Isolation of Cryptococcus laurentii from Canada Goose ... - Springer Link

Springer 2006

Mycopathologia (2006) 162: 363–368 DOI 10.1007/s11046-006-0066-1

Isolation of Cryptococcus laurentii from Canada Goose guano in rural upstate New York Tera Filion1, Sarah Kidd3 & Karen Aguirre2,4 1

Department of Biology, Clarkson University, Potsdam, NY, USA; 2Department of Biology, Coastal Carolina University, P.O. Box 261954, Conway, SC, 29528-6054, USA; 3School of Occupational and Environmental Hygiene, University of British Columbia, Vancouver, BC, Canada; 4Trudeau Institute, Saranac Lake, NY, USA

Received 23 August 2006; accepted in revised form 6 September 2006

Abstract Cryptococcus neoformans and Cryptococcus gattii are etiologic agents of cryptococcal pneumonia and meningitis, potentially lethal syndromes associated with AIDS. A related species, Cryptococcus laurentii, has recently been implicated in several cases of human disease. Guano from Canada Goose (Branta canadensis), an organism that lives closely beside man and inhabits recreational space in rural and suburban areas, might be a significant environmental reservoir of Cryptococcus organisms in non-urban areas. Cryptococcal organisms were isolated from Canada Goose guano from a site in rural northern New York, with identification based upon colony and microscopic morphology, ability to metabolize L-Dopa to melanin, and positive reaction with a commercial anti-cryptococcal capsular polysaccharide latex bead agglutination test. DNA sequences from five positive isolates were identical to each other, and identical to the ITS1-5.8S-ITS2 sequences of C. laurentii strain CBS7140 (Accession AY315665) across a 511 bp sequence. All five isolates of C. laurentii possess three of the known virulence factors common to cryptococcal organisms that cause human disease: capsule, ability to grow at 37 C, and laccase activity. Key words: Cryptococcus neoformans, Cryptococcus laurentii, Canada Goose (Branta Canadensis)

Introduction Cryptococcus neoformans is a fungus that causes lethal meningitis and encephalitis in people with AIDS and with immune deficiencies associated with organ transplantation and cancer-related chemotherapy [1, 2]. It is believed that infection is initiated when desiccated yeast or airborne fungal spores are inhaled. The source of the spores may be bird guano, however, few cases of bird to human transmission have been reported [3–8] The organisms re-hydrate inside the lungs, and when the CD4+ T cell compartment is damaged or absent, may escape the lungs and spread hematogenously to other organs, eventually colonizing the brain [1, 2].

Under the recently revised taxonomy [9], C. neoformans serotype A and D strains are classified as C. neoformans var. grubii and C. neoformans var. neoformans, respectively. The serotype B and C strains have been re-grouped under the species designation C. gattii. Serotype A and D cryptococci are distributed worldwide, and primarily infect immunocompromised individuals. C. gattii, however, is usually encountered only in the tropics and sub-tropics, and can infect immunocompetent individuals [1]. Cryptococcus laurentii, a closely related species, is generally considered non-pathogenic but has recently been implicated in several cases of human disease – meningitis [10], pulmonary [11] and ophthalmic [12].

364 A significant source of infectious Cryptococcus organisms in urban areas is likely to be guano left by pigeons in parks, monuments and other structures, and AIDS patients are often advised to avoid such areas. No natural reservoir has as yet been identified as a source of rurally acquired cryptococcosis, in areas without significant pigeon populations. We tested whether Canada geese, which leave large amounts of guano in areas where humans congregate for recreational purposes, might be an important suburban and rural reservoir of infectious Cryptococcus organisms. Five isolates obtained from the banks of Lake Flower, at a popular picnic ground and recreational marina, in Saranac Lake, NY approximately 8 miles west of Lake Placid, were identified as cryptocccal organisms by the following criteria: individual and colony morphology, ability to metabolize L-dopa to melanin (laccase activity), positive agglutination score using a commercially available antibody-conjugated latex bead assay, and flow cytometry with polyclonal sera raised against C. neoformans capsule. Sequencing revealed that the five isolates were not, however C. neoformans organisms. Rather all five phenotypically positive isolates were identical to C. laurentii strain CBS7140 over a 511 bp sequence of the ITS1-5. 8S-ITS2 ribosomal DNA sequence. These events raise concerns that C. laurentii may be a significant source of human disease. Moreover, identification of cryptococcal organisms based solely upon phenological characteristics may result in mis-indentification of cryptococcal species. Correct identifications are fundamental if we are to understand the etiology of diseases caused by these opportunistic cryptococcal species and their natural history. Furthermore, species to species differences may exist in susceptibilities to anti-microbial agents.

Materials and methods Sample preparation Samples of Canada goose guano were scooped and bagged, then refrigerated until processed. Samples were dried in a sterile environment for several hours, to discourage mold growth in the samples. About 10–20 ml of sterile dH2O were added to each sample, depending on sample size. Samples were stirred and incubated at room temperature

for 30 min, and gravity filtered through Whatman paper. Each rehydrated sample was plated in duplicate on Sabouraud’s dextrose agar (sabdex) and L-Dopamine (L-DOPA) plates as described [13]. After approximately 14 days, colonies with a white to yellow color on sabdex agar, and a gray to black color on L-DOPA plates were picked and further purified by subculture on L-DOPA plates. Purified colonies were differentiated using Canavanine-Glycine-Bromthymol blue agar (CGB). Fungi The cap67 acapsular mutant and wildtype C. neoformans serotype D strains, (ATCC52817 and ATCC 24067, respectively), were obtained from ATCC. The mildly virulent serotype A strain 184A [14] was also used. All strains of yeast were maintained on sabdex as previously described [15]. Environmental isolates were compared to known cryptococcal strains with respect to colony and microscopic morphology, growth on L-DOPA and CGB plates and immunological tests. Melanin detection The two genes LAC1 and LAC2 [16], encode the enzyme laccase, which mediates production of melanin when cultures are grown on diphenolic substrates. Growth on L-DOPA agar is described above. Additionally, organisms were visualized with Fontana–Masson stain as described [17]. The stain allows visualization of melanized cell wall, and in some cases, demonstrated diffuse cytoplasmic staining as well. Cells were also emulsified in India ink to observe capsule morphology. Flow cytometry Samples were incubated with FITC-conjugated polyclonal sera raised against Cryptococcus neoformans (NCL-CN rabbit anti-C. neo, Novocastra, UK). The antibody detects all serotypes of C. neoformans. About 10,000–50,000 events were collected. Data analysis was conducted with CellQuest software (Becton Dickinson). DNA sequencing Universal fungal primers SR6R (5¢-AAGTAAAGTCGTAACAAGG–3¢) and LR1 (5¢-GGTTGGTTTCTTTTCCT–3¢) were used to amplify the ITS–5.82

365 S-ITS2 region of the rDNA [18]. The PCR products (550 bp) were gel purified and sequenced directly using an automated sequencing service (Nucleic Acids Protein Services Unit, UBC, Vancouver) in both the 5¢ and 3¢ directions. Sequences were manually edited using BioEdit Sequence Alignment Editor (T. Hall, Ibis Therapeutics, Carlsbad, CA). Sequences were aligned to existing fungal sequences in the NCBI database using the BLAST function. Antibody-enhanced latex agglutination Samples were incubated with latex beads coated with antibody raised against cryptococcal antigens (CR1003, Immuno-Mycologics, Norman, OK) according to the directions of the manufacturer.

Isolates 6, 7, 8, 9 and 15 were selected for further study by DNA sequence analyses. DNA sequence analysis of phenotypically positive Saranac Lake isolates ITS sequences from all five isolates were identical to each other, and identical to the ITS1-5.8S-ITS2 sequences of C. laurentii strain CBS7140 (Genbank Accession AY315665) across 511 bp sequence (Figure 1) with an expected probability of sequence identity due to chance of 0.0. These sequences were distinct from that of a C. neoformans serotype A strain ATCC90112 (Genbank Accession AJ493550). Discussion

Location and characterization of sampling site Samples of Canada Goose guano were collected from rural Saranac Lake, New York – a resort town located approximately 8 miles from Lake Placid in the Adirondack Mountains. Guano was collected from the shoreline of Lake Flower, a man-made lake frequented by recreational boaters and anglers. The collection site was adjacent to a popular picnic area and recreational marina, with close-cut lawn and birch, maple and fir trees.

Results Cryptococcal organisms were detected from Canada Goose guano samples from rural Saranac Lake, New York. Table 1 summarizes the results of the phenotypic tests described above. Colonies scored as positive when similar to known C. neoformans samples, i.e., round with non-serrated edges, white to beige, smooth. Microscopic morphology was also compared to known C. neoformans samples, with positive scores given to encapsulated, round to ovoid cells, growing singly rather than in chains, with melanized cell walls. Positive latex agglutination scores were scores of 3 or 4 by comparison to the score card distributed by the manufacturer, and the positive (score of 4) and negative (score of 1) controls included in the kit. Positive samples increased mean fluorescence intensity at least one log when incubated with antibodies raised against cryptococcal polysaccharide.

Cryptococcus isolates (identified by morphological, growth, enzymatic, and immunologic characteristics) were identified from Canada Goose guano collected from a site in rural northern New York State. These data describe a reservoir for potentially pathogenic fungus in guano from the Canada Goose. Previous studies of cloacal swabs and guano from the Canada Goose have detected the presence of Salmonella sp. and Shigella sp., bacteria, as well as the Cryptosporidia sp. protozoan in resident New Jersey geese [19]. This is the first study identifying Canada Goose as a reservoir of potentially infectious fungi. During the mid-1990s, the New York State Department of Environmental Conservation estimated the state population of resident geese at about 120,000 birds, with several hundred thousand additional migratory birds passing through via the Atlantic flyway [20]. In suburban and rural areas of the state, expanses of short grass, recreational and ornamental lakes and ponds, paucity of natural predators and tightly controlled hunting laws, have created an explosion in the resident population. The Canada Goose, originally welcomed to the US by hunters and birders alike, has become a nuisance species. An adult Canada Goose may produce 1–2 lbs of guano daily [20]. The bird’s predilection for parklike settings with close-cut grass and low predation keep the bird in close proximity to man, and Canada Goose guano may be a significant reservoir of disease if C. laurentii organisms are capable of producing infection.

366 Table 1. Putative cryptococcal isolates scored by multiple criteria Sample

Colony morphology

L-Dopa

03 05 06 07 08 09 15

+ + + + + + +

+ + + + + + +

assay

Microscopic morphologya

FACS

Latex agglutination

37 C

Nd Nd + + + + +

+/) + +/) +/) +/) +/) +/)

) ) + + + + +

Nd Nd + + + + +

Assays were scored independently either strongly positive or strongly negative, or intermediate, by two or in some experiments three individuals who did not know the identity of the samples. a Summation of similarity of appearance to known cryptoccal isolates when stained by: Fontana Masson technique, India Ink, and Alcian Blue. nd=not done.

Cryptococcus laurentii is only rarely isolated clinically, but it has recently been implicated in at least three cases [10–12] among immunocompromised individuals, and as a non-neoformans/gattii cryptococcal species may be considered an emerging infectious disease [21]. Detection of three cryptococcal virulence factors in the isolates described in this study underscores potential public health concerns since C. laurentii and other cryptococcal species are abundantly present in Canada Goose guano, and potentially in that of other birds whose habitats overlap that of humans.

Additionally, it appears likely that the impact of C. laurentii as a pathogen may be under-estimated due to mis-identification of the organism in clinical samples. Capsular polysaccharide of C. laurentii var. flavrescens Y 1401 cross-reacts with antibodies in polyclonal anti-pneumococcal sera [22], and more recently, serotypes A and D of C. neoformans and B and C of C. gattii, and capsular material released by C. laurentii were cross-reactive with antibodies raised against Aspergillus galactomannan [23]. Furthermore, intraspecies heterogeneity is observed in C. laurentii serologic response to

SL isolates * C. laurentii C. neoformans

10 20 30 40 50 60 70 80 90 100 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| ATTAAAGATTGACCGAAAGGTCTTATCTCTATATCCCTCACCTCTGTGAACTGTGGAC-----CTCCGGGTCTATTTA-ACAAACATC--AGTGTAATGA ..........................................................-----...............-.........--.......... .GAG..T....GA.TTC-....C-..T.A.C..-...ATCTACACC..TGAAC..TTTATGTG..T...CA.GT....C......T..TA.A........

SL isolates C. laurentii C. neoformans

110 120 130 140 150 160 170 180 190 200 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| ACGTATATATCATTA-AACAA-AACAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATT ...............-.....-.............................................................................. .T...-..C.T....T.....T..T............................TC.A...........................................


210 220 230 240 250 260 270 280 290 300 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTTTTGGTATTCCGAAAGGCATGCCTGTTTGAGTGTCATGAAA-TCTCAATCCCCCT ......................................................................................-............. ...................................A........C..............G................A.........A..........T.-


310 320 330 340 350 360 370 380 390 400 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GGGTTT-ATGATCTGGGTCGGACTTGGAAATGGGCGTCTGCCG-G---T-CACA------CGGCTCGCCTCAAATGACTTAGTGGATCTCTCTGCATCC......-....................................-.---.-....------.............................................T..T.C..--..T.........TT....T..T.....C.ACC.G..A.GGACGT..........T.....TG.......GAAGG.GATT.-..T


410 420 430 440 450 460 470 480 490 500 ....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....| GTGA--CAGACGTAATAAGTTTCGTCTTGTCCCTTGCT-TA----TGAGTCTGCTCATAACCTGCCATCGCGCACTTTTAGACTCTGACCTCAAATCAGG ....--................................-..----....................................................... ..C.GC.C.G..............CTGG.-..TA..GGG..GTCT.CG.CT....G.....A-A.....T.-----------------------------


510 520 530 540 ....|....|....|....|....|....|....|....|.. TAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA .......................................... ------------------------------------------

*SL isolates 6, 7, 8, 9 and 15 had identical sequences. See Materials and Methods for details of sequencing protocol.

Figure 1. Comparison of ITS1 sequence of C. laurentii strain CBS7140 (accession AY315665), C. neoformans strain ATCC90112 (accession AJ493550) and the Saranac Lake (SL) isolates.

367 antisera raised against C. neoformans capsular polysaccharide [23], with some isolates crossreacting and others giving negative scores. It is likely, therefore, that laboratories relying on phenotypic data like colony morphology and seroreactivity may mis-identify C. laurentii. It should be noted that in a recent study comparing efficacy of detection by API20 and ID32C systems by clinical laboratories, seven of seven C. laurentii isolates were correctly identified by laboratories using the API20C system, and six of seven were correctly identified by laboratories using the ID32C system, with one not identified [24]. However, eight of 114 clinical laboratories misidentified C. laurentii at least once, in a recent overt proficiency test [25]. Mis-identifications are important because of differing susceptibilities of the organisms to anti-fungal treatments. For example, the mean inhibitory concentration of flucytosine for C. laurentii has been reported as 10- to 20-fold greater than that of C. neoformans var. neoformans, and 40- to 100-fold higher than that of C. gattii [26], implying that a single course of therapeutic management may not be of uniform value for treatment of disease caused by different cryptococcal species. Inaccurate epidemiologic data may also hinder our understanding of the distribution and dispersal of pathogenic species in the environment, impeding attempts to understand the distribution and ecological niches of pathogenic fungi, and our ability to make common sense life-style recommendations to those at risk for cryptococcosis. DNAbased identifications of cryptococcal species have been used with considerable success, particularly in epidemiology studies, including electrophoretic karyotyping, mitochondrial DNA probes, PCR and AFLP fingerprinting, and multilocus enzyme typing [1]. Recently, a capillary electrophoresis-fragment length test using the C. neoformans and C. gattii pheromone genes has been reported [27]. We suggest that it would be prudent to further develop diagnostics and sequence databases for accurate detection of potentially pathogenic cryptococcal species other than C. neoformans and C. gattii, such as C. laurentii. It is not known whether other species of wild birds that live closely with man, (e.g. seagulls), are also potential sources of infectious cryptococcal species. In fact, the ecology and environmental trafficking of Cryptococcus species is a matter of speculation. It is possible that the fungus is carried

from tree hollows and other colonized sites (e.g. soil) [28–31] by air currents or insects and deposited in already-shed guano, which provides an advantageous biochemical niche. The data in this study lends support to the notion that fungi present in guano at a particular site likely originate from a single source. Intraspecies heterogeneity with respect to sequence [32] and seroreactivity [23] has been reported for C. laurentii, but C. laurentii isolates recovered at the Saranac Lake site appeared to be clonally related, as each reacted with anti-C. neoformans antisera, and every isolate was identical over the DNA sequences examined. Experiments are currently under way to determine the extent of colonization of Cryptococcal species among flora at the collection site described in this study, as well as surrounding air. Tests of virulence of environmental isolates in mice are also planned. Knowledge of the ecology of Cryptococcus species could make important contributions to our understanding of the epidemiology of infection. Acknowledgments We would like to acknowledge Melissa Sargent for her help with purifying the putative Cryptococcus neoformans samples, and Dr. Karen Bartlett from the School of Occupational and Environmental Hygiene, University of British Columbia for communications regarding environmental sampling and ecological reservoirs of Cryptococcus species. This study was supported by NIH grant AI:418881 and funds made available by Clarkson University and Coastal Carolina University.

References 1. Casadevall A, Perfect JR. Cryptococcus neoformans. Washington, DC: ASM Press, 1998. 2. Mitchell TG, Perfect JR. Cryptococcosis in the era of AIDS-100 years after the discovery of Cryptococcus neoformans. Clin Micro Rev 2005; 8: 515–548. 3. Tay ST, Chai HC, Na SL, Hamimah H, Rohani MY, SooHoo TS. The isolation, characterization and antifungal susceptibilities of Cryptococcus neoformans from bird excreta in Klang Valley, Malaysia. Mycopathologia 2005; 159: 509–513. 4. Prasad KN, Agarwal J, Nag VL, Verma AK, Dixit AK, Ayyagari A. Cryptococcal infection in patients with clinically diagnosed meningitis in a tertiary care center. Neurol India 2003; 51(3): 364–366.

368 5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

Pappalardo MCSM, Melhem MSC. Cryptococcosis: A review of the Brazilian experience for the disease. Rev Inst Med Trop S Paulo 2003; 45(6): 299–305. Cheung MC, Rachlis AR, Shumak SL. A cryptic cause of cryptococcal meningitis. CMAJ. 2003 Feb [cited 2003 Aug 22]; 168 (4):[about 5 p.]. Available from: . Nosanchuk JD, Rudolph J, Rosas AL, Casadevall A. Evidence that Cryptococcus neoformans Is Melanized in Pigeon Excreta: Implications for pathogenesis. Infect Immun 1999; 67(10): 5477–5479. Ruiz A, Bulmer GS. Particle size of airborne Cryptococcus neoformans in a tower. J Appl Environ Microbiol 1981; 41(5): 1225–1229. Kwon-Chung KJ, Boekhout T, Fell JW, Diaz M. Proposal to conserve the name Cryptococcus gattii against C. hondurianus and C. bacillisporus (Basidiomycota, Huymenomycetes, Tremellomycedtidae). Taxon 2002; 51: 804–806. Kordossis T, Avlami A, Velegraski A, Stefannotti I, Georgakopoulos G, Papalanbrott C, Legakis N. First report of Cryptococcus laurentii meningitis and a fatal case of Cryptococcus albidus cryptococcaemia in AIDS patients. J Med Mycol 1996; 36: 335–339. Kunova A, Kremery V. Fungaemia due to thermophilic cryptococci: 3 cases of Cryptococcus laurentii bloodstream infections in cancer patients receiving antifungals. Scand J Infect Dis 1999; 31: 328–331. Ritterband DC, Seedor JA, Shah M, Sabeed S, Schorr I. A unique case of Cryptococcus laurentii keratitis spread by a rigid gas-permeable contact lens in a patient with onychomycosis. Cornea 1998; 17: 115–118. Kwon-Chung KJ, Polacheck I, Popkin TJ. Melaninlacking mutants of Cryptococcus neoformans and their virulence for mice. J Bacteriol 1982; 150(3): 1414–1421. Murphy JW, Cozad GC. Immunological unresponsiveness induced by cryptococcal polysaccharide assayed by the hemolytic plaque technique. Infect Immun 1972; 5(6): 896–901. Hill JO, Aguirre KM. CD4+ T cell-dependent acquired state of immunity that protects the brain against Cryptococcus neoformans. J Immunol 1994; 152: 2344–2350. Missall TA, Moran JM, Corbett JA, Lodge JK. Distinct stress responses of two functional Laccases in Cryptococcus neoformans are revealed in the absence of thiol-specific antioxidant Tsa 1. Euk Cell 2005; 4(1): 202–208. Vilgalys R, Hester M. Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. J Bacteriol 1990; 172(8): 4238–4246. Roscoe DE. A survey to estimate the prevalence of Salmonella sp., Shigella sp., Yersinia sp. Bactreia and Cryptosporidia sp., Giardia sp. protozoa in resident Canada Geese (Branta canandensis) in New Jersey, 2001. www.state.nj.us/dep/fgw/pdf/2001/gooserpt. When Geese Become a Problem. Pamphlet of NYS Dept. of Environmental Conservation, Div. of Fish, Wildlife and Marine Resources and U.S. Department of Agriculture Animal and Plant Health Inspection Service, March 1999. Ikeda R, Sugita T, Jacobson ES, Shinoda T. Laccase and melanization in clinically important Cryptococcus species

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

other than Cryptococcus neoformans. J Clin Microbiol 2002; 40(4): 1214–1218. Heidelberger M, Bernheimer A. Cross-reaction of polysaccharides of fungi, molds and yeasts in anti-pneumococcal and other antisera. PNAS USA 1984; 81: 5247–5429. Dalle F, Charles PF, Blanc K, Caillot D, Chavanet P, Dromer F, Bornin A. Cryptococcus neoformans Galactoxylomannan contains an Epitope(s) that is cross-reactive with Aspergillus Galactoyxylomannan. J Clin Microbiol 2005; 43: 2029–2031. Ikeda R, Sugita T, Shinoda T. Serological relationships of Cryptococcus spp: Distribution of antigenic factors in Cryptococcus and intraspecies diversity. J Clin Microbiol 2000; 38: 4021–4025. Ramani R, Gromadzki S, Pincus D, Salkin IF, Chaturvedi V. Efficacy of AP120C and ID32C systems for identification of common and rare clinical yeast isolates. J Clin Microbiol 1998; 36(11): 3296–3308. Reilly A, Salkin IF, McGinnis MR, Gromadzki S, Pasarell L, Kemna M, Higgins Salfinger N M. Evaluation of mycology laboratory proficiency testing. J Clin Microbiol 1999; 37(7): 2297–2305. Cuenca-Estrella M, Gomez-Lopez A, Mellado E, GarciaEffron G, Rodriguez-Tudela JL. In vitro activities of Ravuconazole and four other antifungal agents against fluconazole-resistant or susceptible clinical yeast isolates. Antimicrobiol Agent 2004; 48(8): 3107–3111. Chaturvedi S, Dyavaiah M, Larsen RA, Chaturvedi V. Cryptococcus gattii in AIDS patients, Southern California. Emerg Infect Dis 2005; 11(11): 1686–1692. Evenson A, Lamb JW. Slime flux of mesquite as a new saprophytic source of Cryptococcus neoformans. J Bacteriol 1964; 88: 542. Katsu M, Kidd S, Ando A, Moretti-Branchini ML, Mikami Y, Nishimura K, Meyer W. The internal transcribed spacers and 5.8 S rRNA gene show extensive diversity among isolates of the Cryptococcus neoformans species complex. FEMS Yeast Res 2004; 4(4–5): 377–388. Lazera MS, Pires FD, Camillo-Coura L, Nishikawa MM, Bezerra CC, Trilles I, Wanke B. Natural habitat of Cryptococcus neoformans var. neoformans in decaying wood forming hollows in living trees. J Med Vet Mycol 1996; 34(2): 127–131. Lazera MS, Salmito Cavalcanti MA, Londero AT, Trilles I, Nishikawa MM, Wanke B. Possible primary ecological niche of Cryptococcus neoformans. Med Mycol 2000; 38(5): 379–383. Sugita T, Takashima M, Ikeda R, Nakase T, Shinoda T. Intraspecies diversity of C. laurentii, as revealed by sequences of ITS regions and 28s rRNA gene and toxonomic position of C. laurentii clinical isolates. J Clin Microbiol 2000; 56(4): 1468–1471.

Address for correspondence: Karen Aguirre, Department of Biology, Coastal Carolina University, P.O. Box 261954, Conway, SC, 29528-6054, USA Fax: +1-843-349-2201 E-mail: [email protected]