Isolation, characterization and chromosomal

0 downloads 0 Views 956KB Size Report
segment of chromosome 6 by in situ hybridization. (DAVIES et al. 1988 ... PGD and its chromosomal assignment by in situ ..... Blood Gro~cp.r Rioc.hcr~l. G'c~ncr.

Isolation, characterization and chromosomal assignment of a partial cDNA for porcine 6-phosphogluconate dehydrogenase INGRID HARBITZ', BHANU CHOWDHARY', RHENUKA CHOWDHARY', EIRIK FRENGEN', INGEMAR GUSTAVSSON' and WILLIAM DAVIES'

SISSEL KRAN',

'Department of Biochemistry, The Norwegian College of Veterinary Medicine, Oslo, Norway 2Departmentof Animal Breeding and Genetics, Swedish University of Agricultural Sciences, Uppsala, Sweden

HARBITZ,I., CHOWDHARY, B . , CHOWDHARY, R., K R A N , S., FRENGEN, E., GLISTAVSSON, I. and DAVIES,W . 1990. Isolation. characterization and chromosomal assignment of a partial cDNA for porcine 6-phosphogluconate dehydrogenase. - He!-editas112: 83-88. Lund. Sweden. ISSN 0018-0661. Received December 19, 1989. Accepted January 17. 1990

A partial cDNA for 6-phosphogluconate dehydrogenase (PGD, EC 1.1.1.44) was isolated from a porcine liver cDNA library using a rat PGD cDNA. The identity of the PGD cDNA was confirmed by DNA sequencing and comparison of the amino acid sequence with the correspondingovine sequence. The P G D cDNA was assigned to 6q2.5-2.7 by in situ hybr~dization.

Ingrid Harbitz, Department of Biochemistry, The Norwegian College of Veterinary Medicine, Box 81 46 D e p . , N-0033 Oslo 1. Norway

The Halothane (HAL) linkage group, which com- Materials and methods prises the loci for glucosephosphate isomerase Isolation ofporcine PGD cDNA (GPI), H A L , the blood groups S and H , atB-glycoprotein ( A I B G ) and 6-phosphogluconate de- Rat P G D cDNA was isolated from p6PGD-1 hydrogenase (PGD), has been one of the most (MIKSICEK and TOWLE 1983) by PstI digestion, prepaintensively studied linkage groups in pigs (JORGENSENrative low melting agarose gel electrophoresis. and 1981; ANDRESEN 1981; IMLAH 1982; RASMUSEN 1981; purification on Gene Clean (BIO101, La Jolla, JUNEJA et al. 1983; GAHNE and JUNUA 1985; ARCHIBALDUSA). A porcine liver cDNA library in lambda and IMLAH1985; VOGELI1989). The HAL locus is gtlO was screened with the 32P-labelledrat cDNA as et al. (1982). A P G D positive important with respect to the genetic predisposition described by MANIATIS of pigs to develop PSS under stress conditions. The lambda clone was isolated, lambda D N A purified, most likely gene order in the linkage group is now and the EcoRI insert excised from a low melting known, but the exact position of HAL relative agarose gel and subcloned in pBluescript SK(-) to GPI is still a subject of discussion (VOGELI1989). (Stratagene) to give plasmid pSK-PGD. P G D It is widely accepted that P G D is located farthest cDNA was isolated from pSK-PGD by EcoRI from HAL. G P I has been localized to the ~ 1 2 3 2 1 digestion and preparative low melting agarose gel segment of chromosome 6 by in situ hybridization electrophoresis followed by purification on Gene (DAVIES et al. 1988; CHOWDHARY et al. 1989) and Clean. assigned to chromosome 6 by enzyme expression in pig-Chinese hamster cell hybrids (BOSMAet al. DNA sequencing 1989). The present study describes the isolation and characterization of a porcine partial cDNA for Plasmid pSK-PGD was digested with EcoRI and PGD and its chromosomal assignment by in situ the insert separated on a low melting point agarose gel. T h e insert was cut out, dialysed in T E buffer hybridization.

overnight, cut into four portions, and digested in situ In situ hybridization with RsaI, HaeIII, AluI and Sau3A. The fragments The technique of in situ hybridization was essentiwere purified on Gene Clean and subcloned in et al. (1989) ally the same as described by MAKINEN pBluescript SK(-) digested with the appropriate et with the modification suggested by CHOWDHARY enzymes (SmaI or BamHI) and dephosphorylated. al. (1989). The concentration of the probe D N A in For the ordered deletions, pSK-PGD was digethe hybridization mixture was I00 pg/ml (3 ndslide). sted with XhoI, Klenow filled in with thio derivaThe slides were exposedfor 18-25 days in light tight tive dNTP, and digested with HindIII. Ordered boxes with desiccator at +4"C. deletions were then generated by exonucleaseIII and S l nuclease treatment according to the suppliers' instructions (Pharmacia). Ligation mixes were transformed in E. coli XLl-Blue (Stratagene) and positive clones (white o r pale blue colonies) Results selected on ampicillin1X-gal1IPTG plates. Plasmid Characterization of porcine PGD cDNA mini-preps were prepared (BIRNBOIM and DOLY 1979) and the insert sizes estimated by agarose gel The nucleotide and the corresponding amino acid electrophoresis. The plasmids from the shotgun sequences of the porcine P G D cDNA are shown in cloning and the ordered deletions were treated with Fig. 1 (EMBL accession number X16638 PGD). 0.2M NaOH for 3 min at 65°C and passed through The nucleotide sequence contains one open reading a Sephacryl S-300 spun column prior to sequencing frame coding for 249 amino acids. Amino acid comby the dideoxy chain termination method (SANGER parison with ovine P G D (CARNE and WAI.KER 1983) et al. 1977) using T7 (deletions) and KS (shotgun) indicated 95 % homology with cyanogen bromide primers and T7 polymerase according to the sup- generated peptides (indicated in the legend of Fig. pliers' instructions (Pharmacia). D N A sequences 1).The porcine P G D amino acid sequence was also were aligned and analysed using DNASIS software compared using a Harr plot to the P G D amino acid sequence from E. coli (NASOFF et al. 1984) and B. (Hitachi). subtilis (FUIITA et al. 1986). A very low degree of homology was observed, but, nevertheless, a linear relationship of homologous regions was preserved along the sequence (results not shown). Two pepLabelling of D N A probes tide regions showed a high degree of conservation. Rat and porcine P G D cDNA was labelled with "PThe first peptide, IRDSAGQKGTGKWTAISAdCTP by the random priming method (FEINBERG LEYGVPVTLIGEAVFARCLSSLKDERVQAand VOCELSTEIN 1983) to a specific activity of 3 x 10" SKKLKG (start 22 pig), showed 96 % , 64 %, and cpmlpg D N A . Tritium labelling of the porcine 56 % homology with the ovine, E. coli (start 255), probe was done by the random priming method and B. subtilis (start 254) sequences, respectively. modified by LINet al. (1985) to a specific activity of The second peptide, MLPANLIQAQRDYFGA4 x 10' dpmlyg D N A . H T Y E (start 204 pig) showed 100 %, 90 O/O, and 80 % homology with the ovine, E. coli (start 437), and B. subfilis (start 437) sequences, respectively. The conserved peptides were investigated for Chrorno.~orne analysis homology to other proteins in the EMBL protein Chromosome preparations were obtained from data bank but no homologous sequences were pokeweed stimulated pig lymphocytes that had found. been cultured for 72 h. The metaphases were Gbanded after hybridization using the technique et al. (1985) and modified by described by POPESCU In situ hybridization HARBITZ et al. (1990). The grains scored were plotted on the standard idiogram of G-banded pig chromo- A total of 180 metaphases from 3 hybridization somes (Committee for the Standardized Karyotype experiments were used in the present study. The of the Domestic Pig 1988) and the results were ana- grains scored are presented on a standard idiogram lysed. using the standard statistical procedures. of G-banded pig chromosomes (Fig. 2), and a Chromosome measurements according to LINet al. representative G-banded metaphase along with a Giemsa stained autoradiographic picture is present(1980) were used.

34 100

I E I T A N I L K F P D A D G K H L L P K I R D S A G P K G T G K V 5' ATTGAGATCACGGCCAACATCCTCAAGTTCCAGGATGCCGACGGCAAGCACCTGCTGCCCAAGATCAGGGACAGCGCGGGACAGAAGGGCACCGGGAAGT T A I S A L E Y G V P V T L I G E A V F A R C L S S L K D E R V P GGACGGCCATCTCGGCCCTGGAGTATGGCGTCCCCGTCACCCTCATTGGAGAAGCAGTCTTTGCTCGATGCTTATCATCCCTGAAGGACGAGAGGGTTCA

67 200

A S K K L K G P P K I P F S G D K K S F L E D I R K A L Y A S K I AGCGAGCAAAAAGCTCAAAGGGCCTCAAAAGATCCAGTTTTCAGGAGACAAGAAATCCTTCCTGGAGGACATTCGAAAGGCCCTCTACGCCTCCAAGATC

100 300

l S Y T P G F H L L R P A A A E F G V S S T T E H R L H U R G G C 1 ATCTCCTACACTCAGGGCTTCATGCTGCTGAGACAGGCAGCCGCGGAATTTGGCTGGAGCTCAACTACGGAGCATCGCCTGATGTGGCGGGGGGGCTGCA

134 400

I R S V F L G K I K D A F D R N P G L P N L L L D D F F K S A V E TCATCAGGAGTGTGTTCCTGCGCAAGATAAAAGACGCGTTTGACCGCAACCCCGGGCTGCAGAACCTGCTCCTGGATGACTTCTTTAAGTCGGCGGTGGA

167 500

D C ~ D S V R R A V S T G V ~ T G I P M P C F T T A L S F Y D G GGACTGCCAGGACTCCTGGCGGCGCCCAGTCAGCACCCCCGTCCAGACAGGCATCCCCATGCCCTGCTTCACCACTGCCCTCTCCTTCTACGACGGGTAC

200 Y 600

R H E M L P A N L I P A O R D Y F G A H T Y E L L P S R D T S S T L AGACACGAGATGCTGCCGGCCAACCTGATCCAGGCGCACCGGGATTACTTCGGGGCTCACACCTATGAACTCTTGCCAAGCCGGGACACTTCGTCCACAC

234 700

T G O A T V A A C P P L R T R TAACTGGACAGGCCACGGTttCAGCGTGTCCTCCTCTTCGTACACGCTAACGAGTCGTGCCCGCCGCACAGCCAGGACATTCCATCTTCACGCACTGTCC

249 800

ACACGGCCCCTGCCCTGCCTTCTGCGCACATCTTTTAAAACAGTGTCAGAAGAGACTCCTCTGCAACATCAACCCAAGTTTACTTGCAAAGCAGTTCCAG

900

GAGAACCAGCACGCCTCTGCGGCCCCAGCACCATCCCACTGTGTGTGGACAGTTCTCGCCAGCTCCGGAAGGCAGCGTCCCGCAGTCCCGGGGGATTAGG

1000

GAGGCAGGGGGAGTCTGCCCTGACAGAGGCAGCGGCTCTCACCACATGGGTAGGAAAGGTTTTTATGGAATTTGATCAAACTGGAACCTTTGTATCATGC

1100'

AGCTGAATTC 3 '

Fig. 1. Nucleotide end amino acid sequence of the 3'-terminal region of porcine PGD. Amino acid 1-108, 109-128, 129-

187. 188-204, and 205-238 correspond to the ovine CNBr peptides CR13. CB1, CB2, CB3 and CBl4, respectively. The last 13 amino acids of CB14 and the last 24 amino acids of porcine PGD show no sequence homology. Numbers on the right margin correspond to the last nucleotide and amino acid on each line.

ed in Fig. 3. A total of 1052 grains were scored. of which 235 (22.3 % ) were located on chromosome 6. This chromsome forms 6.7 % of the total porcine genome (LINet al. 1980). Assuming a Poisson distribution, the statistical evalution revealed that the signal of the P G D prvbe was highly significant (x2=336.3, P

Suggest Documents