behavioural aspects of red-winged tinamous (Rhynchotus rufescens) in groups with different sex ratios. Brazil J Poult Sci 9:161–166 5. Brennan PLR, Hyseni C (2008) Development of microsatellite markers for parentage analysis in the great tinamou (Tinamus major). Mol Ecol Res 8:933–935 6. Billotte N, Lagoda PJL, Risterucci AM, Baurens FC (1999) Microsatellite-enriched libraries: applied methodology for the development of SSR markers in tropical crops. Fruits 54:277–288 7. Martins WS, Lucas DCS, Neves KFS, Bertioli DJ (2009) WebSat—A web software for microsatellite marker development. Bioinformation 3:282–283 8. Rozen S, Skaletsky HJ (2000) Primer3: on the www for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics methods and protocols: methods in molecular biology. Humana Press, Totowa, pp 365–386 9. Creste S, Tulmann Neto A, Figueira A (2001) Detection of single sequence repeat polymorphisms in denaturing polyacrylamide sequencing gels by silver staining. Plant Mol Biol Rep 19:299–306 10. Raymond M, Rousset F (1996) Genepop: population genetics software for exact tests and ecumenicism. J Heredity 86:248–249 11. Rice WR (1989) Analyzing tables of statistical tests. Evolution 43:223–225 12. Paetkau D, Calvert W, Stirling I, Strobeck C (1995) Microsatellite analysis of population structure in Canadian polar bears. Mol Ecol 4:347–354 13. Weir BS (1996) Genetic data analysis II: methods for discrete population genetic data. Sinauer Associates, Sunderland 14. Wagner HW, Sefc KM (1999) Identity 1.0. Centre for Applied Genetics. University of Agricultural Sciences, Vienna 15. van Oosterhout C, Hutchinson WF, Wills DP, Shipley P (2004) Micro-checker: software for identifying and correcting genotyping errors in microsatellite data. Mol Ecol Notes 4:535–538 16. Tang B, Huang YH, Lin L (2003) Isolation and characterization of 70 novel microsatellite markers from ostrich (Struthio camelus) genome. Genome 46:833–840 17. Kimwele CN, Graves JA, Burke T, Hanotte O (1998) Development of microsatellite markers for parentage typing of chicks in the ostrich Struthio camelus. Mol Ecol 7:247–255

Suggest Documents