JNK MAPK Pathway Regulates Constitutive

The Journal of Immunology

JNK MAPK Pathway Regulates Constitutive Transcription of CCL5 by Human NK Cells through SP11 Dilip Kumar,* Judith Hosse,*† Christine von Toerne,* Elfriede Noessner,† and Peter J. Nelson2* The MAPKs ERK, JNK, and p38 control diverse aspects of the immune response, including regulation of cytotoxin biology in NK cells and CTL. The chemokine CCL5 is coreleased with the cytotoxins, perforin, the granzymes, and granulysin, during the lethal hit administered by cytotoxic CD8ⴙ T cells (CTL). CCL5 expression is up-regulated relatively late in CTL coincident with their functional maturation 3–7 days after activation. Unlike T cells, NK cells have the ability to kill virally infected or transformed cells when directly isolated from the peripheral circulation. In this study, we show that in contrast to T cells, peripheral blood NK cells express CCL5 constitutively. The use of specific inhibitors of the JNK, ERK, and p38 MAPK pathways showed that the JNK pathway controls expression of CCL5 by NK cells. Promoter-reporter assays identified a compact region of the CCL5 promoter responsible for the constitutive transcription of CCL5 by NK cells. EMSA, chromatin immune precipitation, the use of heterologous promoters, and site-directed mutagenesis demonstrated that transcription in NK cells is largely controlled through binding of the transcription factor specificity protein 1 to a region ⴚ75 to ⴚ56 upstream of the site of transcriptional initiation. Specificity protein 1 expression, and in turn the constitutive expression of CCL5, was found to be controlled through constitutive activation of the JNK/MAPK pathway in peripheral blood NK cells. The Journal of Immunology, 2009, 182: 1011–1020. atural killer cells have features similar to CD8⫹ T cells in that they recognize and lyse virally infected and neoplastic cells; express receptors such as CD28, CD43, and 2B4; and contain cytolytic granules (1– 6). The activation of NK surface receptors triggers microtubule organization, granule polarization, and cytotoxicity signals through both ERK2 and JNK1 phosphorylation pathways (7, 8). The chemokine CCL5 has been suggested to act as an important mediator of diverse inflammatory processes (9 –11). In CTL, the protein is associated with the development and expression of effector function (12–14). In CD8⫹ T cells, CCL5 transcription occurs late (3–5 days) after the activation of naive cells and is coincident with the up-regulation of perforin, the granzymes, and granulysin (15–17). A complex of nuclear proteins recruited to the promoter by Kru¨ppel-like factor 13 (KLF13)3 controls the transcription of CCL5 in CTL (18, 19). KLF13 is translationally regulated and appears several days af-

N

*Medizinische Poliklinik, Ludwig-Maximilians-University of Munich, Munich, Germany; and †Helmholtz Center, Munich, Institute of Molecular Immunology, Munich, Germany Received for publication July 25, 2008. Accepted for publication October 28, 2008. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1

This work was supported by grants from the Deutsche Forschungsgemeinschaft (SFB 571 C2 to P.J.N., and SFB-TR36 B6 and A7 to P.J.N. and E.N., respectively), the European Union (Network of Excellence “MAIN” FP6-502935 to P.J.N.), and P6 “INNOCHEM” (to P.J.N.).

2

Address correspondence and reprint requests to Dr. Peter J. Nelson, Medizinische Poliklinik, Ludwig-Maximilians-Universita¨t Mu¨nchen, Schillerstrasse 42, 80336, Munich, Germany. E-mail address: [email protected]

3

Abbreviations used in this paper: KLF13, Kru¨ppel-like factor 13; Act D, actinomycin D; ChiP, chromatin immunoprecipitation; CHX, cycloheximide; DAPI, 4⬘,6⬘-diamidino-2-phenylindole; ⌬MFI, ⌬ median fluorescence intensity; PKC, protein kinase C; qRT-PCR, quantitative RT-PCR; 5⬘ UTR, 5⬘ untranslated region.

Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00 www.jimmunol.org

ter T cell activation. The p38 and ERK1/2 MAPK pathways control KLF13 gene expression, whereas pre-mRNA processing factor 4 homolog B, a member of the MAPK family, regulates KLF13 phosphorylation in T cells and by extension CCL5 expression (20, 21). In NK cells, the MAPKs and PI3K pathways are also involved in triggering the polarized release of cytolytic granules (7, 8, 22–24); however, the role of these pathways in the control of CCL5 expression in NK cells has not been investigated. We report in this study that unlike in T cells, CCL5 mRNA is constitutively transcribed and translated in peripheral blood NK cells. The CCL5 protein is localized to secretory vesicles that are distinct from the cytolytic granules. The constitutive transcription of CCL5 mRNA in NK cells is mediated through binding of the SP1 transcription factor to a site just upstream from the TATA box of the CCL5 gene. The JNK/MAPK pathway in turn controls SP1 expression and, through this, constitutive CCL5 transcription.

Materials and Methods Abs, inhibitors, and oligonucleotides Phospho-specific Abs that recognize the activated forms of phospho-stressactivated protein kinase/JNK (Thr183/Tyr185) and inactive forms of stressactivated protein kinase/JNK were purchased from Cell Signaling Technology (catalog 9251 and 9252). The Abs for NF-␬B, p50, p52, p65, SP1, and SP3 were purchased from Upstate Biotechnology (catalog 06-886, 06413, 06-418, 07-645, and 07-107, respectively), and ␤ actin for proteinloading control and KLF13 was purchased from Abcam (catalog ab8227 and ab1127). Primary Abs were as follows: mouse IgG2b-anti-human CCL5 VL1 or VL2 hybridoma supernatant (25), mouse IgG1 anti-human granzyme B (Serotec; catalog MCA2120PE), mouse anti-human perforin (BD Biosciences; catalog 556434), goat anti-mouse IgG1 CD3 Pacific Blue (DakoCytomation; PB982), goat anti-mouse IgG1 CD56 allophycocyanin conjugated (BD Biosciences; catalog IM2474), and rabbit anti-human CD8 (Neomarkers; catalog RM-9116-R7). Isotype control Abs were as follows: unconjugated mouse IgG2b hybridoma supernatant (clone TIB 173; donation from E. Kremmer, Munich, Germany), unconjugated mouse IgG2b monoclonal isotype control (clone MPC-11; BD Biosiences; 559530), and PE-conjugated mouse IgG1 and ␬ monoclonal isotype control (clone

1012 W3125; Serotec; MCA928PE). Secondary Abs were as follows: goat antimouse IgG1 AlexaFluor A568, goat anti-mouse IgG2b AlexaFluor 488 (all from Invitrogen Molecular Probes), and goat anti-rabbit Cy5 (Dianova; Jackson ImmunoResearch Laboratories). PMA (P1585) and ionomycin (I3909) were purchased from Sigma-Aldrich; IL-2 from PeproTech (20002); and protein kinase C (PKC) inhibitors, PKC inhibitor 1 (Go¨6976) and PKC inhibitor 2 (Go¨6983), and PI3K inhibitor (LY294002) were purchased from Calbiochem (365250, 365251, and 440202, respectively). The MAPK inhibitors (ERK inhibitor, PD 98059; JNK inhibitor, SP600125; and p38 inhibitor, SB 203580) were purchased from Sigma-Aldrich. The following chip grade reagents were purchased from: chip grade reagents (formaldehyde; Sigma-Aldrich; catalog F8775); BSA (Promega; catalog R396A); herring sperm DNA (Roche Diagnostics; catalog 11467140001); pansorbin cells (Calbiochem; catalog 507862); RNase A (Roche Diagnostics; catalog 101.9134001); proteinase K (Roche Diagnostics; catalog 03115828001); tRNA (Ambion; catalog 7119); protease inhibitors (Roche Diagnostics; catalog 04693116001); and phosphatase inhibitors (Sigma-Aldrich; catalog P2850). Consensus or mutant DNA-binding sequences for specific transcription factors were purchased from Santa Cruz Biotechnology, and oligonucleotides corresponding to CCL5 promoter region ⫺75 to ⫺55 for EMSA probe preparation were synthesized by Metabion International.

Cell isolation, cell lines, culture conditions, and inhibitor treatment Human primary NK cells were isolated from healthy donors using a human NK negative isolation kit (Dynal Biotech; catalog 113.15), according to manufacturer’s protocol. Purity, assessed by anti-CD3 and anti-CD56 flow cytometry analysis, was ⬎97%. Freshly purified cells were cultured in RPMI 1640 (Invitrogen) supplemented with 10% human AB serum (Cambrex); 1% L-glutamin, 1% nonessential amino acids, and 1% sodium pyruvate (Invitrogen); and 200 U/ml rIL-2 (PeproTech). The human NK leukemia cell line YT was cultured in IMDM supplemented with 20% FBS, 1% glutamin, and 1% sodium pyruvate (Invitrogen). Inhibitors were used in the absence of serum. No toxicity was observed with the used concentrations (JNK and ERK inhibitors, 50 ␮M, and p38 inhibitor, 20 ␮M for primary NK cells; JNK and ERK inhibitors, 100 ␮M, and p38 inhibitor, 20 ␮M for YT cell line) (data not shown).

Intracellular CCL5, perforin, and granzyme B staining by flow cytometry Primary NK cells (1 ⫻ 106) were incubated for 12 h with JNK inhibitor (50 ␮M), ERK inhibitor (50 ␮M), p38 inhibitor (20 ␮M), cycloheximide (CHX, 10 ␮g/ml; Sigma-Aldrich; C-4859), and actinomycin D (Act D; 10 ␮g/ml; Sigma-Aldrich; A5156-1VL), or without inhibitor (control) in the absence of serum. Following incubation, cells were fixed with 1% paraformaldehyde and permeabilized with 0.1%, washed with 0.35% saponin, and stained for 30 min with primary Ab mouse IgG2b anti-human CCL5 hybridoma VL1 supernatant (25) (diluted 1/2 in 0.35% saponin/PBS/2% human serum, mouse-anti-human perforin (1:100), mouse IgG1 anti-human granzyme B-PE (1:10)) or the corresponding isotype controls. After staining, the cells were washed, and unlabeled primary Ab VL1 or perforin was detected with the secondary reagent goat anti-mouse IgG2b Alexa 488 (1:500; Invitrogen) for another 30 min, followed by a final wash step. Data acquisition was performed with the BD LSRII cytometer (BD Biosciences). Analysis was done with FlowJo Flow Cytometry Analysis Software (Tree Star). The ⌬ median fluorescence intensity (⌬MFI) was calculated by subtracting the median fluorescence intensity of the isotype control Ab from the median fluorescence intensity of the specific Ab staining.

Immune fluorescence staining and confocal laser microscopy Freshly isolated NK cells (5 ⫻ 105) were allowed to settle on poly(Llysine)-coated slides for 20 min before fixation in 100% acetone on ice. Nonspecific binding sites were saturated with 2% BSA in PBS. Cells were stained with the primary Abs against mouse IgG2b anti-human CCL5 hybridoma VL2 supernatant (diluted 1/2 in PBS/10% human serum), mouse IgG1 anti-human granzyme B (1:100), and rabbit antihuman CD8 (1:50) (to exclude T cells) for 1 h. Primary Ab binding was revealed with goat anti-mouse-IgG2b AlexaFluor 488 (1:500), goat antimouse-IgG1 AlexaFluor 568 (1:500), and goat anti-rabbit Cy5 (1:100). Cells were washed, fixed with 4% paraformaldehyde, counterstained with 4⬘,6⬘-diamidino-2-phenylindole (DAPI; 15 ␮g/100 ml; SigmaAldrich), and mounted using Vectashield mounting medium (Vector Laboratories). Fluorescence images were captured with a Leica TCS SP2 confocal system, equipped with lasers exciting at 488 and 543 nm

CONSTITUTIVE JNK DRIVES CCL5 IN NK CELLS (Ar/Kr), 633 nm (HeNe), and 405 nm (diode laser) on a Leica DM IRBE microscope stand with HCX PL APO 63 ⫻ 1.40 NA oil immersion objective lens (Leica Microsystems). Cells were examined with pinhole 1.0 Airy units, 1024 ⫻ 1024 pixel image format, six-frame averaging, and a TD488/568/633 dichroic beam splitter. To avoid possible crosstalk of the various fluorochromes, the width of the detection channels and filter settings were carefully controlled and, furthermore, images for A488, A568, Cy5, and DAPI were acquired using the sequential image recording method. For evaluation of colocalization, single z-planes were analyzed with Leica confocal software LCSLite (Leica Microsystems). For image presentation, size and contrast were adjusted with Adobe Photoshop CS software (Adobe Software).

RNA isolation and quantitative RT-PCR (qRT-PCR) Total mRNA from NK cells was isolated using the RNeasy Mini Kit (Qiagen) and reverse transcribed (Invitrogen; catalog 18064-14) with hexamer primer from Roche Diagnostics (catalog 11277081001). A real-time PCR was performed with 10 ng of cDNA and oligonucleotide primers (300 nmol/L) and probes (100 nmol/L) in AB Biosystem 7000. Primers and probes were from PE Biosystems. All TaqMan reagents were obtained from Applied Biosystems. The following PCR conditions were used for LightCycler: 2 min, 50°C, and 10 min, 95°C, followed by 40 cycles of 15 s, 95°C and 1 min, 60°C in 20 ␮l reactions.

Plasmids and transfection and luciferase assay The deletions and site-specific mutations of the human CCL5 promoter sequence were based on previously described pGL2- and pGL3-based plasmid constructs (pGL2/pGL3; Promega; catalog E1751) (17, 26 –28). Mutations in regions ⫺70 to ⫺58 and ⫺56 to ⫺42 were introduced into pGL3/⫺194 by site-directed mutagenesis by using the QuikChange SiteDirected Mutagenesis Kit (Stratagene; catalog 200523). The 5⬘ untranslated region (5⬘ UTR) in the CCL5 promoter was deleted by inverse PCR method. Wild-type and mutant either ⫺70 to ⫺58 or ⫺56 to ⫺42 dimer oligonucleotides (sequence spanning ⫺75 to ⫺39) were subcloned directly into the XhoI site of the pGL3-promoter vector. Plasmid DNA used in transfection experiments was prepared by using the EndoFree Plasmid Maxi Kit (Qiagen; catalog 12362). YT cells (5 ⫻ 106) were electroporated with 20 ␮g of the reporter plasmid and 0.4 ␮g of the pRL-TK control vector (Promega; catalog E2241) as an internal control for normalization of transfection efficiency. Electroporation was performed according to the protocol described (29) with modifications. Cells were harvested at 24 h posttransfection and lysed. For quantitation of Photinus- and Renilla-luciferase values, the Dual-Luciferase Reporter Assay (Promega; catalog E1960) was conducted on a Lumat LB9507 (Berthold Technologies). The results are presented as a ratio of Photinus/Renilla luciferase activity.

ELISA RANTES protein secreted into the cell culture supernatant was quantified by ELISA (DuoSet human RANTES, DY278), according to the manufacturer’s protocol (R&D Systems).

Nuclear extract preparation and EMSA YT cells were treated with MAPK inhibitors (JNK or ERK inhibitor, 100 ␮M; p38 inhibitor, 20 ␮M) in the absence of serum for 12 h, and nuclear protein was isolated by using the high-salt extraction described (30) with modification (31). For EMSA, 5 ␮g of protein was incubated with 40 kcpm of 32P-labeled oligonucleotide coding for the region of interest. Binding conditions for NF-␬B and SP1 were 5 mM HEPES (pH 7.9), 5% glycerol, 0.5 mM EDTA, 1 ␮g dIdC, 1 mM DTT, 1.5 mM MgCl2, and 80 mM NaCl in 25 ␮l total volume. Reactions were incubated at 4°C for 45 min. For oligonucleotide competitions and Ab supershift/blocking experiments, we added 20 – 40 ng of specific oligonucleotide competitor or 1–2 ␮g of antisera/Ab reagent before adding the probe.

Chromatin immunoprecipitation (ChiP) assay Confluent YT cells (1 ⫻ 107) were cross-linked by adding 1% formaldehyde (Sigma-Aldrich) directly to the tissue culture medium for 10 min at room temperature. The cross-linking reaction was stopped by adding glycine to a final concentration of 0.125 M (1 ml of 1.25 M stock in 10 ml of medium). The cells were then lysed in 1 ml of cell lysis buffer (20 mM Tris-HCl, 85 mM KCl (pH 8.0), 0.5% Nonidet P-40, and protease inhibitors) and incubated at 4°C for 10 min. After 10 min, the lysed cells were centifuged at 3000 rpm for 10 min and the supernatant was discarded. The nuclei pellet was lysed in 200 ␮l of nuclei lysis buffer/20 ⫻ 106 cells (50 mM Tris-Cl (pH 8.0), 10 mM EDTA, 1% SDS, and protease inhibitors;


1013

FIGURE 1. Constitutive expression of CCL5 and cytotoxins in freshly isolated NK cells. A, Freshly isolated NK cells were stained for intracellular CCL5, perforin, and granzyme B using flow cytometry. For data acquisition and analysis, the BD LSRII cytometer and FlowJo software were used. Histograms show the fluorescence intensity of intracellular CCL5, perforin, and granzyme B of unstimulated cells without inhibitor treatment. B, The bar diagram represents the ⌬MFI, which was calculated by subtracting the median fluorescence intensity of the isotype control Ab from the median fluorescence intensity of the specific Ab staining. C, Multicolor immune fluorescence staining and confocal microscopy of isolated NK cells. NK cells were fixed and permeabilized with ice-cold acetone and stained with mouse IgG2b anti-human CCL5 VL1 hybridoma supernatant and mouse IgG1 anti-human granzyme B, followed by goat anti-mouse IgG2b AlexaFluor 488 (depicted in green) and goat anti-mouse IgG1 Alexa 568 (depicted in red) as secondary reagents. The nucleus was stained with DAPI (depicted in gray). One confocal z-section is shown. 䡺, Scale bar equals 2 ␮m. D, Freshly isolated NK cells were lysed, and total RNA was isolated, reverse transcribed, and checked for the CCL5, perforin, and granzyme B mRNA levels by qPCR.

Roche Diagnostics). Chromatin was subsequently sonicated to an average length of 600 bp using empirically defined conditions. The chromatin was precleared by adding 50 ␮l of BSA (Promega)/herring sperm DNA (Roche Diagnostics)-blocked pansorbin cells (Calbiochem). The supernatant was transferred to a fresh tube, diluted 5-fold in ChIP dilution buffer (0.01% SDS, 1.1% Trition X-100, 1.1 mM EDTA, 20 mM Tris-Cl (pH 8.0), and 167 mM NaCl), and divided by 10 ⫻ 106 cells/tube. A total of 5 ␮l of SP1 Ab or isotype control Ab was added to the samples and rotated overnight at 4°C. Immune precipitated Ab/protein/DNA complex was then washed consecutively for 3–5 min on a rotating platform with 1 ml of each solution: 2⫻ low salt wash buffer (0.1% SDS, 1% Trition X-100, 2 mM EDTA, and 150 mM NaCl), 2⫻ high salt wash buffer (0.1% SDS, 1% Trition X-100, 2 mM EDTA, and 500 mM NaCl), and 1⫻ LiCl wash buffer (0.25 M/0.5 M LiCl, 1% Nonidet P-40, and 1% deoxycholate), and eluted using elution buffer (50 mM NaHCO3 and 1% SDS). Reverse cross-linking and RNA digestion were performed by adding NaCl to a final concentration of 0.3 M and 1 ␮l of concentrated RNase A (10 mg/ml; Roche Diagnostics) with incubation at 65°C for 4 –5 h. Purified DNA was then treated with protenase K (Roche Diagnostics) at 42°C for 1 h. DNA was extracted with phenol/chloroform and precipitated with ethanol/carrier tRNA (Ambion)/ NaCl. DNA was eluted in sterile H2O, and PCR was performed, as described (19). PCR primers flanking the proximal CCL5 promoter and the TATA box from bp ⫺209 to ⫺100 (⫺209 primer, 5⬘-CACCATTGGTGC TTGGTCAAAGAGG-3⬘; ⫺100 primer, 5⬘-GCAGTAGCAATGAGGAT GACAGCGA-3⬘) were used. As a negative control, primers corresponding to a genomic region distal to the CCL5 promoter from ⫺3789 to ⫺3459 were used (primer, ⫺3789, 5⬘-GCAGATTACGAGGTCAGGAG-3⬘; primer, ⫺3459, 5⬘-TTATGCTTTTCAACAGTCT-3⬘).

Western blotting Cells were treated with specific inhibitors for 12 h in the absence of serum. After 12 h, cells were lysed in radioimmunoprecipitation assay buffer (50 mM Tris-HCl (pH 7.4), 0.25% Na-deoxycholate, 1% Nonidet P-40, 150

mM NaCl, and 1 mM EDTA) in the presence of protease and phosphatase inhibitors (Sigma-Aldrich; catalog P2850). Western blotting was performed according to the protocol described in the manual (Cell Signaling Technology; catalog 9251). ECL Plus Western blotting detection reagents were used for the detection of proteins, as described in the manual (GE Healthcare; RPN2132).

Statistical analyses Luciferase reporter assay data, ELISA, and qRT-PCR data were compared by one-way ANOVA and Newman-Keuls posthoc test or Student’s unpaired t test using GraphPad Prism version 4.00 software for Windows (GraphPad). Statistical significance ( p) ⬍0.05 has been indicated by ⴱ and ⬍0.01 by ⴱⴱ.

Results CCL5 and the cytotoxins are constitutively expressed by peripheral blood NK cells CCL5 and the cytotoxins (perforin, the granzymes, and granulysin) are up-regulated during the functional maturation of CD8 T cells 3–7 days after their initial activation by presented Ag (15–17). By contrast, NK cells display effector function when directly isolated from the peripheral blood. Intracellular flow cytometry (FACS) was performed to measure proteins levels of CCL5, perforin, and granzyme B in freshly isolated primary NK cells (Fig. 1, A and B). In parallel, confocal laser microscopy was used to determine the intracellular distribution of CCL5 and granzyme B (Fig. 1C). Freshly isolated primary NK cells constitutively express CCL5, perforin, and granzyme B proteins. CCL5 is sequestered in secretory vesicles that differ from

1014

CONSTITUTIVE JNK DRIVES CCL5 IN NK CELLS

those containing granzyme B. Additionally, TaqMan RT-PCR was used to determine the levels of CCL5, perforin, and granzyme B mRNA in peripheral blood NK cells (Fig. 1D). A comparison of protein and transcript levels revealed an inverse relationship with higher protein than transcript levels for perforin and granzyme B and opposing low protein, but high transcript levels for CCL5, suggesting that cytotoxins and CCL5 are regulated at different levels. Constitutively activated JNK MAPK pathway is required for CCL5 expression in NK cells A series of regulatory pathways, including the MAPKs, have been linked to the induced expression of CCL5 in CTL (20). Specific inhibitors of the JNK, ERK, and p38 MAPK pathways were used to characterize the potential role of MAPKs in the constitutive expression of CCL5 by NK cells. Freshly isolated primary NK cells were treated with the MAPK inhibitors in the absence of serum. After 12 h, intracellular CCL5 protein was measured by flow cytometry, and mRNA was extracted in parallel for analysis of steady-state CCL5 mRNA levels. As shown in Fig. 2, A and B, JNK inhibition reduced both steady-state mRNA and intracellular CCL5 protein level. Inhibitors of ERK and p38 MAPK pathways had no effect on CCL5 expression. The reduced intracellular protein levels caused by JNK inhibition were not due to increased protein secretion, because protein levels in the culture supernatants remained unchanged (data not shown). Similar experiments were performed using the NK cell line YT (Fig. 2, C and D). Unlike primary NK cells, the YT NK cell line secretes CCL5 constitutively (Fig. 2, C and D, and data not shown). JNK inhibition was again found to reduce the steady mRNA level as well as CCL5 secretion, whereas no significant effect of ERK or p38 inhibition was observed. Perforin and granzyme B mRNA and intracellular protein levels remained unchanged by JNK, ERK, and p38 MAPK inhibition in primary NK cells (Supplementary Fig. 1, A–D).4 CCL5 is transcriptionally regulated in NK cells CCL5 mRNA is extremely stable in CTL, and important aspects of the regulation of this chemokine in T cells can be linked to translational control (32, 33). To determine whether mRNA (and protein) was also stable in NK cells, primary NK cells were treated with the transcriptional blocker Act D or the translational inhibitor CHX. The mRNA and intracellular protein levels for CCL5, perforin, and granzyme B were then measured 12 h later. Steady-state mRNA as well as protein levels of CCL5 in NK cells appeared to be largely dependent on constitutive transcription and translation, because levels were dramatically reduced after 12 h of treatment (Fig. 3, A–C). Unlike CCL5, perforin and granzyme protein levels were stable in the NK cells because they are unchanged with Act D or CHX treatment (Supplementary Fig. 2, A–D).4 To determine whether JNK inhibition could also directly inhibit CCL5 promoter activity, a fragment of the CCL5 immediate upstream region extending from ⫺976 to ⫹59 was cloned into a luciferase reporter gene and transiently transfected into YT cells. Two hours after transfection, the cells were treated with increasing levels of the JNK inhibitor. After 12 h, the cells were lysed and luciferase activity was measured. As shown in Fig. 3D, the JNK inhibitor inhibited CCL5 promoter-reporter activity in a dose-dependent manner, suggesting a direct effect on CCL5 transcription.

4

The online version of this article contains supplementary material.

FIGURE 2. Requirement of JNK signal for CCL5 expression in primary NK cells and YT cell line. A, Freshly isolated primary NK cells were cultured in the presence of JNK (50 ␮M), ERK (50 ␮M), and p38 JNK inhibitors (20 ␮M), or DMSO vehicle in the absence of serum for 12 h. The cells were used for RNA isolation and reverse transcription to analyze CCL5 mRNA level by qRT-PCR. B, Simultaneously, inhibitor-treated cells were fixed and stained for intracellular CCL5 with mouse IgG2b antihuman VL1 hybridoma supernatant and goat anti-mouse IgG2b (AlexaFluor 488). Median fluorescence intensity was determined by BD LSRII cytometer and FlowJo software. The ⌬MFI was calculated by as described in legend to Fig. 1. C, YT NK cells were cultured in the presence of JNK inhibitor (25, 50, and 100 ␮M), ERK inhibitor (25, 50, and 100 ␮M), p38 inhibitor (10 and 20 ␮M), or DMSO vehicle in the absence of serum for 12 h. The cells were then used for RNA isolation and reverse transcription to analyze CCL5 mRNA expression level. D, In parallel, supernatants were analyzed for the presence of released CCL5 by specific ELISA (ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍ 0.01).

The JNK MAPK pathway is constitutively active in primary NK and YT cells JNK inhibition reduced steady-state CCL5 mRNA and protein levels in freshly isolated NK cells. Importantly, this occurred in the absence of NK cell activation, suggesting that constitutively activated JNK MAPK pathway may be important in NK function (24, 34, 35). To test for JNK activity in primary NK cells, freshly isolated primary NK cells were treated with JNK, ERK, and p38 inhibitor, or vehicle control for 12 h in the absence of serum. After 12 h, the cells were lysed and checked for phosphorylated JNK vs total JNK protein by immunoblotting. JNK2 MAPK appears to be constitutively phosphorylated in freshly isolated primary NK cells (Fig. 4A). Similar experiments performed in YT cells also demonstrated constitutive activation of JNK1/2 (Fig. 4B). Identification of the minimal optimal CCL5 promoter in NK cells The experiments outlined in Fig. 3D suggested a direct effect of JNK inhibition on CCL5 reporter-promoter activity in NK cells. The minimal optimal functional region of the CCL5 promoter in NK (YT) cells was then determined. YT cells were transiently transfected with a series of 5⬘ to 3⬘ CCL5 promoter-reporter deletions driving the luciferase reporter gene (Fig. 5A). After 24 h, the cells were lysed and reporter gene activity was measured. The reporter gene activity was essentially unchanged when promoter sequences were deleted from ⫺976 to ⫺83 (Fig. 5B).


1015

FIGURE 3. Steady-state expression of CCL5 requires constitutive transcription and translation, and JNK signal is required for constitutive CCL5 promoter activity. A, Freshly isolated NK cells were treated with Act D (10 ␮g/ml) or left untreated for 12 h, then stained for intracellular CCL5, and analyzed by flow cytometry, as described in legend to Fig. 1. B, In parallel, cells were lysed and total RNA was isolated, reverse transcribed, and analyzed for CCL5 mRNA level. C, Freshly isolated NK cells were treated with CHX (10 ␮g/ml), or left untreated for 12 h, stained for intracellular CCL5, and analyzed by flow cytometry, as described in legend to Fig. 1. D, YT cells were transfected with CCL5 promoter-reporter construct (pGL3/⫺976); after 3 h of transfection, the cells were treated with JNK inhibitors (2, 25, and 50 ␮M) or left untreated for 12 h. The cells were then lysed and analyzed for Photinus- and Renilla-luciferase activity. The results are representative of more than three experiments (ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍ 0.01).

SP1/KLF-binding elements in the CCL5 promoter region are required for constitutive promoter activity Bioinformatics analysis of the ⫺83 bp proximal region of the CCL5 promoter for potential transcription factor binding sites us-

ing Matinspector (Genomatix GmbH) identified the two previously identified binding sites for NF-␬B (⫺70 to ⫺58 and ⫺55 to ⫺42), a SP1/KLF binding site (⫺70 to ⫺58) (26 –28, 36 –39), as well as NOLF, MZF1, PLAG, HICF c-MYB, PAX6, and SRF binding sites (Fig. 5C). To characterize the functionality of these elements in the context of NK cells, serial mutations of each element (based on Sequence Shaper; Genomatix) as well as a deletion of the 5⬘ UTR region were generated within the ⫺194 CCL5 reporter-promoter construct (Table I) (Fig. 6A). The reporter gene constructs were then transiently transfected into YT cells, and after 24 h the cells were lysed and checked for reporter gene activity. As shown in Fig. 6B, mutation of the p65 site at ⫺70 to ⫺58 and complete mutation of the second NF-␬B binding site at ⫺55 to ⫺42 in the promoter did not influence reporter gene activity. However, mutation of the SP1 binding site at ⫺70 to ⫺58 resulted in 75– 80% reduced promoter-reporter activity. Mutation of the c-MYB, PAX6, and SRF binding sites or deletion of the 5⬘ untranslated region did not lead to a change in promoter-reporter activity (Fig. 6C). CCL5 promoter region ⫺75 to ⫺39 confers inducibility to a SV40 enhancerless promoter

FIGURE 4. Constitutive activation of JNK in primary NK cells and the YT cell line. A, Freshly isolated NK cells were treated with JNK inhibitor, ERK inhibitor (50 ␮M), and p38 inhibitor (20 ␮M), or DMSO vehicle for 12 h. The cells were lysed, and phosphorylated JNK and total cellular JNK were measured by Western blotting using a p-JNK Ab. B, YT cells were treated either with 100 ␮M JNK, ERK inhibitor and 20 ␮M p38 inhibitor, or DMSO vehicle for 12 h in the absence of serum. After 12 h, cells were lysed and checked for the p-JNK Ab and total cellular JNK by Western blotting.

To further assess the functionality of the ⫺75 to ⫺39 promoter region, a series of heterologous promoter-reporter gene constructs were tested in the YT cell line. A dimer of the ⫺75 to ⫺39 region was cloned in front of an enhancerless SV40 promoter (pGL3promoter; Promega) (Fig. 7A). Transient transfection of the constructs into YT cells demonstrated that the region could efficiently confer increased promoter activity to a heterologous reporter promoter. To determine whether the JNK inhibitor could inhibit the ⫺75 to ⫺39 mediated promoter-reporter activity, transfected cells were treated with increasing concentrations of the JNK inhibitor. The heterologous promoter-reporter activity was inhibited in a dose-dependent manner (Fig. 7B). In two additional constructs, either the ⫺70 to ⫺58 or ⫺55 to ⫺42 region was mutated in the context of the dimer. The selective mutation of ⫺75 to ⫺58

1016

CONSTITUTIVE JNK DRIVES CCL5 IN NK CELLS

FIGURE 5. The ⫺83 to ⫹69 region contributes to constitutive CCL5 promoter activity. A, Schematic presentation of the CCL5-promoter region and its 5⬘-truncated forms. B, Transient transfection of 5⬘ to 3⬘ CCL5 promoter deletion constructs. The transfected cells were cultured for 24 h, and cell lysates were assayed for Photinus- and Renilla-luciferase activity. The result is representative of more than three experiments. C, Schematic presentation of ⫺194-bp proximal region of the CCL5 promoter and potential transcription factor binding sites.

resulted in loss of the increased promoter activity, whereas mutation of ⫺55 to ⫺42 did not have an effect on the heterologous promoter-reporter activity (Fig. 7C). The ⫺75 to ⫺56 region binds SP1 in EMSA EMSAs were then used to study in vitro factor binding to the ⫺70 to ⫺56 region. An oligonucleotide probe spanning ⫺75 to ⫺56 and representing the binding sites for the SP1/NF-␬B elements

FIGURE 6. A SP1-binding element in the CCL5 promoter is essential for constitutive promoter activity. A, Sequence of the ⫺75 to ⫺26 promoter region showing potential binding sites for transcription factors. Schematic presentation of site-directed mutations in the CCL5 promoter region ⫺83 to ⫹58 and UTR deletion mutation. B and C, The wild-type or site-directed mutant constructs and pRL-TK were transfected into YT cells, the transfected cells were cultured for 24 h, and cell lysates were assayed for firefly and Renilla luciferase activities. The results are representative of more than three experiments (ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍ 0.01).

showed only one prominent band in EMSA. The band was specific because it could be completely competed with an excess of cold self probe. In addition, the band was completely competed with a consensus oligonucleotide probe for SP1, but not with a mutant version of the SP1 consensus probe or with a NF-␬B consensus oligonucleotide. Supershift/Blocking with antisera directed against either Rel p50, Rel p52, Rel p65, B Rel, SP1, SP3, or KLF 13 further demonstrated that the complex was formed by SP1 because

Table I. Wild type and mutant sequences in CCL5 promoter Type of Mutations Wild-type SP1 ⫹ NF-␬B (in ⫺70 to ⫺58) SP1 mutation (in ⫺70 to ⫺58) NF-␬B mutation (in ⫺70 to ⫺58) SP1 ⫹ NF-␬B mutation (in ⫺70 to ⫺58) Wild-type NF-␬B (in ⫺55 to ⫺42) NF-␬B mutation (in ⫺55 to ⫺42) C Myb mutation C Myb ⫹ SRF mutation

Sequence ⫺76

GCTATTTTGGAAACTCCCCTTAGGGGATGCCCCCGATAAAACCTTTGAGGGGAATCCCCTACGGGG

⫺43

⫺76 ⫺76 ⫺76

GCTATTTTGGAAACTCTCCTTAGGGGATGCCCCCGATAAAACCTTTGAGAGGAATCCCCTACGGGG GCTATTTTGGCCACTCCTCTTAGGGGATGCCCCCGATAAAACCGGTGAGGAGAATCCCCTACGGGG GCTATTTTGGACACTCTCCTTAGGGGATGCCCCCGATAAAACCTGTGAGAGGAATCCCCTACGGGG

⫺43 ⫺43 ⫺43

⫺68 ⫺68 ⫺54 ⫺54

GGAAACTCCCCTTAGGGGATGCCCCTCAACCCTTTGAGGGGAATCCCCTACGGGGAGTTG GGAAACTCCCCTTACTCGATGCCCCTCAACCCTTTGAGGGGAATGAGCTACGGGGAGTTG GGGGATGCCCCTCAACTCACCCTATAAAGGGCCAGCCCCCCTACGGGGAGTTGAGTGGGATATTTCCCGGTCGG GGGGATGCCCCTCAACAAGCCCTATAAAGGGCCAGCCCCCCTACGGGGAGTTGTTCGGGATATTTCCCGGTCGG

⫺39 ⫺39 ⫺17 ⫺17


FIGURE 7. Region ⫺75 to ⫺39 confers constitutive inducibility to a heterologous promoter that requires ⫺70 to ⫺58 promoter region. A, Dimer of region ⫺75 to ⫺39, or dimers containing mutations in either ⫺70 to ⫺58 or ⫺55 to ⫺42 were cloned into pGL3/SV40 enhancerless vector. B, YT cells were transiently transfected with wild-type ⫺75 to ⫺39 promoter reporter construct; 2 h after transfection, cells were treated with different concentration of JNK inhibitor for 12 h in the absence of serum. Twelve hours after treatment with inhibitor, the cells were lysed and assayed for Photinus- and Renilla-luciferase reporter activity. C, The wild ⫺75 to ⫺39 type/mutant dimer constructs and pRL-TK were transfected into YT cells. The transfected cells were cultured for 24 h, and cell lysates were assayed for Photinus- and Renilla-luciferase activity. The results are representative of more than three experiments (ⴱ, p ⬍ 0.05; ⴱⴱ, p ⬍ 0.01).

1017

FIGURE 8. CCL5 promoter region ⫺75 to ⫺56 binds SP1 in YT cell nuclear extracts. A, EMSA competition experiment with ⫺75 to ⫺56 as probe and nuclear extracts from YT cells; 50 ng of unlabeled ⫺75 to ⫺56 oligonucleotide or 40 ng of consensus (SP1, NF-␬B) or mutant competitor was added to the binding reactions before incubation with probe. B, EMSA supershift/blocking analysis with ⫺75 to ⫺56 as probe and nuclear extracts derived from YT cells.

from ⫺209 to ⫹100 PCR lead to the amplification of CCL5 promoter sequence, establishing that SP1 binds to CCL5 promoter near to TATA box (Fig. 9B).

it was completely blocked by anti-SP1 Abs, whereas the other Ab reagents did not affect the complex (Fig. 8). SP1 binds in vivo near the TATA box on the CCL5 promoter To verify that SP1 binds to the immediate upstream region of the CCL5 promoter in native chromatin, ChiP assay was used (40). SP1 Ab was used to immunoprecipitate the CCL5 promoter DNA from YT cells. CCL5-specific PCR was then used to demonstrate the presence of the CCL5 promoter region in the precipitate. Two primer pairs were applied to perform the PCR. One primer set annealed from bp –209 to ⫹100 near the CCL5 TATA box, whereas the second primer pair corresponding to a genomic region distal to the CCL5 promoter (from ⫺3789 to ⫺3459) was used as a negative control (Fig. 9A). Precipitation controls with either no Ab or isotype control Ab added during the immunoprecipitation step showed no specific CCL5 promoter PCR product. The input DNA control with PCR performed on cross-link reversed total DNA demonstrated a control PCR. Only the primer pairs annealing

FIGURE 9. Binding of SP1 to the ⫺70 to ⫺58 region of CCL5 promoter region in vivo. A, Schematic presentation of the CCL5-promoter region; B, lanes 1, 2, and 3 of uppermost gel picture, represent the no Ab control, isotype Ab control, and DNA immunoprecipitated by SP1 Abs. Lower gel picture, Represents the input DNA control amplified for 35 cycles using pairs of DNA primers binding proximal to the TATA box of CCL5 promoter region. A second control primer pair was applied, as described in Materials and Methods.

1018

FIGURE 10. JNK inhibitor reduces SP1 expression. A and B, Freshly isolated NK cells or YT cells were treated with either DMSO vehicle or JNK, ERK inhibitor (50 ␮M for primary NK cells, and 100 ␮M for YT cell line), and p38 inhibitor (20 ␮M for both cell types) for 12 h. The cells were lysed and analyzed for intracellular SP1 levels by Western blot. C, YT cells were treated with either DMSO vehicle or 100 ␮M JNK, ERK or 20 ␮M p38 inhibitor for 12 h. Nuclear proteins were isolated and EMSA performed using 32P-labeled ⫺75 to ⫺56 oligonucleotide probe.

JNK inhibition reduces expression of SP1 To gain insight into the mechanism by which JNK may regulate CCL5 transcription via SP1, nuclear proteins isolated from JNKinhibited NK cells were then analyzed by Western blot and EMSA (using an oligonucleotide probe spanning ⫺75 to ⫺56). A reduced level of SP1 protein was detected in the cell extracts from the JNK inhibitor-treated samples (Fig. 10, A and B). In parallel, reduced SP1-binding activity to the ⫺75 to ⫺56 oligonucleotide probe was observed after JNK inhibition (Fig. 10C).

Discussion To gain insight into the biology of CCL5 in NK effector function, it is important to understand the molecular mechanisms that control CCL5 expression in NK cells. CCL5 expression is induced 3–7 days following activation of resting peripheral blood T cells that is coincident with the development of CTL effector function (16). In contrast, peripheral NK cells are able to kill target cells without the activation of a differentiation program. The biological role of CCL5 production by peripheral blood NK cells is not well defined. Yet, it has been proposed that, in addition to its role as a recruiter of leukocytes, CCL5 exhibits other biological activities, for example, increasing cytolytic activity (12, 41). A similar role has been proposed for CCL5 in CTL function (12, 13, 32). Using primary human NK cells from pheripheral blood, we observed that perforin and granzyme B are present constitutively, as has been reported by others (42, 43). Additionally, our results show that unstimulated peripheral blood NK cells constitutively express CCL5 at mRNA and protein levels and sequester it in secretory vesicles distinct from those containing the cytotoxins. The MAPK (ERK, JNK, and p38) and PI3K pathways are involved in triggering the polarization and secretion of cytolytic granules in NK cells (7, 8, 24, 44, 45). In this study, we show that

CONSTITUTIVE JNK DRIVES CCL5 IN NK CELLS of these pathways, only the JNK MAPK plays a role in the regulation of steady-state CCL5 mRNA levels in NK cells. Inhibition of the JNK pathway resulted in a decrease of the constitutive CCL5 promoter activity as well as the constitutive CCL5 mRNA and protein levels, whereas no effect of JNK inhibition was observed on perforin or granzyme B (supplemetary Fig. 1, A–D).4 NK cell proliferation was unchanged by JNK inhibitor treatment (data not shown). The phosphorylated state of JNK was not altered over time or by serum deprivation, suggesting that activation of JNK is intrinsic and spontaneous in these cells. Primary NK cells were found to exhibit active JNK2, whereas the NK cell line YT was found to show constitutive activation of JNK1/2. The constitutive activation of JNK2 in freshly isolated NK cells can be linked to the constitutive transcription of CCL5, whereas levels of perforin and granzyme B were stable and independent of transcription and translation in the time frame tested (Supplementary Fig. 2, A–D).4 Our results in concert with previous reports suggest the differential regulation of NK cell function by JNK isforms (8). It has been previously shown that NK cell receptors can also activate ERK2 and JNK1 pathways, which in turn trigger microtubule-organizing center, granule polarization, and cytotoxicity (8, 44). In this study, we show that JNK2 is involved in the regulation of CCL5 transcription. Because polarization and NK receptor activation were not studied in this work, we cannot attest to the potential role of the ERK2 and JNK1 pathways in CCL5 protein release. However, the YT NK cell line that showed active JNK1/2 also showed constitutive secretion of the CCL5 protein. The cis-acting promoter elements and the respective binding factors required for constitutive CCL5 promoter activity in NK cells were identified and characterized. The 5⬘ to 3⬘ deletion analysis of the CCL5 promoter revealed a very compact region from nucleotide ⫺83 to nucleotide ⫹68, providing basal promoter activity. Based on the experiments performed in this study, we cannot rule out that additional upstream or downstream signals may also contribute to the control of CCL5 transcription. Indeed, this small region is in marked contrast to what has been previously shown by our group and others as operationally functional for CCL5 transcription in other cell types, including T cells, macrophage/monocytes, fibroblasts, and endothelial cells (18 –20, 26 – 28, 36 –38, 46 –54). In CTL, the transcription factor KLF13 binds to the ⫺70 to ⫺58 region and helps to direct the transcription of CCL5 during the functional maturation of CD8 T cells (16). Constitutive transcription of CCL5 by NK cells was found to involve the same promoter region, but mediated by the transcription factor SP1 that in turn is controlled through the JNK pathway. The basal CCL5 promoter contains binding sites for two NF-␬B and SP1/KLF13 binding sites previously shown to be functional in T cells (18, 19, 26, 27). Transient transfection of site-directed individual mutants of SP1, p65 (in the ⫺70 to –58) promoter regions, or complete mutation of the ⫺70 to ⫺58 and ⫺55 to ⫺42 demonstrated the importance of SP1 binding site in the ⫺70 to ⫺58 promoter region for constitutive CCL5 promoter activity in YT cells. EMSA supershift experiments verified SP1 binding to the ⫺70 to ⫺58 promoter region, whereas ChiP demonstrated in vivo binding of SP1 to the CCL5 promoter proximal to the TATA box. SP1 is a ubiquitously expressed transcription factor that binds GC-rich cis elements. Western blotting and JNK inhibition demonstrated that the constitutive JNK signal is required for SP1 expression. JNK pathway activation has been shown to play a role in the stability of transcription factors, which may also be the basis for the effect of JNK inhibition on SP1 expression seen in this study (55–57). Posttranslational modifications of SP1 have been

The Journal of Immunology implicated in the regulation of SP1 activity. For example, glycosylation, sumoylation, and ubiquitination regulate SP1 stability in a proteasome-dependent manner (58 – 60). The results detailed in this study deal exclusively with the molecular mechanisms controlling the constitutive expression of CCL5 by NK cells. However, NK cells are also activated by various factors and receptors. In subsequent experiments, we examined the effect of IL-2 stimulation and activation via the phorbol ester PMA and ionomycin (mimicking NK receptor activation) (61) on CCL5 mRNA expression. Interestingly, whereas IL-2 did increase mRNA expression of both perforin and granzyme B, it did not influence CCL5 mRNA levels (Supplementary Fig. 3, A–C).4 The moderate increase in steady-state mRNA level seen after combined stimulation with PMA and ionomycin was suppressed by JNK inhibition, suggesting that some aspects of CCL5 mRNA regulation during NK cell activation may also act through the JNK pathway (Supplementary Fig. 4A).4 An additional level of complexity occurs when considering the molecular pathways controlling the release of CCL5 protein upon NK activation. It appears that then other pathways than the JNK pathway identified in this study as controlling steady-state transcription take control (62). This is indicated by results showing that PKC inhibition strongly blocks the release of protein in the context of NK activation, whereas JNK blockade does not have an effect (Supplementary Fig. 4B).4 Collectively, our data establish that constitutive CCL5 expression in NK cells is dependent on JNK2 signaling that controls expression of SP1, which in turn regulates transcription of CCL5. The results suggest that a common JNK signaling pathway differentially regulates cytolytic granule release as well as constitutive CCL5 expression. Inhibition of JNK MAPK has been shown to reduce NK-mediated cytotoxicity toward target cells and block movement of the microtubule-organizing center, granzyme B, and paxillin (a scaffold protein) to the immune synapse (8, 44). In this study, we show that JNK also regulates CCL5 transcription through SP1 regulation, but does not affect perforin or granzyme B expression.

Acknowledgments

1019

10.

11. 12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

We thank Anke Mojaat for excellent technical assistance. 26.

Disclosures The authors have no financial conflict of interest.

27.

References

28.

1. Arnon, T. I., G. Markel, and O. Mandelboim. 2006. Tumor and viral recognition by natural killer cells receptors. Semin. Cancer Biol. 16: 348 –358. 2. Yokoyama, W. M. 2005. Specific and non-specific natural killer cell responses to viral infection. Adv. Exp. Med. Biol. 560: 57– 61. 3. Yokoyama, W. M. 2005. Natural killer cell immune responses. Immunol. Res. 32: 317–325. 4. Farag, S. S., and M. A. Caligiuri. 2006. Human natural killer cell development and biology. Blood Rev. 20: 123–137. 5. Lieberman, J. 2003. The ABCs of granule-mediated cytotoxicity: new weapons in the arsenal. Nat. Rev. Immunol. 3: 361–370. 6. Wei, S., A. M. Gamero, J. H. Liu, A. A. Daulton, N. I. Valkov, J. A. Trapani, A. C. Larner, M. J. Weber, and J. Y. Djeu. 1998. Control of lytic function by mitogen-activated protein kinase/extracellular regulatory kinase 2 (ERK2) in a human natural killer cell line: identification of perforin and granzyme B mobilization by functional ERK2. J. Exp. Med. 187: 1753–1765. 7. Chen, X., D. S. Allan, K. Krzewski, B. Ge, H. Kopcow, and J. L. Strominger. 2006. CD28-stimulated ERK2 phosphorylation is required for polarization of the microtubule organizing center and granules in YTS NK cells. Proc. Natl. Acad. Sci. USA 103: 10346 –10351. 8. Chen, X., P. P. Trivedi, B. Ge, K. Krzewski, and J. L. Strominger. 2007. Many NK cell receptors activate ERK2 and JNK1 to trigger microtubule organizing center and granule polarization and cytotoxicity. Proc. Natl. Acad. Sci. USA 104: 6329 – 6334. 9. Devergne, O., A. Marfaing-Koka, T. J. Schall, M. B. Leger-Ravet, M. Sadick, M. Peuchmaur, M. C. Crevon, K. J. Kim, T. T. Schall, T. Kim, et al. 1994. Production of the RANTES chemokine in delayed-type hypersensitivity reac-

29.

30.

31.

32.

33.

34.

35.

tions: involvement of macrophages and endothelial cells. J. Exp. Med. 179: 1689 –1694. Grone, H. J., C. Weber, K. S. Weber, E. F. Grone, T. Rabelink, C. M. Klier, T. N. Wells, A. E. Proudfood, D. Schlondorff, and P. J. Nelson. 1999. MetRANTES reduces vascular and tubular damage during acute renal transplant rejection: blocking monocyte arrest and recruitment. FASEB J. 13: 1371–1383. Krensky, A. M., and Y. T. Ahn. 2007. Mechanisms of disease: regulation of RANTES (CCL5) in renal disease. Nat. Clin. Pract. Nephrol. 3: 164 –170. Taub, D. D., J. R. Ortaldo, S. M. Turcovski-Corrales, M. L. Key, D. L. Longo, and W. J. Murphy. 1996. ␤ chemokines costimulate lymphocyte cytolysis, proliferation, and lymphokine production. J. Leukocyte Biol. 59: 81– 89. Hadida, F., V. Vieillard, L. Mollet, I. Clark-Lewis, M. Baggiolini, and P. Debre. 1999. Cutting edge: RANTES regulates Fas ligand expression and killing by HIV-specific CD8 cytotoxic T cells. J. Immunol. 163: 1105–1109. Cocchi, F., A. L. DeVico, A. Garzino-Demo, S. K. Arya, R. C. Gallo, and P. Lusso. 1995. Identification of RANTES, MIP-1␣, and MIP-1␤ as the major HIV-suppressive factors produced by CD8⫹ T cells. Science 270: 1811–1815. Green, L. M., M. L. Stern, D. L. Haviland, B. J. Mills, and C. F. Ware. 1985. Cytotoxic lymphokines produced by cloned human cytotoxic T lymphocytes. I. Cytotoxins produced by antigen-specific and natural killer-like CTL are dissimilar to classical lymphotoxins. J. Immunol. 135: 4034 – 4043. Ortiz, B. D., P. J. Nelson, and A. M. Krensky. 1997. Switching gears during T-cell maturation: RANTES and late transcription. Immunol. Today 18: 468 – 471. Ortiz, B., A. Krensky, and P. Nelson. 1996. Kinetics of transcription factors regulating the RANTES chemokine gene reveal a developmental switch in nuclear events during T-lymphocyte maturation. Mol. Cell. Biol. 16: 202–210. Song, A., Y. F. Chen, K. Thamatrakoln, T. A. Storm, and A. M. Krensky. 1999. RFLAT-1: a new zinc finger transcription factor that activates RANTES gene expression in T lymphocytes. Immunity 10: 93–103. Ahn, Y. T., B. Huang, L. McPherson, C. Clayberger, and A. M. Krensky. 2007. Dynamic interplay of transcriptional machinery and chromatin regulates “late” expression of the chemokine RANTES in T lymphocytes. Mol. Cell. Biol. 27: 253–266. Nikolcheva, T., S. Pyronnet, S. Y. Chou, N. Sonenberg, A. Song, C. Clayberger, and A. M. Krensky. 2002. A translational rheostat for RFLAT-1 regulates RANTES expression in T lymphocytes. J. Clin. Invest. 110: 119 –126. Huang, B., Y. T. Ahn, L. McPherson, C. Clayberger, and A. M. Krensky. 2007. Interaction of PRP4 with Kruppel-like factor 13 regulates CCL5 transcription. J. Immunol. 178: 7081–7087. Upshaw, J. L., L. N. Arneson, R. A. Schoon, C. J. Dick, D. D. Billadeau, and P. J. Leibson. 2006. NKG2D-mediated signaling requires a DAP10-bound Grb2Vav1 intermediate and phosphatidylinositol-3-kinase in human natural killer cells. Nat. Immunol. 7: 524 –532. Sutherland, C. L., N. J. Chalupny, K. Schooley, T. VandenBos, M. Kubin, and D. Cosman. 2002. UL16-binding proteins, novel MHC class I-related proteins, bind to NKG2D and activate multiple signaling pathways in primary NK cells. J. Immunol. 168: 671– 679. Liang, S., J. Zhang, H. Wei, R. Sun, and Z. Tian. 2005. Differential roles of constitutively activated ERK1/2 and NF-␬B in cytotoxicity and proliferation by human NK cell lines. Int. Immunopharmacol. 5: 839 – 848. Krensky, A. M., and P. J. Nelson. 1997. Expression of chemokine RANTES and production of monoclonal antibodies. Methods Enzymol. 287: 162–174. Nelson, P. J., H. T. Kim, W. C. Manning, T. J. Goralski, and A. M. Krensky. 1993. Genomic organization and transcriptional regulation of the RANTES chemokine gene. J. Immunol. 151: 2601–2612. Nelson, P. J., B. D. Ortiz, J. M. Pattison, and A. M. Krensky. 1996. Identification of a novel regulatory region critical for expression of the RANTES chemokine in activated T lymphocytes. J. Immunol. 157: 1139 –1148. Fessele, S., S. Boehlk, A. Mojaat, N. G. Miyamoto, T. Werner, E. L. Nelson, D. Schlondorff, and P. J. Nelson. 2001. Molecular and in silico characterization of a promoter module and C/EBP element that mediate LPS-induced RANTES/ CCL5 expression in monocytic cells. FASEB J. 15: 577–579. Grund, E. M., and R. C. Muise-Helmericks. 2005. Cost efficient and effective gene transfer into the human natural killer cell line, NK92. J. Immunol. Methods 296: 31–36. Schreiber, E., P. Matthias, M. M. Muller, and W. Schaffner. 1989. Rapid detection of octamer binding proteins with “mini-extracts,” prepared from a small number of cells. Nucleic Acids Res. 17: 6419. Leung, S., S. McCracken, J. Ghysdael, and N. G. Miyamoto. 1993. Requirement of an ETS-binding element for transcription of the human lck type I promoter. Oncogene 8: 989 –997. Swanson, B. J., M. Murakami, T. C. Mitchell, J. Kappler, and P. Marrack. 2002. RANTES production by memory phenotype T cells is controlled by a posttranscriptional, TCR-dependent process. Immunity 17: 605– 615. Marcais, A., M. Tomkowiak, T. Walzer, C. A. Coupet, A. Ravel-Chapuis, and J. Marvel. 2006. Maintenance of CCL5 mRNA stores by post-effector and memory CD8 T cells is dependent on transcription and is coupled to increased mRNA stability. Eur. J. Immunol. 36: 2745–2754. Aluoch, A. O., S. O. Odman-Ghazi, and M. M. Whalen. 2007. Pattern of MAP kinases p44/42 and JNK activation by non-lethal doses of tributyltin in human natural killer cells. Arch. Toxicol. 81: 271–277. Trotta, R., K. Fettucciari, L. Azzoni, B. Abebe, K. A. Puorro, L. C. Eisenlohr, and B. Perussia. 2000. Differential role of p38 and c-Jun N-terminal kinase 1 mitogenactivated protein kinases in NK cell cytotoxicity. J. Immunol. 165: 1782–1789.

1020 36. Miyamoto, N. G., P. S. Medberry, J. Hesselgesser, S. Boehlk, P. J. Nelson, A. M. Krensky, and H. D. Perez. 2000. Interleukin-1␤ induction of the chemokine RANTES promoter in the human astrocytoma line CH235 requires both constitutive and inducible transcription factors. J. Neuroimmunol. 105: 78 –90. 37. Melchjorsen, J., and S. R. Paludan. 2003. Induction of RANTES/CCL5 by herpes simplex virus is regulated by nuclear factor ␬B and interferon regulatory factor 3. J. Gen. Virol. 84: 2491–2495. 38. Andoh, A., S. Fujino, S. Bamba, Y. Araki, T. Okuno, T. Bamba, and Y. Fujiyama. 2002. IL-17 selectively down-regulates TNF-␣-induced RANTES gene expression in human colonic subepithelial myofibroblasts. J. Immunol. 169: 1683–1687. 39. Li, Q. Q., and C. T. Bever. 2001. Glatiramer acetate blocks interleukin-1-dependent nuclear factor-␬B activation and RANTES expression in human U-251 MG astroglial cells. Brain Res. Mol. Brain Res. 87: 48 – 60. 40. Fasciano, S., A. Kaufman, and R. C. Patel. 2007. Expression of PACT is regulated by Sp1 transcription factor. Gene 388: 74 – 82. 41. Robertson, M. J. 2002. Role of chemokines in the biology of natural killer cells. J. Leukocyte Biol. 71: 173–183. 42. Salcedo, T. W., L. Azzoni, S. F. Wolf, and B. Perussia. 1993. Modulation of perforin and granzyme messenger RNA expression in human natural killer cells. J. Immunol. 151: 2511–2520. 43. Obata-Onai, A., S. Hashimoto, N. Onai, M. Kurachi, S. Nagai, K. Shizuno, T. Nagahata, and K. Matsushima. 2002. Comprehensive gene expression analysis of human NK cells and CD8⫹ T lymphocytes. Int. Immunol. 14: 1085–1098. 44. Li, C., B. Ge, M. Nicotra, J. N. Stern, H. D. Kopcow, X. Chen, and J. L. Strominger. 2008. JNK MAP kinase activation is required for MTOC and granule polarization in NKG2D-mediated NK cell cytotoxicity. Proc. Natl. Acad. Sci. USA 105: 3017–3022. 45. Jiang, K., B. Zhong, D. L. Gilvary, B. C. Corliss, E. Hong-Geller, S. Wei, and J. Y. Djeu. 2000. Pivotal role of phosphoinositide-3 kinase in regulation of cytotoxicity in natural killer cells. Nat. Immunol. 1: 419 – 425. 46. Ieki, K., S. Matsukura, F. Kokubu, T. Kimura, H. Kuga, M. Kawaguchi, M. Odaka, S. Suzuki, S. Watanabe, H. Takeuchi, et al. 2004. Double-stranded RNA activates RANTES gene transcription through co-operation of nuclear factor-␬B and interferon regulatory factors in human airway epithelial cells. Clin. Exp. Allergy 34: 745–752. 47. Li, Q. Q., C. T. Bever, D. R. Burt, S. I. Judge, and G. D. Trisler. 2001. Induction of RANTES chemokine expression in human astrocytic cells is dependent upon activation of NF-␬B transcription factor. Int. J. Mol. Med. 7: 527–533. 48. Moriuchi, H., M. Moriuchi, and A. S. Fauci. 1997. Nuclear factor-␬B potently up-regulates the promoter activity of RANTES, a chemokine that blocks HIV infection. J. Immunol. 158: 3483–3491. 49. Casola, A., A. Henderson, T. Liu, R. P. Garofalo, and A. R. Brasier. 2002. Regulation of RANTES promoter activation in alveolar epithelial cells after cytokine stimulation. Am. J. Physiol. 283: L1280 –L1290.

CONSTITUTIVE JNK DRIVES CCL5 IN NK CELLS 50. Kudo, T., H. Lu, J. Y. Wu, D. Y. Graham, A. Casola, and Y. Yamaoka. 2005. Regulation of RANTES promoter activation in gastric epithelial cells infected with Helicobacter pylori. Infect. Immun. 73: 7602–7612. 51. Kim, M. O., H. S. Suh, C. F. Brosnan, and S. C. Lee. 2004. Regulation of RANTES/CCL5 expression in human astrocytes by interleukin-1 and interferon-␤. J. Neurochem. 90: 297–308. 52. Blaber, R., E. Stylianou, A. Clayton, and R. Steadman. 2003. Selective regulation of ICAM-1 and RANTES gene expression after ICAM-1 ligation on human renal fibroblasts. J. Am. Soc. Nephrol. 14: 116 –127. 53. Wickremasinghe, M. I., L. H. Thomas, C. M. O’Kane, J. Uddin, and J. S. Friedland. 2004. Transcriptional mechanisms regulating alveolar epithelial cell-specific CCL5 secretion in pulmonary tuberculosis. J. Biol. Chem. 279: 27199 –27210. 54. Cho, M. L., S. Y. Min, S. H. Chang, K. W. Kim, S. B. Heo, S. H. Lee, S. H. Park, C. S. Cho, and H. Y. Kim. 2006. Transforming growth factor ␤1 (TGF-␤1) down-regulates TNF␣-induced RANTES production in rheumatoid synovial fibroblasts through NF-␬B-mediated transcriptional repression. Immunol. Lett. 105: 159 –166. 55. Yin, Z. M., J. Sima, Y. F. Wu, J. Zhu, and Y. Jiang. 2004. The effect of Cterminal fragment of JNK2 on the stability of p53 and cell proliferation. Cell Res. 14: 434 – 438. 56. Fuchs, S. Y., V. Adler, T. Buschmann, Z. Yin, X. Wu, S. N. Jones, and Z. Ronai. 1998. JNK targets p53 ubiquitination and degradation in nonstressed cells. Genes Dev. 12: 2658 –2663. 57. Buschmann, T., O. Potapova, A. Bar-Shira, V. N. Ivanov, S. Y. Fuchs, S. Henderson, V. A. Fried, T. Minamoto, D. Alarcon-Vargas, M. R. Pincus, et al. 2001. Jun NH2-terminal kinase phosphorylation of p53 on Thr-81 is important for p53 stabilization and transcriptional activities in response to stress. Mol. Cell. Biol. 21: 2743–2754. 58. Spengler, M. L., and M. G. Brattain. 2006. Sumoylation inhibits cleavage of Sp1 N-terminal negative regulatory domain and inhibits Sp1-dependent transcription. J. Biol. Chem. 281: 5567–5574. 59. Han, I., and J. Kudlow. 1997. Reduced O glycosylation of Sp1 is associated with increased proteasome susceptibility. Mol. Cell. Biol. 17: 2550 –2558. 60. Su, K., X. Yang, M. D. Roos, A. J. Paterson, and J. E. Kudlow. 2000. Human Sug1/p45 is involved in the proteasome-dependent degradation of Sp1. Biochem. J. 348: 281–289. 61. Bonnema, J., L. Karnitz, R. Schoon, R. Abraham, and P. Leibson. 1994. Fc receptor stimulation of phosphatidylinositol 3-kinase in natural killer cells is associated with protein kinase C-independent granule release and cell-mediated cytotoxicity. J. Exp. Med. 180: 1427–1435. 62. Tassi, I., M. Cella, R. Presti, A. Colucci, S. Gilfillan, D. R. Littman, and M. Colonna. 2008. NK cell activating receptors require PKC-␪ for sustained signaling, transcriptional activation and IFN-␥ secretion. Blood 112: 4109 – 4116.