Knockdown of c-MET induced apoptosis in ABCB1 ... - Nature

Cancer Gene Therapy (2015) 22, 262–270 © 2015 Nature America, Inc. All rights reserved 0929-1903/15 www.nature.com/cgt

ORIGINAL ARTICLE

Knockdown of c-MET induced apoptosis in ABCB1-overexpressed multidrug-resistance cancer cell lines T-H Hung1, Y-H Li2, C-P Tseng1,2,3, Y-W Lan1, S-C Hsu4,5, Y-H Chen6, T-T Huang7, H-C Lai1,2, C-M Chen8,9,10, K-B Choo11 and K-Y Chong1,2,3 Inappropriate c-MET signaling in cancer can enhance tumor cell proliferation, survival, motility, and invasion. Inhibition of c-MET signaling induces apoptosis in a variety of cancers. It has also been recognized as a novel anticancer therapy approach. Furthermore, reports have also indicated that constitutive expression of P-glycoprotein (ABCB1) is involved in the HGF/c-METrelated pathway of multidrug resistance ABCB1-positive human hepatocellular carcinoma cell lines. We previously reported that elevated expression levels of PKCδ and AP-1 downstream genes, and HGF receptor (c-MET) and ABCB1, in the drug-resistant MES-SA/Dx5 cells. Moreover, leukemia cell lines overexpressing ABCB1 have also been shown to be more resistant to the tyrosine kinase inhibitor imatinib mesylate. These findings suggest that chemoresistant cancer cells may also develop a similar mechanism against chemotherapy agents. To circumvent clinical complications arising from drug resistance during cancer therapy, the present study was designed to investigate apoptosis induction in ABCB1-overexpressed cancer cells using c-MET-targeted RNA interference technology in vitro and in vivo. The results showed that cell viability decreased and apoptosis rate increased in c-MET shRNAtransfected HGF/c-MET pathway-positive MES-SA/Dx5 and MCF-7/ADR2 cell lines in a dose-dependent manner. In vivo reduction of tumor volume in mice harboring c-MET shRNA-knockdown MES-SA/Dx5 cells was clearly demonstrated. Our study demonstrated that downregulation of c-MET by shRNA-induced apoptosis in a multidrug resistance cell line. Cancer Gene Therapy (2015) 22, 262–270; doi:10.1038/cgt.2015.15; published online 24 April 2015

INTRODUCTION Multidrug resistance (MDR) is a major clinical obstacle in cancer therapy. P-glycoprotein 1 (permeability glycoprotein, abbreviated as P-gp or Pgp), also known as MDR protein 1 (MDR1) or ATPbinding cassette subfamily B member 1 (ABCB1) or cluster of differentiation 243 (CD243), is a glycoprotein that in humans is encoded by the ABCB1 gene. Overexpression of ABCB1 causes effluxes of therapeutic drugs from cancer cells that prevent effective treatment. As ABCB1 expression in normal tissues leads to higher toxicity in cancer treatment with an ABCB1 inhibitor,1,2 Researchers have focused on the molecular pathway of MDR cancer cells as a strategy in the development new molecular targets, including Pregnane X receptor,3 tyrosine kinase,4 cyclic guanosine monophosphate (cGMP)-specific phosphodiesterase type 5 (PDE5),5 and Wnt5A.6 The hepatocyte growth factor (HGF)-related pathway is involved in cancer metastasis,7 proliferation,8 drug resistance9 and cell cycle progression.10 c-MET is a HGF receptor tyrosine kinase that is abnormally expressed in different types of tumors.11–13 Aberrant binding of HGF to c-MET induces the activation of matrix metalloproteinases and urokinase plasminogen activator14,15 in numerous types of cancers, including bladder, renal, cervical, colon, breast, ovary, lung, esophagus, gastric and head and neck cancers.16

Studies have shown that the inhibition of c-MET expression by RNA interference reduces growth rates and metastasis in glioma17 or enhanced chemosensitivity in multiple myeloma.18,19 However, c-MET shRNA was significantly affected by cells proliferation, survival, invasiveness and metastasis in glioma, rhabdomyosarcoma, laryngeal carcinoma and breast ductal carcinoma cells.17,20–23 The HGF/c-MET pathway is recently been considered as a therapeutic target. A series of c-MET kinase inhibitors have been developed for studies in cancer therapy include K252a,24 SU-1127425 and PHA665752.12 To date, several c-MET inhibitors, such as cabozantinib and foretinib, are being used in clinical trials.26 It has been shown that constitutive expression of ABCB1 is involved in the HGF/c-MET-related pathway in ABCB1-positive human hepatocellular carcinoma cell lines.10,27 We previously reported that elevated expression levels of PKCδ and the AP-1 downstream genes, HGF receptor (c-MET) and ABCB1 in the drugresistant MES-SA/Dx5 cells.28 Furthermore, leukemia cell lines overexpressing the ABCB1 gene have also been shown to be more resistant to the tyrosine kinase inhibitor imatinib mesylate.29,30 These findings suggest that chemoresistant cancer cells may also develop a similar mechanism against c-MET inhibitors. The present study focused on evaluating HGF/c-MET-related

1 Graduate Institute of Biomedical Sciences, Division of Biotechnology, College of Medicine, Chang Gung University, Tao-Yuan, Republic of China; 2Department of Medical Biotechnology and Laboratory Science, College of Medicine, Chang Gung University, Tao-Yuan, Republic of China; 3Molecular Medicine Research Center, College of Medicine, Chang Gung University, Tao-Yuan, Republic of China; 4Cancer Molecular Diagnostic Laboratory, Chang-Gung Memorial Hospital, Lin-Kou Medical Center, Tao-Yuan, Republic of China; 5Department of Pathology, Chang-Gung Memorial Hospital, Lin-Kou Medical Center, Tao-Yuan, Republic of China; 6Graduate Institute of Pharmaceutical Sciences and Graduate Institute of Clinical Pharmacy, College of Medicine, National Taiwan University, Taipei, Republic of China; 7Center for Molecular and Clinical Immunology, College of Medicine, Chang Gung University, Tao-Yuan, Taiwan, Republic of China; 8Department of Life Sciences, National Chung Hsing University, Taichung, Republic of China; 9Agricultural Biotechnology Center, National Chung Hsing University, Taichung, Republic of China; 10Rong-Hsing Translational Medicine Center, National Chung Hsing University, Taichung, Republic of China and 11Department of Preclinical Sciences, Faculty of Medicine and Health Sciences and Centre for Stem Cell Research, Universiti Tunku Abdul Rahman, Selangor, Malaysia. Correspondence: Professor K-Y Chong, Department of Medical Biotechnology and Laboratory Science, College of Medicine, Chang Gung University, 259 WenHwa 1st Road, Gui-Shan, Tao-Yuan, Taiwan 333, Republic of China. E-mail: [email protected] Received 15 March 2014; revised 10 February 2015; accepted 10 February 2015; published online 24 April 2015

c-MET shRNA-induced apoptosis in MDR cancer cells T-H Hung et al

263 pathway expression and applying the c-MET shRNA techniques to induce apoptosis in MDR cancer cells. In this work, two multidrugresistant cancer cell lines, the human uterine sarcoma cell line MES-SA/Dx5 and the breast adenocarcinoma cell line MCF-7/ ADR2, were cultured in the presence of doxorubicin; ABCB1 was also overexpressed for analysis of the effects in this study. We noted that the expression level of HGF and its downstream genes, HGF receptor (c-MET) and urokinase plasminogen activator (uPA) were upregulated in drug-resistant MDR cancer cells. We also showed that cell viability was decreased in c-MET shRNAtransfected MES-SA/Dx5 cells in a dose-dependent manner both in vivo and in vitro, suggesting that HGF/c-MET signaling has an important role in MDR cancer cells. MATERIALS AND METHODS Cell culture The multidrug-resistant cell line MES-SA/Dx5 (CRL-1977; ATCC, Manassas, VA, USA) was established from the human sarcoma cell line MES-SA (CRL-1976; ATCC) in the presence of increasing doxorubicin concentrations as described previously.31 All the cell lines were continuously maintained in McCoy’s 5A medium supplemented with 10% fetal bovine serum and 2 mM antimycotics (Invitrogen Corp., Carlsbad, CA, USA) under 95% air and 5% CO2 at 37 °C. The MES-SA/Dx5 cell line was maintained in the continuous presence of 1.7 μM doxorubicin (Sigma-Aldrich, St Louis, MO, USA). The multidrug-resistant cell line MCF-7/ADR2 was established from the human mammary gland adenocarcinoma cell line MCF-7 (ATCC HTB22) in the presence of increasing doxorubicin concentrations followed by previously described.32 The MCF-7/ADR2 cell line was maintained in the continuous presence of 0.25 μM doxorubicin (Sigma-Aldrich). Both cell lines were be grown in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum and 2 mM antimycotics (Invitrogen).

Western blot analysis Total cellular proteins were isolated from cell lines by the PRO-PREP Protein Extraction Solution (Intron Biotechnology, Kyonggi-do, Korea). Nuclear and cytoplasmic proteins were isolated using the NE-PER Nuclear and Cytoplasmic Extraction Reagents (Pierce, Rockford, IL, USA). Western blot was performed as described previously.28 Briefly, approximately 25 or 50 μg total proteins was loaded onto each lane and the proteins were separated in sodium dodecyl sulphate-polyacrylamide gel electrophoresis gels. After electrophoresis, the resolved proteins were transferred to a PVDF membrane (Millipore, Billerica, MA, USA) and subsequently stained with Ponceau S (Sigma-Aldrich) to confirm complete protein transfer. The membranes were blocked with 5% nonfat dry milk in PBS-T (0.1% Tween20 in phosphate-buffered saline (PBS), pH7.4) for 1 h and probed overnight with the following antisera at appropriate dilutions: 1:1000 dilution of the anti-MDR-1 (sc-13131, Santa Cruz Biotechnology, Dallas, TX, USA), a 1:1000 dilution of the anti-HGF(sc-1357, Santa Cruz Biotechnology), a 1:1000 dilution of the anti-c-MET (1996-1, Epitomics, Burlingame, CA, USA), a 1:1000 dilution of the anti-PARP and anti-Cleaved-PARP (MAB3290 and MAB3565, (Millipore), and a 1:10 000 dilution of the anti β-actin (MAB1501, Millipore) antiserum in PBS–Tween-20. Identification of each protein was achieved with the Western Lighting Plus Reagent (Perkin Elmer, Waltham, MA, USA) using an appropriate alkaline phosphatase-conjugated secondary antibody. The level of each protein in the western blot analysis was detected by the LAS-3000 chemiluminescence detection device (Fujifilm, Valhalla, NY, USA). To adjust for loading differences, the optical density of each protein was normalized to that of the β-actin band.

Plasmid construction A cDNA encoding the fusion protein of Luciferase-EGFP, pL3-TRE-LucGFP-2L, was obtained from Addgene (Cambridge, MA, USA). The 2.5-kb fragment containing the complete coding region of Luciferase-EGFP was released from pL3-TRE-LucGFP-2L by SacIl and EcoRV double digestion and was filled in. The DNA fragment was then ligated into of lentiviral vector, pLenti 6.2 (Life Technologies), and designated pLenti-LucEGFP.

shRNA The c-MET shRNA clone (TRCN0000121248; CCTTCAGAAGGTTGCTGAGTA) targeted at the human MET transcript, and the control scramble © 2015 Nature America, Inc.

shRNA clone (CCTAAGGTTAAGTCGCCCTCGCTC) in a red fluroscence protein-containing expression vector TRC009 were purchased from the National RNAi Core Facility (Academia Sinica, Taipei, Taiwan, Republic of China).

Viral production and viral transduction Virus stocks were prepared by cotransfecting the pLenti-LucEGFP, c-MET shRNA plasmid or control scramble shRNA plasmid with three packaging plasmids, pMDLg/pRRE, CMV-VSVG and RSV-Rev, into 293 T cells. The viral supernatants were collected 36–48 h later, filtered and centrifuged at 20 000 × g for 90 min. The viral titer was determined by the method of end point dilution through counting the number of infected red cells at × 100 magnification under a fluorescence microscope (Nikon, Tokyo, Japan) 96 h after infection to 293 T cells. Titer in transducing units was computed as follows: (TU)/ml = (the numbers of red fluorescent cells) × (dilution factor)/ (volume of virus solution). Viral particle was quantified by HIV quantification ELISA kit. MES-SA/Dx5 cells were seeded in 12-well plate and the cell was transduced with equal viral particle of pLenti-LucEGFP virus particle following the method of Chan et al.33 and the stably transducted cells were designated MES-SA/Dx5-LG.

Transient transfection For transient transfection, cells were plated at a density of 1 × 105 cells per well in a 24-well plate and were transfected with DNA of indicated concentrations (Promega, Madison, WI, USA) premixed with 2 μl Lipofectamine 2000 (Invitrogen) for 48 h. At the end of the incubation, cells were either lysed by the passive lysis buffer (Promega) to perform caspase 3/7 assays and apoptosis analysis, or were assayed by cell viability assay and colony formation.

Quantitative real-time RT-PCR The RT-PCR was performed as previously described.34 Briefly, total RNA (2 μg) was prepared from the transfectants and was treated with DNase I. The RNAs were reverse transcribed into cDNAs at 42 °C for 60 min using Moloney Murine Leukemia Virus Reverse Transcriptase (Invitrogen). After the oligo (dT)-primed reverse transcription reaction, real-time PCR was performed in a LightCycler 480 (Roche, Mannheim, Germany) in 96-well plates. The reaction mixture was 1 μl RT product, 15 μl RealQ-PCR Master Mix Kit (Ampliqon AqS, Odense, Denmark), 1 μl each of 10 μM forward and reverse primers, and the complete total volume was adjusted to 10 μl with nuclease-free water. The real-time PCR program was: preincubation at 50 °C for 2 min, initial denaturation at 95 °C for 7 min and 45 cycles at 95 °C for 10 s, 63 °C for 15 s and 72 °C for 30 s. The program was terminated by a final extension at 60 °C for 1 min and cooling at 40 °C for 5 min. For normalization, the mRNA level of the β-actin gene in each RNA preparation was determined. Relative gene expression was determined by the ΔΔCt method, where Ct = threshold cycle. The relative targeted mRNA levels were normalized to the mRNA level of the reference β-actin gene. The melting curve of the amplification product was always checked to ensure a single clean peak that represented good-quality real-time PCR data.

Cell viability MTT assay Cells were plated at a density of 1 × 105 cells per well in a 24-well plate. The cells were then treated with the indicated concentrations of various drugs in different sets of experiments. After 48 h of drug incubation, the medium was removed and PBS was used to wash the cells. Thiazolyl Blue Tetrazolium (Sigma-Aldrich; 200 μl) was added to each well and was incubated with the cells at 37 °C for 2 h. Subsequence, 400 μl dimethyl sulfoxide was added to each well and incubation at 37 °C was continued for 20 min. Absorbance of the mixture was read at 540 nm using a Microplate Reader (VersaMax, Molecular Devices, Sunnyvale, CA, USA). Cell viability (%) was calculated as the ratio of the surviving cells in each drugtreated experiment set to that of the control.

Colony-formation assay The cells were plated at a density of 5 × 105 cells per well in a 6-well plate and grown for 24 h. After c-MET shRNA transfection, the cells were grown in the replaced fresh medium for 24 h. The cells were then replated at a density of 100 cells per 10 cm2 dish and grown for 7–8 days until discrete colonies were visualized. After washing with PBS, the colonies were stained with 0.5% crystal violet and counted. After cell counting, cell number was Cancer Gene Therapy (2015), 262 – 270


264 estimated by dissolving the crystal violet in 70% ethanol (4 ml per well) and then optical density values measured at 562 were used as previously reported.35 In each group, cells transfected with the control scramble shRNA were set at 100%. Results (mean ± s.d.) represent data from triplicate wells.

with anti-c-MET (Epitomics) or anti-active caspase antibodies (SigmaAldrich) using the sensitive Dako-REAL, Alkaline-Phosphatase/RED detection system (Dako, Glostrup, Denmark). Hematoxylin was used for counterstaining according to the manufacturer’s protocol.

Statistical analysis Caspase 3/7 assay MES-SA and MES-SA/Dx5 cells were plated at a density of 8 × 103 cells per well in a 96-well plate. The cells were then treated with the indicated dosages of PHA665752 and/or verapamil for 48 h. At the end of the drug treatment, 100 μl Caspase-Glo 3/7 Reagent (Promega) was added to the treated cells in each well. After 30 min of incubation at room temperature, the relative luminescence unit was measured by GLOMAX 20/20 Luminometer (Promega) and as an indication of Caspase 3/7 apoptotic activity.

Flow cytometric analysis of apoptosis In preparation of flow cytometry, pc-MET-shRNA plasmid-transfected cells were collected at the indicated time points. The cells were then stained with Annexin V and propidium iodine by using the Annexin V-FITC Apoptosis Detection Kit (Strong Biotech Corp, Taipei, Taiwan, Republic of China) following the manufacturer’s protocol.

Tumor xenografts in nude mice Eight-week-old male BALB/c nude mice were purchased from the National Laboratory Animal Center (Taipei, Taiwan, Republic of China). The Institutional Animal Care committee of Chang Gung University approved these experiments. The mice were maintained in an air-conditioned animal facility under constant temperature and humidity conditions with a 12:12 light–dark cycle and the mice were allowed ad libitum in the diet or drinking water. Mice were randomly picked to different groups and each group had at least five or more mice. c-MET shRNA or control scramble shRNA-transfected MES-SA/Dx5 cells (1 × 106) was subcutaneous transplanted into BALB/c nude mice as previously described.35 Tumor volumes (V) were calculated as V (mm3) = (L × W2)/2, where L was the largest diameter and W was the diameter perpendicular to L.

c-MET shRNA lentivirus intratumor injection Eight-week-old female BALB/c nude mice were purchased from the National Laboratory Animal Center (Taipei, Taiwan, Republic of China). All the in vivo experimental protocols were approved by the Chung Gung University Animal Center. The mice were anesthetized. Cultured tumor cells were removed by trypsinization, washed twice with PBS and suspended in McCoy’s 5a medium. MES-SA/Dx5-LG cells (1 × 106) were mixed with Matrigel (BD Bioscience, San Jose, CA, USA) followed by subcutaneous injection into the dorsal region near the thigh of the mouse as previously described.6 Upon tumor establishment, mice were allocated to the following groups: (a) scramble shRNA as the control group; (b) c-MET shRNA as the experiment group. Upon reaching a volume of 500 mm3, intratumoral injections of viral particles at a titer of 107 TU in 100 μl PBS were initially performed. The tumor volume was measured every 7 days up to 3 weeks, and the volume of a tumor was calculated using the formula V (mm3) = (L × W2)/2 where L and W indicate the length and width of a tumor, respectively. On day 21 treatment with doxorubicin, all mice were killed and tumors were resected, weighed and frozen or fixed in formalin and paraffin embedded for immunohistochemical studies.

Bioluminescent IVIS imaging system Xenografted nude mice were kept in a chamber and were anesthetized with 2% isofluorane/oxygen mixture and i.p. injection with 20 mg ml− 1 −1 D-luciferin (Promega) in PBS (200 mg kg ). Mice were sedated using isoflurane, and live anesthetized mice were imaged using the Bioluminescent IVIS Imaging system (Xenogen Corp., Alameda, CA, USA). The resulting light emission was quantified using the LivingImage software (Xenogen Corp.). Raw values were reported as photons s − 1 cm −2 sr − 1.

Immunohistochemical staining studies Paraffin sections from c-MET-transfected MES-SA/Dx5 xenograft tumor specimen were microwave heated (750-W, three 5-min cycles) in 10 mM citrate, pH 6.0 or 1 mM EDTA, pH 8.0 and immunostaining was performed Cancer Gene Therapy (2015), 262 – 270

The surviving fraction and the relative luminescence unit were measured in triplicate samples and were expressed as mean ± s.d. The Student’s t-test was used for statistical analysis. Po 0.05 was considered as statistically significant.

RESULTS Elevated expression of HGF pathway-related genes in the MDR cells The MES-SA/Dx5 and MCF7/ADR2 cells, which overexpressed ABCB1 but not ABCC1 and ABCG2, were selected from MES-SA and MCF7 cell lines by doxorubicin treatment (Figure 1).36,37 Realtime PCR quantification showed that the expression levels of ABCB1 was increased by 4300-fold in MES-SA/Dx5 (Figure 1a) and by 430-fold in MCF-7/ADR2 (Figure 1b). Western blot analysis showed that ABCB1 expression occurred only in MES-SA/Dx5 cells and MCF-7/ADR2 cells (Figure 2a). To characterize modulation of the HGF pathway in the drug-resistant cells, expression levels of genes involved in the HGF pathway, including HGF and c-MET, were evaluated in MES-SA/Dx5 and MCF-7/ADR2 cell lines by western blot analysis. The data indicated that HGF and c-MET expression levels were increased in the MES-SA/Dx5 and MCF-7/ ADR2 cell lines when compared with the respective parental cells (Figure 2a). Real-time PCR quantification showed that the expression levels of HGF, c-MET and uPA were increased by 43-fold in MES-SA/Dx5 (Figure 2b) and by 41.5-fold in MCF-7/ ADR2 (Figure 2c) when compared with the respective parental cells. Thus, these data indicated that the HGF pathway was activated in the drug-resistant cells. Decreased cell viability in c-MET shRNA-transfected MDR cells As the HGF pathway was activated in the drug-resistant MES-SA/ Dx5 and MCF-7/ADR2 cells, we further used RNA interference to reverse c-MET expression for reducing cell viability in these cells. Cell viability MTT assay and colony-formation assay were used to monitor the viability of the MES-SA/Dx5 and MCF7/ADR2 cell lines that were transfected with c-MET shRNA in comparison with transfection with scrambled shRNA as the control at different dosages. The cell viability MTT assay showed that the survival rate of both cell lines declined with increasing concentration of c-MET shRNA transfection (Figure 3a and b). Compared with MCF7/ADR2 cells, the survival rate of MES-SA/Dx5 cells was more greatly affected by c-MET shRNA transfection (Figure 3a and b). Furthermore, the colony-formation ability was decreased in the c-MET shRNA-transfected MES-SA/Dx5 cells (Figure 3c and e) and MCF7/ADR2 cells (Figure 3d) in a dose-dependent manner compared with the control set. To verify induction of apoptosis by c-MET shRNA in MDR cells, caspase 3/7 activity assay and detection of annexin V apoptosis were performed. c-MET expression was significantly reduced in c-MET shRNA-transfected MES-SA/Dx5 cells (Figure 4a), but not in the control using scrambled shRNA-transfected MES-SA/Dx5 cells (data not shown). The cleavage of the caspase 3 substrate PARP increased in c-MET shRNA-transfected MES-SA/Dx5 and MCF7/ ADR2 cells (Figure 4b). Furthermore, caspase 3/7 activities were found to increase two- and three-fold in c-MET shRNA-transfected MES-SA/Dx5 cells when transfected with 100 and 200 ng c-MET shRNA, respectively (Figure 4c). The caspase 3/7 activity was also increased 2- and 2.5-fold in MCF7/ADR2 cells at 100 and 200 ng c-MET shRNA, respectively (Figure 4d). Apoptotic cell death increased significantly in the c-MET-transfected MES-SA/Dx5 and © 2015 Nature America, Inc.


265

Figure 1. ABCB1 was upregulated in MES-SA/Dx5 and MCF7/ADR2 cells. mRNA expression levels of ABCB1, ABCG2 or ABCC1 in (a) MES-SA and MES-SA/Dx5 or (b) MCF-7 and MCF-7/ADR2 cells. Expression levels were normalized to β-actin. Data represent means ± s.d. of three independent experiments. **P o0.01 indicate the differences between the drug-resistant and the parental cells.

Figure 2. Upregulation of hepatocyte growth factor (HGF)/c-MET signaling in MDR cells. (a) Protein expression of ABCB1, HGF and MET of MES-SA and MES-SA/Dx5 cells or MCF-7 and MCF-7/ADR2 cells, mRNA expression levels of HGF, c-MET or uPA in (b) MES-SA and MES-SA/Dx5 or (c) MCF-7 and MCF-7/ADR2 cells. Expression levels were normalized to β-actin. Data represent means ± s.d. of three independent experiments. *P o0.05 and **P o0.01 indicate the differences between the drug resistant and the parental cells.

MCF7/ADR2 cells at days 3 and 7 posttransfection (Figure 4e and f). The data indicated that downregulation of c-MET by RNA interference significantly reduced cell viability and induced apoptosis of the drug-resistant MES-SA/Dx5 and MCF7/ADR2 cells in a dose-dependent manner. Reduction of tumor volume in c-MET shRNA-knockdown MES-SA/Dx5 cells in vivo To assess the effects of c-MET knockdown on drug-resistant cells in an animal model, c-MET shRNA-transfected MES-SA/Dx5 cells were injected subcutaneously into nude mice (n = 5 per group). c-MET shRNA was found to substantially delay tumor growth in © 2015 Nature America, Inc.

comparison with the control scrambled shRNA-treated group (Figure 5a) from weekly monitoring of the tumor size in the injected mice. As c-MET shRNA was observed to markedly induce apoptosis in vitro (see Figure 4 above) and that c-MET-depleted MES-SA/Dx5 cells showed retarded tumor growth in vivo, we further evaluated the effects of intratumoral injection of c-MET shRNA lentivirus into the MES-SA/Dx5-LG subcutaneous xenograft tumors in the mouse model. At day 35 after the xenograft, there were significant decreases in the tumor volume of the c-MET shRNA lentiviral vector transduction group when comparison with the control scrambled shRNA vector-treated group (Figure 5b). The IVIS luciferase imaging results further indicated that c-MET shRNA lentiviral transduction led to slower tumor growth when Cancer Gene Therapy (2015), 262 – 270


266

Figure 3. Reduction of cell viability in transient c-MET–shRNA-knockdown MDR cells. (a) MES-SA/Dx5 or (b) MCF-7/ADR2 cells were transfected with the indicated concentrations of c-MET–shRNA plasmid for 48 h. At the end of the treatment, cells were collected for measurement of viability by using the MTT assay. (c) MES-SA/Dx5 and (d) MCF-7/ADR2 cells were transfected with the indicated concentrations of c-MET-shRNA plasmid for 48 h. At the end of the treatment, cells were collected for measurement of viability by using the colony-formation assay and colony-formation was scored after 7 days. (e) Representative images of colony-forming assay from MES-SA/Dx5 cells. Data represent means ± s.d. of three independent experiments. *Po0.05 indicate the differences between the c-MET–shRNA-knockdown MDR cells and the respective untreated controls. *Po0.05, the viability are expressed as the mean ± s.d. (n = 3).

compared with the control scramble shRNA (Figure 5c and d). The tumor sizes of the xenografts of the c-MET shRNA lentivirustransduced MES-SA/Dx5 cells were reduced 4-fold in the mean relative tumor volume compared to those of the vector control cells at 21 days of c-MET shRNA treatment (Figure 5e and f). Furthermore, xenografts of c-MET shRNA lentivirus-transduced MES-SA/ Dx5 cells showed induced caspase 3 activation (Figure 5g). Taken together, c-MET knockdown inhibited tumor formation in vivo. DISCUSSION Involvement of the HGF/c-MET pathway in regulating drug resistance in MDR cancer cells Le Vee et al.38 investigated the expression levels of drug resistance-related proteins in human hepatocytes and found that Cancer Gene Therapy (2015), 262 – 270

ABCB1 and the breast cancer resistance protein were upregulated in the cells. Lasagna et al.27 reported that HGF interacted with its receptor c-MET controlled Ets-1 for angiogenesis activity in an ABCB1-positive human hepatocellular carcinoma cell line. Hung et al.28 reported that FZD1 regulated PKCδ and its signaling transduction pathway, such as the AP-1 downstream genes, HGF receptor (c-MET) and ABCB1 has an important role in drug resistance in the human uterine sarcoma cell line MES-SA/Dx5. In addition, siRNA knockdown of the ABCB1 gene led to decreased HGF expression.27 Furthermore, ABCB1 was reported to be involved in HGF/MET autocrine loop in celecoxib-induced autophagy and cell cycle arrest in ABCB1-expressing hepatocellular carcinoma cell lines.10 In this work, higher expression levels of HGF pathway-related genes were found in the drug-resistant MCF-7/ADR2 and MES-SA/Dx5 cell lines (Figure 2). Therefore, our data supported that HGF signaling had an important role in MDR © 2015 Nature America, Inc.


267

Figure 4. Induction of apoptosis in transient c-MET shRNA-knockdown MDR cells. (a) Protein expression of MET of indicated cells after c-MET shRNA transfection for 48 h in western blot analysis. (b) Expression of PARP and cleaved PARP of indicated cells after c-MET shRNA transfection for 48 h in western blot analysis. MDR cells were transfected with the indicated concentrations of c-MET–shRNA plasmid for 48 h. At the end of the treatment, cells were collected for measurement of caspase 3/7 activities of shRNA-transfected (c) MES-SA/Dx or (d) MCF-7/ADR2 cells using the Caspase-Glo 3/7 assay. The activity was detected by luminescence and was proportional to its intensity which was normalized by cell viability. Annexin V-stained cells of shRNA-transfected (e) MES-SA/Dx5 or (f) MCF-7/ADR2 cells using the Flow cytometric analysis at the indicated time points. Data represent means ± s.d. of three independent experiments. *P o0.05 or **P o0.01 indicate the differences between the transient c-MET shRNA-knockdown MDR cells and the respective untreated controls.

of cancer cells. As several c-MET inhibitors have been approved for clinical trials, selected components of the HGF pathway might be effective therapeutic targets in MDR cancers. Involvement of the P-glycoprotein in regulating drug resistance against the c-MET inhibitor in MDR cancer cells Many c-MET kinase inhibitors have been developed for inhibiting the HGF/MET pathway in cancers,12,24,25 but drug resistance to kinase inhibitors was discovered only in recent years. Drug resistance of kinase inhibitors was also reported in several leukemic cell lines or clinical cases resistant to treatment with tyrosine kinase inhibitors. © 2015 Nature America, Inc.

Furthermore, Bcr-abl-positive leukemic and ABCB1-expressing cells were resistant to the tyrosin kinase inhibitor, imatinib.29,30 Brendel et al.39 found that resistance to imatinib and nilotinib in ABCG2transduced K562 cells occurred via P-CRKL downregulation. Moreover, CGP74588, which is a metabolite of the tyrosine kinase inhibitor Gleevec, has lower apoptosis and antiproliferation abilities in resistant K562/Dox cells,40 indicating that drug resistance of tyrosine kinase inhibitors occurred in ABCB1-expressing cells. Moreover, the combination of verapamil and tyrosine kinase inhibitor raises the risk of cumulative cardiac toxicity.41 In addition, the evidences indicated that tyrosine kinase inhibitor gefitinib resistance was found in ABCG2-transduced human lung cancer PC-9 cells.42 Cancer Gene Therapy (2015), 262 – 270


268

Figure 5. Reduction of tumor formation ability in c-MET shRNA-knockdown MES-SA/Dx5 cells in vivo. (a) Tumor growth curve at indicated time points of c-MET shRNA or control scramble shRNA vector-transfected MES-SA/Dx5 cells were subcutaneous transplanted into nude mice. (b) Intratumoral injections of c-MET shRNA lentiviral particles into the MES-SA/Dx5-LG xenografted nude mice. (c) Tumor formation and (d) tumor luciferase activity of c-MET shRNA (left) and control scramble shRNA (right) after shRNA lentivirus intratumor injection was monitored by BLI of c-MET shRNA and control scramble shRNA cells after shRNA lentivirus intratumor injection monitored by using BLI at day 21 and 35. (e) tumor and (f) tumor weight of c-MET shRNA and control scramble shRNA-transduced MES-SA/Dx5 cells. (g) Immunohistochemistry staining of c-MET and activated caspase 3 in c-MET shRNA- and control scramble shRNA-transduced MES-SA/ Dx5 cells.

Enhancement of apoptosis and reduction of tumorigenicity in c-MET shRNA-treated MDR cells in vivo and in vitro c-MET inhibition by RNA interference or specific inhibitors as a therapeutic approach has been reported for several types of cancers. Such an application in NSCLC and SCLC cells has been shown to lead to reduced viability and proliferation in vitro and in vivo.43,44 Several reports have demonstrated that the use of either viral or nonviral vector of c-MET shRNA delivery system inhibited proliferation, tumorigenicity,45 migration and invasion abilities of cancer cell lines.46,47 Likewise, c-MET shRNA also induced apoptosis17,48 as well as inhibited c-MET-mediated Erk signaling.49 Furthermore, Que et al.19 observed that the downregulation of c-MET by short-hairpin RNA inhibited the Cancer Gene Therapy (2015), 262 – 270

proliferation, adherence and invasiveness of human multiple myeloma U266 cells as well as increased the chemosensitivity of these cells to doxorubicin. Moreover, our results demonstrated that c-MET shRNA in MDR cells induced apoptosis and increased the accumulation of cleavage PARP and Caspase 3/7 activities (Figure 4). We have also shown that c-MET shRNA-induced apoptosis and reduced tumorigenicity in MDR cells in vivo (Figure 5). Taken together, our data showed that the c-MET shRNA-induced silencing of HGF/c-MET signaling shows greater potential in MDR cancer therapy. CONFLICT OF INTEREST The authors declare no conflict of interest.

© 2015 Nature America, Inc.


ACKNOWLEDGMENTS This work was supported in part by the Taiwan Ministry of Science and Technology, NSC 95-2320-B-182-028-MY3 and MOST 103-2320-B-182-021 to KYC, NSC 99-2632B-182-001-MY3 to CPT, NSC 102-2815-C-182-062-B to YHL. The Chang Gung Memorial Hospital Grant (CMRPD 34012, CMRPD 180133, CMRPD1B0472, CMRPD1B0473) and Taiwan Ministry of Education (EMRPD1C0121). The IVIS imaging facilities were supported by the SPF Animal Center Animal Image Laboratory, Chang Gung University. The tissue slide imaging by HistoFAXS of Molecular Imaging Center, Chang Gung Memorial Hospital, Linkou Medical Center, TaoYuan. Taiwan.

REFERENCES 1 Lum BL, Gosland MP. MDR expression in normal tissues. Pharmacologic implications for the clinical use of P-glycoprotein inhibitors. Hematol Oncol Clin North Am 1995; 9: 319–336. 2 Thomas H, Coley HM. Overcoming multidrug resistance in cancer: an update on the clinical strategy of inhibiting p-glycoprotein. Cancer Control 2003; 10: 159–165. 3 Vadlapatla RK, Vadlapudi AD, Pal D, Mitra AK. Mechanisms of drug resistance in cancer chemotherapy: coordinated role and regulation of efflux transporters and metabolizing enzymes. Curr Pharm Des 2013; 19: 7126–7140. 4 Wang YJ, Zhang YK, Kathawala RJ, Chen ZS. Repositioning of tyrosine kinase inhibitors as antagonists of atp-binding cassette transporters in anticancer drug resistance. Cancers (Basel) 2014; 6: 1925–1952. 5 Shi Z, Tiwari AK, Shukla S, Robey RW, Singh S, Kim IW et al. Sildenafil reverses ABCB1- and ABCG2-mediated chemotherapeutic drug resistance. Cancer Res 2011; 71: 3029–3041. 6 Hung TH, Hsu SC, Cheng CY, Choo KB, Tseng CP, Chen TC et al. Wnt5A regulates ABCB1 expression in multidrug-resistant cancer cells through activation of the non-canonical PKA/β-catenin pathway. Oncotarget 2014; 5: 12273–12290. 7 Locatelli A, Lofgren KA, Daniel AR, Castro NE, Lange CA. Mechanisms of HGF/Met signaling to Brk and Sam68 in breast cancer progression. Horm Cancer 2012; 3: 14–25. 8 Mueller KL, Madden JM, Zoratti GL, Kuperwasser C, List K, Boerner JL. Fibroblastsecreted hepatocyte growth factor mediates epidermal growth factor receptor tyrosine kinase inhibitor resistance in triple-negative breast cancers through paracrine activation of Met. Breast Cancer Res 2012; 14: R104. 9 Chen CT, Kim H, Liska D, Gao S, Christensen JG, Weiser MR. MET activation mediates resistance to lapatinib inhibition of HER2-amplified gastric cancer cells. Mol Cancer Ther 2012; 11: 660-669. 10 Mazzanti R, Platini F, Bottini C, Fantappie O, Solazzo M, Tessitore L. Downregulation of the HGF/MET autocrine loop induced by celecoxib and mediated by P-gp in MDR-positive human hepatocellular carcinoma cell line. Biochem Pharmacol 2009; 78: 21–32. 11 Li Y, Chen CQ, He YL, Cai SR, Yang DJ, He WL et al. Abnormal expression of E-cadherin in tumor cells is associated with poor prognosis of gastric carcinoma. J Surg Oncol 2012; 106: 304–310. 12 Crosswell HE, Dasgupta A, Alvarado CS, Watt T, Christensen JG, De P et al. PHA665752, a small-molecule inhibitor of c-Met, inhibits hepatocyte growth factor-stimulated migration and proliferation of c-Met-positive neuroblastoma cells. BMC Cancer 2009; 9: 411. 13 Berthou S, Aebersold DM, Schmidt LS, Stroka D, Heigl C, Streit B et al. The Met kinase inhibitor SU11274 exhibits a selective inhibition pattern toward different receptor mutated variants. Oncogene 2004; 23: 5387–5393. 14 Pepper MS, Matsumoto K, Nakamura T, Orci L, Montesano R. Hepatocyte growth factor increases urokinase-type plasminogen activator (u-PA) and u-PA receptor expression in Madin-Darby canine kidney epithelial cells. J Biol Chem 1992; 267: 20493–20496. 15 Jeffers M, Rong S, Vande Woude GF. Enhanced tumorigenicity and invasionmetastasis by hepatocyte growth factor/scatter factor-met signalling in human cells concomitant with induction of the urokinase proteolysis network. Mol Cell Biol 1996; 16: 1115–1125. 16 Organ SL, Tsao MS. An overview of the c-MET signaling pathway. Ther Adv Med Oncol 2011; 3: S7–S19. 17 Chu SH, Feng DF, Zhang H, Chen ET, Duan ZX, Li XY et al. c-Met-targeted RNA interference inhibits growth and metastasis of glioma U251 cells in vitro. J Neurooncol 2009; 93: 183–189. 18 Que W, Chen J, Chuang M, Jiang D. Knockdown of c-Met enhances sensitivity to bortezomib in human multiple myeloma U266 cells via inhibiting Akt/mTOR activity. APMIS 2012; 120: 195–203. 19 Que W, Chen J. Knockdown of c-Met inhibits cell proliferation and invasion and increases chemosensitivity to doxorubicin in human multiple myeloma U266 cells in vitro. Mol Med Report 2011; 4: 343–349.


269 20 Taulli R, Scuoppo C, Bersani F, Accornero P, Forni PE, Miretti S et al. Validation of met as a therapeutic target in alveolar and embryonal rhabdomyosarcoma. Cancer Res 2006; 66: 4742–4749. 21 Phillip CJ, Stellrecht CM, Nimmanapalli R, Gandhi V. Targeting MET transcription as a therapeutic strategy in multiple myeloma. Cancer Chemother Pharmacol 2009; 63: 587–597. 22 Ji CY, Xie ZN, Chen JC, Wang YN, Guan LL, Li HT et al. [RNA interference targeting c-Met inhibits proliferation of human laryngeal carcinoma Hep-2 cell line in vitro and in its xenografts in nude mice]. Zhonghua Er Bi Yan Hou Tou Jing Wai Ke Za Zhi 2010; 45: 61–67. 23 Lee SJ, Seol HJ, Lee HW, Kang WY, Kang BG, Jin J et al. Gene silencing of c-Met leads to brain metastasis inhibitory effects. Clin Exp Metastasis 2013; 30: 845–854. 24 Morotti A, Mila S, Accornero P, Tagliabue E, Ponzetto C. K252a inhibits the oncogenic properties of Met, the HGF receptor. Oncogene 2002; 21: 4885–4893. 25 Arena S, Pisacane A, Mazzone M, Comoglio PM, Bardelli A. Genetic targeting of the kinase activity of the Met receptor in cancer cells. Proc Natl Acad Sci USA 2007; 104: 11412–11417. 26 Sharma N, Adjei AA. In the clinic: ongoing clinical trials evaluating c-METinhibiting drugs. Ther Adv Med Oncol 2011; 3: S37–S50. 27 Lasagna N, Fantappie O, Solazzo M, Morbidelli L, Marchetti S, Cipriani G et al. Hepatocyte growth factor and inducible nitric oxide synthase are involved in multidrug resistance-induced angiogenesis in hepatocellular carcinoma cell lines. Cancer Res 2006; 66: 2673–2682. 28 Hung TH, Chen CM, Tseng CP, Shen CJ, Wang HL, Choo KB et al. FZD1 activates protein kinase C delta-mediated drug-resistance in multidrug-resistant MES-SA/ Dx5 cancer cells. Int J Biochem Cell Biol 2014; 53: 55–65. 29 Chen L, Wang JM, Xu XP, Gao L, Fei XH, Lou JW et al. [The reverse effect on drugresistance against tyrosine kinase inhibitor STI571 in mdr1 and bcr-abl positive leukemic cells]. Zhongguo Shi Yan Xue Ye Xue Za Zhi 2003; 11: 600–603. 30 Mahon FX, Belloc F, Lagarde V, Chollet C, Moreau-Gaudry F, Reiffers J et al. MDR1 gene overexpression confers resistance to imatinib mesylate in leukemia cell line models. Blood 2003; 101: 2368–2373. 31 Chong KY, Hsu CJ, Hung TH, Hu HS, Wang TH, Wang CH et al. Wnt pathway activation and ABCB1 expression account for attenuation of proteasome Inhibitor-mediated apoptosis in multidrug-resistant cancer cells. Cancer Biol Ther 2015; 16: 149–159. 32 Ke W, Yu P, Wang J, Wang R, Guo C, Zhou L et al. MCF-7/ADR cells (re-designated NCI/ADR-RES) are not derived from MCF-7 breast cancer cells: a loss for breast cancer multidrug-resistant research. Med Oncol 2011; 28: S135–S141. 33 Chan AW, Chong KY, Martinovich C, Simerly C, Schatten G. Transgenic monkeys produced by retroviral gene transfer into mature oocytes. Science 2001; 291: 309–312. 34 Huang TT, Chong KY, Ojcius DM, Wu YH, Ko YF, Wu CY et al. Hirsutella sinensis mycelium suppresses interleukin-1β and interleukin-18 secretion by inhibiting both canonical and non-canonical inflammasomes. Sci Rep 2013; 3: 1374. 35 Chong KY, Lai CC, Su CY. Inducible and constitutive HSP70s confer synergistic resistance against metabolic challenges. Biochem Biophys Res Commun 2013; 430: 774–779. 36 Calcagno AM, Ambudkar SV. Molecular mechanisms of drug resistance in single-step and multi-step drug-selected cancer cells. Methods Mol Biol 2010; 596: 77–93. 37 Calcagno AM, Salcido CD, Gillet JP, Wu CP, Fostel JM, Mumau MD et al. Prolonged drug selection of breast cancer cells and enrichment of cancer stem cell characteristics. J Natl Cancer Inst 2010; 102: 1637–1652. 38 Le Vee M, Lecureur V, Moreau A, Stieger B, Fardel O. Differential regulation of drug transporter expression by hepatocyte growth factor in primary human hepatocytes. Drug Metab Dispos 2009; 37: 2228–2235. 39 Brendel C, Scharenberg C, Dohse M, Robey RW, Bates SE, Shukla S et al. Imatinib mesylate and nilotinib (AMN107) exhibit high-affinity interaction with ABCG2 on primitive hematopoietic stem cells. Leukemia 2007; 21: 1267–1275. 40 Mlejnek P, Dolezel P, Faber E, Kosztyu P. Interactions of N-desmethyl imatinib, an active metabolite of imatinib, with P-glycoprotein in human leukemia cells. Ann Hematol 2011; 90: 837–842. 41 Haouala A, Widmer N, Duchosal MA, Montemurro M, Buclin T, Decosterd LA. Drug interactions with the tyrosine kinase inhibitors imatinib, dasatinib, and nilotinib. Blood 2011; 117: e75–e87. 42 Katayama K, Shibata K, Mitsuhashi J, Noguchi K, Sugimoto Y. Pharmacological interplay between breast cancer resistance protein and gefitinib in epidermal growth factor receptor signaling. Anticancer Res 2009; 29: 1059–1065. 43 Ma PC, Jagadeeswaran R, Jagadeesh S, Tretiakova MS, Nallasura V, Fox EA et al. Functional expression and mutations of c-Met and its therapeutic inhibition with SU11274 and small interfering RNA in non-small cell lung cancer. Cancer Res 2005; 65: 1479–1488.

Cancer Gene Therapy (2015), 262 – 270


270 44 Wang ZX, Lu BB, Yang JS, Wang KM, De W. Adenovirus-mediated siRNA targeting c-Met inhibits proliferation and invasion of small-cell lung cancer (SCLC) cells. J Surg Res 2011; 171: 127–135. 45 Zhang SZ, Pan FY, Xu JF, Yuan J, Guo SY, Dai G et al. Knockdown of c-Met by adenovirus-delivered small interfering RNA inhibits hepatocellular carcinoma growth in vitro and in vivo. Mol Cancer Ther 2005; 4: 1577–1584. 46 Xie B, Tang DG, Dong JH. Effects of c-met-siRNA on the growth and invasion of hepatocellular carcinoma MHCC97-H cells. Zhonghua Gan Zang Bing Za Zhi 2006; 14: 499–504.

Cancer Gene Therapy (2015), 262 – 270

47 Xie B, Xing R, Chen P, Gou Y, Li S, Xiao J et al. Down-regulation of c-Met expression inhibits human HCC cells growth and invasion by RNA interference. J Surg Res 2010; 162: 231–238. 48 Li Y, Zhang S, Tang Z, Chen J, Kong W. Silencing of c-Met by RNA interference inhibits the survival, proliferation, and invasion of nasopharyngeal carcinoma cells. Tumour Biol 2011; 32: 1217–1724. 49 Leelawat K, Leelawat S, Tepaksorn P, Rattanasinganchan P, Leungchaweng A, Tohtong R et al. Involvement of c-Met/hepatocyte growth factor pathway in cholangiocarcinoma cell invasion and its therapeutic inhibition with small interfering RNA specific for c-Met. J Surg Res 2006; 136: 78–84.
