Conservation Genet Resour (2011) 3:33–36 DOI 10.1007/s12686-010-9275-5
TECHNICAL NOTE
Isolation and characterization of tri and tetranucleotide microsatellite markers for the tambaqui (Colossoma macropomum, Serrasalmidae, Characiformes) Igor Guerreiro Hamoy • Fernanda Witt Cidade • Maria Silvanira Barbosa • Evonnildo Costa Gonc¸alves Sidney Santos
•
Received: 20 May 2010 / Accepted: 6 July 2010 / Published online: 17 July 2010 Ó Springer Science+Business Media B.V. 2010
Abstract We isolated 13 tri and tetranucleotide microsatellite markers for the species Colossoma macropomum that can be used in management programmes for this species of Amazon fish. This panel of microsatellite markers was used in the genotyping of 20 individual ´ bidos city, in the specimens collected in the lakes of O Brazilian Amazon. The number of alleles per locus varied from four to ten. The observed heterozygosity varied from 0.31 to 0.95. We observed no significant deviation from the expected Hardy–Weinberg equilibrium assumption. In the sample investigated, it was not possible to identify any significant linkage disequilibrium among the 78 possible loci pairs. In our analysis, we found no indication of genotyping error attributed to stutter bands, large allele dropout or null alleles. Keywords Colossoma macropomum Tambaqui Microsatellite Tri and tetranucleotide
I. G. Hamoy (&) S. Santos Laborato´rio de Gene´tica Humana e Me´dica, Instituto de Cieˆncias Biolo´gicas, Universidade Federal do Para´, Cidade Universita´ria Prof. Jose´ da Silveira Netto. Av. Augusto Correˆa, 01, Bele´m, PA, Brazil e-mail:
[email protected] F. W. Cidade Centro de Biologia Molecular e Engenharia Gene´tica, Universidade Estadual de Campinas, Campinas, SP, Brazil M. S. Barbosa E. C. Gonc¸alves Laborato´rio de Polimorfismo de DNA, Instituto de Cieˆncias Biolo´gicas, Universidade Federal do Para´, Cidade Universita´ria Prof. Jose´ da Silveira Netto. Av. Augusto Correˆa, 01, Bele´m, PA, Brazil
The tambaqui (Colossoma macropomum) is the second largest scale fish of the Amazon ichthyofauna. It has considerable economic importance for commercial fishing and for breeding in captivity (Calcagnotto and Toledo-Filho 2000). It is being caught in increasing numbers, threatening the natural inventory of the species (Isaac and Ruffino 1996; Vieira et al. 1999; Garcia et al. 2009). Estimating the genetic diversity of cultured and natural populations is one of the most important methods of evaluating a species’ viability. For most fish species, this kind of investigation has been centred on the analysis of the variability of microsatellite markers (Perez-Enriquez et al. 1999; Hamoy et al. 2008). Santos et al. (2009) were the first to isolate microsatellite markers for C. macropomum. All of these isolated markers consisted of two base pair motifs (dinucleotides). The laboratory analysis of dinucleotides is complex and frequently presents PCR artefacts (stutter bands) that result in genotyping errors, which can compromise the results. Microsatellite markers consisting of a motif with three nucleotides (trinucleotides), or four (tetranucleotides) or more, are more stable and produce fewer PCR artefacts (Fishback et al. 1999; Clarke et al. 2001; Olsen et al. 2002; Li et al. 2007). The present work was conducted with the main purpose of isolating and characterising tri and tetranucleotide microsatellite markers that can be employed to obtain reliable genetic variability estimates for Colossoma macropomum. Four subgenomic libraries enriched for microsatellites were constructed and screened for GAAAn, ACAGn, ACTGn and ACCTn repeats following protocols modified from those of Kijas et al. (1994) and Arruda et al. (2010). Total genomic DNA was extracted from tissue digested in a proteinase K/sodium dodecyl sulphate solution. DNA was purified using the standard phenol/chloroform method,
123
34
Conservation Genet Resour (2011) 3:33–36
followed by precipitation with isopropanol (Sambrook and Russel 2001). Ten micrograms of genomic DNA was digested with Sau3AI. The 300–1,000 bp size fractions were purified using an illustraTM GFXTM PCR and Gel Band Purification Kit (GE Healthcare) and ligated to Sau3AI adaptors (AdapF/AdapR) using T4 DNA ligase. The DNA fragments were amplified by polymerase chain reaction (PCR), using AdapF as primer, with a limited number of cycles (18 cycles) to avoid redundant clones in the libraries. Adaptor-ligated DNA was denatured and hybridised to biotinylated (GAAA6, ACAG6, ACTG6 and ACCT6) probes at 55°C for 5 h. We recovered fragments containing microsatellite repeats using streptavidin-coated magnetic beads (Dynal). The sample was eluted 1 in 100 lL TE buffer, and PCR using AdapF primer was conducted to make fragments double-stranded. PCR products were ligated into pGEM-T Easy Vector (Promega)
overnight and then desalted before electroporation into Escherichia coli TOP 10 (Invitrogen). We plated cells on 2XYT-agar/Ampicillin/X-gal. After incubation at 37°C for 14 h, white colonies were transferred into 96-well plates with highly enriched Tartoff-Hobbs Broth/Ampicillin medium and grown at 37°C for 6 h. The libraries were glycerolised and stored at -20°C. A total of 384 clones (96 for each probe) were sequenced with M13 forward and reverse primers using the BigDyeÒ v3.0 (Applied Biosystems) kit. The sequencing products were separated in the Applied Biosystems 3130 Genetic Analyzer. The WebSat program (Martins et al. 2009) was used to locate the perfect tri and tetranucleotide microsatellites with more than five repetitions. The microsatellites found were edited and aligned with the Bioedit (Hall 1999) program, and the redundant clones were removed. At the end of this step, we found 21
´ bidos city, in the Table 1 Characteristics of 13 microsatellites isolated from Colossoma macropomum, genotype in 20 individuals from O Brazilian Amazon, F forward primer, R reverse primer Loci
GenBank accession
Primer (50 ? 30 )
Cmacrl01 HM579948 F: *CAGTTCACCCACTCAGCCTT
Repeat motif Size range Flourescent Na Ho in library (bp) dye
He
PHWE
(CCT)7
124–142
6-FAM
6 0.55 0.76 0.0606
Cmacrl02 HM579949 F: *GAATCAAAGGAAAGAAGTACGGAG
(ACAG)10
201–253
6-FAM
9 0.60 0.85 0.2327
R: AAATGGCACAGCAGTTTAAGGT Cmacrl03 HM579950 F: *GCATCAAATAGGCACGAGTTCT
(AGAA)10
269–289
6-FAM
6 0.70 0.76 0.2369
(AAGA)12
315–347
6-FAM
8 0.95 0.82 0.8564
(TTTC)11
107–127
HEX
6 0.85 0.78 0.3473
(GATG)7
150–174
HEX
5 0.50 0.57 0.1740
(TGTA)6
212–256
HEX
8 0.68 0.76 0.1066
(AGAC)7
344–356
HEX
4 0.31 0.55 0.3188
(GATG)5
105–129
NED
7 0.70 0.79 0.0685
Cmacrl10 HM579957 F: *TAGTTAATCGGTCCAGGTGAGG (ACAT)8 R: GTTGGCTACTTGGTTATAGAAAATGTT
225–245
NED
7 0.70 0.79 0.4673
Cmacrl11 HM579958 F: *GACAGGTGAGTGATTGTGAATGTAA
(GAAA)13
298–326
NED
8 0.62 0.80 0.1213
(TCA)13
129–156
PET
10 0.60 0.87 0.2451
(CTTT)12
189–217
PET
8 0.80 0.82 0.5791
R: AAAACCTGTAGAAGAGCACATGAA
R: GCTCTCAGCAACACATTACTGG Cmacrl04 HM579951 F: *CCTTTCTATGTTCTCATCCCAAA R: GCTTTGTGCGAAGGTTTCA Cmacrl05 HM579952 F: *TCTCTACAGGCCGAACCAAT R: CGCGTCGTTCTTCTCAAAT Cmacrl06 HM579953 F: *ACCTGTATCCTGCCTTCTGC R: CACTCATGCTTTCTCATTCACATAC Cmacrl07 HM579954 F: *TGCTCACACAGAGAGAAGTGAAG R: GAGTACGGAGGCTGATGAAGAG Cmacrl08 HM579955 F: *ATGTATTGGTGATAGTGATGGGTG R: CGGGTAACACACACAAACCTT Cmacrl09 HM579956 F: *CTGGGATAGGCTCCAGCA R: TGGCACTCCAGCAAACTG
R: TGACTACTGTGTTTGGTGCTGAC Cmacrl12 HM579959 F: *CTGTGCGTGTGACGTTAATATGT R: TTCTCTGCTCTCCTGACTGCTAC Cmacrl13 HM579960 F: *TTTTAGGCCCAGTGATTGTAGTC R: CTGCTGCTTACTATGGGTGAAAG Na number of alleles, Ho observed heterozygosity, He expected heterozygosity. PHWE probability of deviation from Hardy–Weinberg equilibrium after Bonferroni correction *Flourescent dye added in the forward primer
123
Conservation Genet Resour (2011) 3:33–36
microsatellite markers, for which primer pairs were designed with the same annealing temperature of 60°C using the Primer 3 program (Rozen and Skaletsky 2000). The individual amplification reactions were conducted in 12 lL containing 10 mM Tris–HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 5–25 ng of DNA, 0.3 lM of each primer, 0.125 mM of dNTPs and 1 U of Taq DNA polymerase. The PCR program was adjusted to following format: one cycle at 95°C for 5 min; 6 cycles at 94°C for 1 min, 60°C for 0.5 min and 72°C for 1 min; followed by 25 cycles at 94°C for 1 min, 60°C for 0.5 min and 72°C for 1 min; and a final extension at 72°C for 30 min. Evidence of polymorphism was initially verified in 7% nondenaturing polyacrylamide gels and stained with silver nitrate. Eight of the 21 loci tested were monomorphic, the remaining 13 polymorphic microsatellites were selected and fluorescently tagged by adding 6-FAM, HEX, NED and PET of the forward primer (Table 1). The individual PCR targets followed the same protocol as for the non-target PCRs described above. The amplification products were separated on an Applied Biosystems 3130 Genetic Analyzer. Allele sizes were stipulated using the size standard GeneScan 500 Liz (Applied Biosystems). Samples were genotyped using the software GeneMapper 3.7 (Applied Biosystems). To determine possible genotyping errors and null alleles we used the Micro-Checker program (Oosterhout et al. 2004). We analysed the genetic variability using the observed and expected heterozygosity and Hardy–Weinberg equilibrium deviations. We also estimated the allele number per locus and compared the proportion of locus pairs in linkage disequilibrium. All tests were carried out using the Arlequin 3.01 software (Excoffier et al. 2005) with the Bonferroni correction (Rice 1989). The 13 polymorphic tri and tetranucleotide microsatellites were used to genotype 20 individuals collected in the ´ bidos city located in the Brazilian Amazon. The lakes of O number of alleles per locus varied from 4 to 10, and the observed heterozygosity varied from 0.31 to 0.95. No Hardy–Weinberg equilibrium deviations were observed in the loci, and no significant linkage disequilibrium was found in the loci pairs. Additionally, we found no indication of genotyping errors attributed to stutter bands, large allele dropout or null alleles (Table 1). Acknowledgments This research was supported by Conselho Nacional de Desenvolvimento Cientı´fico e Tecnolo´gico (CNPq) and Financiadora de Estudos e Projetos (FINEP).
References Arruda MP, Morielle-Versute E, Silva A, Schneider MPC, Gonc¸alves EC (2010) Twelve polymorphic microsatellite loci developed
35 and optimized from the Leptodactylus chaquensis. Conserv Genet Resour. doi:10.1007/s12686-010-9204-7 Calcagnotto D, Toledo-Filho SA (2000) Loss of genetic variability at the transferrin locus in five hatchery stocks of tambaqui (Colossoma macropomum). Genet Mol Biol 23(1):127–130. doi: 10.1590/s1415-47572000000100023 Clarke LA, Rebelo CS, Gonc¸alves J, Boavida MG, Jordan P (2001) PCR amplification introduces errors into mononucleotide and dinucleotide repeat sequences. J Clin Pathol Mol Pathol 54:351–353. doi:10.1136/mp.54.5.351 Excoffier L, Laval G, Schneider S (2005) Arlequin 3.01: an integrated software package for population genetics data analysis. Evol Bioinformatics Online 1:47–50 Fishback AG, Danzmann GR, Sakamoto T, Ferguson MM (1999) Optimization of semi-automated microsatellite multiplex polymerase chain reaction systems for rainbow trout (Oncorhynchus mykiss). Aquaculture 172:247–254. doi:10.1016/s0044-8486(98) 00434-7 Garcia A, Tello S, Vargas G, Duponchelle F (2009) Patterns of commercial fish landings in the Loreto region (Peruvian Amazon) between 1984 and 2006. Fish Physiol Biochem 35:53–67. doi:10.1007/s10695-008-9212-7 Hall TA (1999) Bioedit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acid S 41:95–98 Hamoy IG, Santos EJM, Santos SEB (2008) Rapid and inexpensive analysis of genetic variability in Arapaima gigas by PCR multiplex panel of eight microsatellites. Genet Mol Res 7(1):29–32. doi:10.4238/vol7-1gmr394 Isaac VJ, Ruffino ML (1996) Population dynamics of tambaqui, Colossoma macropomum Cuvier, in the lower Amazon, Brazil. Fish Manag Ecol 3:315–333. doi:10.1046/j.1365-2400.1996.d01-154.x Kijas JMH, Fowler JCS, Garbett CA, Thomas MR (1994) Enrichment of microsatellites from the citrus genome using biotinylated oligonucleotide sequences bound to streptavidin-coated magnetic particles. Biotechniques 16:656–662 Li Y, Wongprasert K, Shekhar M, Ryan J, Dierens L, Meadows J, Preston N, Coman G, Lyons RE (2007) Development of two microsatellite multiplex systems for black tiger shrimp Penaeus monodon and its application in genetic diversity study for two populations. Aquaculture 266:279–288. doi:10.1016/j.aqua culture.2007.01.038 Martins WS, Lucas DCS, Neves KFS, Bertioli DJ (2009) WebSat—a web software for microsatellite marker development. Bioinformation 3(6):282–283 Olsen JB, Lewis J, Kretschmer EJ, Wilson L, Seeb JE (2002) Characterization of 14 tetranucleotide microsatellite loci derived from Pacific herring. Mol Ecol Notes 2:101–103. doi:10.1046/ j.1471-8286.2002.00160.x Oosterhout CV, Hutchinson WF, Wills DPM, Shipley P (2004) MICRO-CHECKER software for identifying and correcting genotyping errors in microsatellite data. Mol Ecol Notes 4:535–538. doi:10.1111/j.14718286.2004.00684.x Perez-Enriquez R, Takagi M, Taniguchi N (1999) Genetic variability and pedigree tracing of a hatchery-reared stock of red sea bream (Pagrus major) used for stock enhancement, based on microsatellite DNA markers. Aquaculture 173:413–423. doi:10.1016/ s0044-8486(98)00469-4 Rice WR (1989) Analyzing tables of statistical tests. Evolution 43:223–225 Rozen S, Skaletsky HJ (2000) Primer 3 on the www for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics methods and protocols: methods in molecular biology. Humana press, Totowa, pp 365–386 Sambrook J, Russel D (2001) Molecular cloning: a laboratory manual, 3rd edn. Cold Spring Harbor Laboratory Press, New York
123
36 Santos MCF, Hrbek T, Farias IP (2009) Microsatellite markers for the tambaqui (Colossoma macropomum, Serrasalmidae, Characiformes), an economically important keystone species of the Amazon River floodplain. Perm Genet Res Note 9:874–876. doi: 10.1111/j.1755-0998.2008.02331.x
123
Conservation Genet Resour (2011) 3:33–36 Vieira EF, Issac VJ, Fabre´ NN (1999) Biologia reprodutiva do Tambaqui, Colossoma macropomum Curvier, 1818 (Teleostei, Serrasalmidae), no Baixo Amazonas, Brasil. Acta Amazonica 29(4):625–638
