L-type calcium channel Cav1.2 is required for ...

JBC Papers in Press. Published on August 4, 2015 as Manuscript M115.672675 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M115.672675

L-type calcium channel Cav1.2 is required for maintenance of auditory brainstem nuclei

Running title: Role of Cav1.2 in auditory neurons Lena Ebbers1, Somisetty V. Satheesh1, Katrin Janz2, Lukas Rüttiger3, Maren Blosa4, Franz Hofmann5, Markus Morawski4, Désirée Griesemer2, Marlies Knipper3, Eckhard Friauf2, Hans Gerd Nothwang1,6,* Neurogenetics group, Center of Excellence Hearing4All, School of Medicine and Health Sciences, Carl von Ossietzky University Oldenburg, 26111 Oldenburg, Germany 2 Animal Physiology Group, Department of Biology, University of Kaiserslautern, POB 3049, 67663 Kaiserslautern, Germany 3 University of Tübingen, Department of Otolaryngology, Hearing Research Centre Tübingen (THRC), Molecular Physiology of Hearing, Elfriede Aulhorn Str. 5, 72076 Tübingen, Germany 4 Paul Flechsig Institute of Brain Research, Faculty of Medicine, University Leipzig, Liebigstrasse 19, 04103 Leipzig, Germany 5 FOR923, Pharmakologie, Technische Universität, Biedersteiner Str. 29, D-80802 München 6 Research Center for Neurosensory Science, Carl von Ossietzky University Oldenburg, 26111 Oldenburg, Germany

*Corresponding author: Hans Gerd Nothwang Department of Neurogenetics, Center of Excellence Hearing4All, Carl von Ossietzky University Oldenburg, 26111 Oldenburg, Germany Phone: +49-(0)441-798-3932 Fax: +49-(0)441-798-5649 E-mail: [email protected]

Key words apoptosis; calcium channel; mouse; neuron; circuit formation; Egr2::Cre;

Background: Cav1.2 is a calcium channel involved in excitation-coupled postsynaptic signaling. Results: Targeted deletion of Cav1.2 in the auditory brainstem causes early postnatal cell death. Conclusion: Cav1.2 is essential for survival of auditory brainstem neurons shortly after circuit formation. Significance: This study identifies common and distinct functions of neuronal L-type calcium channels. Abstract

Cav1.2 and Cav1.3 are the major L-type voltage-gated Ca2+ channels in the CNS. Yet, their individual in vivo functions are largely unknown. Both channel subunits are expressed in the auditory brainstem, where Cav1.3 is essential for proper maturation. Here, we investigated the role of Cav1.2 by targeted deletion in the mouse embryonic auditory brainstem. Similar to Cav1.3, loss of Cav1.2 resulted in a significant decrease in volume and cell number of auditory nuclei. Contrary to deletion of Cav1.3, action potentials of LSO neurons were narrower compared to controls, whereas firing behavior

Copyright 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Downloaded from http://www.jbc.org/ at CARL VON OSSIETZKY UNIVERSITÄT OLDENBURG on August 6, 2015

1

Role of Cav1.2 in auditory neurons

We recently reported an essential role of Cav1.3 for proper development and function of auditory brainstem structures in mice: lack of Cav1.3 channels results in a reduced volume of major auditory nuclei (33, 34), impaired refinement of tonotopic projections (35), and abnormal auditory brainstem responses (34). Auditory brainstem neurons express both Cav1.2 and Cav1.3 (36). Therefore, they offer an excellent opportunity to delineate the contributions of both channels to neuronal development and function. To investigate the role of Cav1.2, we here employed a conditional knockout approach and deleted Cacna1c in the mouse auditory brainstem from embryonic stages onwards. This resulted in structural abnormalities of auditory nuclei. In contrast to the scenario after Cav1.3 loss, auditory brainstem responses were nearly normal. Perinatal analyses revealed that Cav1.2 is required for early postnatal survival of auditory neurons. In summary, Cav1.2 and Cav1.3 are both essential for the integrity of the auditory brainstem but differ in their requirement for proper physiological function of auditory neurons.

INTRODUCTION L-type voltage-gated Ca2+ channels (L-VGCCs)1 serve as key transducers in the plasma membrane, converting membrane depolarization to intracellular signaling (1). They consist of a pore-forming subunit and auxiliary , , and  subunits (1, 2). Of the four subunits Cav1.1-Cav1.4, neurons mainly express Cav1.2 and Cav1.3 (3). During brain development, these two subunits participate in various processes, such as neuronal survival (4, 5), neurite outgrowth (6, 7), maturation of GABAergic synapses (8, 9), positioning of the axon initiation segment (10), and myelination (11). In the mature brain, L-VGCCs are important for longterm potentiation (12) and glutamate receptor trafficking (13, 14). The lack of isoform-specific pharmacological tools against the two subunits has long precluded the dissection of their precise in vivo roles (15, 16). Results from human genetics and transgenic mice have only recently provided some insights into these roles (16). In humans, mutations in Cacna1c, which encodes Cav1.2, are associated with Timothy syndrome, characterized by cardiac arrhythmia, syndactyly, cognitive abnormalities, and autism (17), Brugada syndrome-3 (18), associated with shorter QT intervals, or early repolarization syndrome with an abnormal electroencephalography pattern (19). Furthermore, genome-wide association studies have linked Cacna1c polymorphisms to

Experimental procedures Animals—Cacna1cfl/fl mice (23) and the Credriver line Egr2::Cre (37) were described previously. Homozygous Cacna1cfl/fl mice were crossed with mice containing the locus Egr2::Cre in the heterozygous state and the Cacna1cfl locus in the homozygous state (Cacna1cfl/fl). Consequently, 50% of the offspring had the genotype

2


psychiatric disorders such as schizophrenia and bipolar disorders (20–22). In mice, constitutive ablation of Cacna1c causes embryonic lethality (23), whereas region-specific deletion in hippocampus and neocortex results in impaired spatial learning (24). Conversely, altered function of Cav1.3 is linked to sinoatrial node dysfunction and deafness (25, 26), impaired consolidation of fear memory (27), autism spectrum disorders (28), and adrenal aldosterone-producing adenomas (29). Despite this information, virtually nothing is known about the individual roles of Cav1.2 and Cav1.3 during neuronal development, despite the fact that numerous pharmacological studies demonstrated the importance of L-VGCCs for neuronal survival in vitro and in vivo (5, 30–32).

and neurotransmission appeared unchanged. Furthermore, auditory brainstem responses were nearly normal in mice lacking Cav1.2. Perineuronal nets were also unaffected. The medial nucleus of the trapezoid body underwent a rapid cell loss between postnatal days P0 and P4, shortly after circuit formation. Phosphorylated CREB, nuclear NFATc4, and expression levels of p75NTR, Fas, and FasL did not correlate with cell death. These data demonstrate for the first time that both Cav1.2 and Cav1.3 are necessary for neuronal survival, but differentially required for biophysical properties of neurons. Thus, they perform common as well as distinct functions in the same tissue.

Role of Cav1.2 in auditory neurons the subcellular localization of detected proteins was taken into account and met expectations (pCREB in the nucleus; NeuN in the nucleus of neurons, i.e. no colocalization with microglia marker Iba1; Sort1 in the Golgi complex). Antibodies were diluted as indicated in carrier solution containing 1% bovine serum albumin, 1% goat serum, and 0.3% Triton X-100 in phosphate-buffered saline (PBS), pH 7.4. For staining with goat anti-Sort1, a carrier without goat serum was used. Free-floating 30-µm-thick cryosections were incubated overnight at 7 °C, washed three times in PBS and incubated in carrier solution with Alexa Fluor Dye-coupled secondary antibodies (diluted 1:1,000, Invitrogen) for 1 h at room temperature. Finally, slices were washed and mounted onto gelatinecoated slides. Immunohistochemistry of neonatal tissue (P0-P4) was performed on-slide. To obtain optimal staining results for p-CREB, NFATc4, Sort1, Iba1 and Kcnma1 staining, antigen retrieval was performed using standard 10 mM trisodium citrate buffer treatment for 2 min (pH 6). Images were taken with a BZ 8100 E fluorescence microscope (Keyence, NeuIsenburg, Germany) or with a TCS SP2 confocal laser scanning microscope (Leica, Wetzlar, Germany). Files were obtained using the Keyence BZ observation software or the Leica confocal software and processed in Adobe Photoshop CS6 (Adobe Systems, San José, California, USA). Quantification of Kcnma1 immunosignals was performed with ImageJ (U. S. National Institutes of Health, Bethesda, Maryland, USA). A region of interest of 70 µm x 70 µm was defined within the central lateral superior olive (LSO)10 as well as outside the superior olivary complex (SOC)11 for background subtraction. Grey values were calculated and statistical analysis was performed using two-tailed Student’s t-test after testing for Gaussian distribution of the datasets with SPSS Version 21.0 (IBM Corp., Armonk, New York, USA). In case of a non-Gaussian distribution, a Mann-Whitney U test was performed. Nissl staining was performed on consecutive 30-µm-thick sections. The volume of auditory nuclei was calculated by multiplying the outlined area with the thickness of each section. Three young-adult animals (P25–30) and two young animals (P0, P4) were used from each genotype. Analysis was carried out blind to the respective

Immunohistochemistry and Nissl staining— Fluorescent immunohistochemistry was performed as described previously (33, 38). Applied antibodies were: polyclonal rabbit antiVGlut12 (1:1,500, gift from Dr. S. El Mestikawy, Creteil, Cedex, France), monoclonal rabbit antip-CREB3 (1:500, #9198, Cell Signaling Technology, Danvers, Massachusetts, USA), polyclonal rabbit anti-NFATc44 (1:200, HPA031641, Sigma-Aldrich, St. Louis, Missouri, USA), polyclonal rabbit anti-p75NTR5 (1:500, AB1554, Millipore, Darmstadt, Germany) polyclonal goat anti-Sort16 (1:500, AF2934, Novus Biologicals, Littleton, Colorado, USA), rabbit polyclonal anti-Iba17 (1:1,000, #234003, Synaptic Systems, Göttingen, Germany), mouse monoclonal anti-NeuN8 (1:1,000, ab104224, Abcam, Cambridge, UK) and rabbit polyclonal anti-Kcnma19 (1:200, HPA-05464, SigmaAldrich). Nuclear staining was carried out with TO-PRO®-3 according to the manufacturer’s instructions (T3605, Molecular Probes, Waltham, Massachusetts, USA). Specificity of antibodies used was given by analyses and reliable information from the manufacturer: Sigma prestige antibodies anti-NFATc4 and anti-Kcnma1 were thoroughly tested by immunohistochemistry against hundreds of normal and disease tissues in the human protein atlas (http://www.proteinatlas.org), anti-p-CREB was tested by western blot analysis, specificity of anti-p75NTR is routinely evaluated by immunoprecipitation, anti-Sort1 was tested by direct ELISA and western blotting, and anti-Iba1 and anti-NeuN were tested by immunohistochemistry and western blotting. Anti-p75NTR and anti-NeuN are also listed in a collection of trustworthy antibodies by the Journal of Comparative Neurology. In addition,

3


Egr2::Cre;Cacna1cfl/fl (abbreviated Cacna1cEgr2) and 50% Cacna1cfl/fl. The latter served as littermate controls. Mice were maintained at a C57BL/6 background, and animals of both sexes were used. The day of birth was taken as postnatal day (P) 0. All protocols were in accordance with the German Animal Protection law and approved by the local animal care and use committee (LAVES Oldenburg; RP Tübingen; LUA Koblenz). Protocols also followed the NIH guide for the care and use of laboratory animals.

Role of Cav1.2 in auditory neurons total of 45 cycles. Additionally, melting curves were generated to verify specificity of products. Samples were analyzed using the method by Pfaffl (40). All values were normalized to RPL3 and reported as fold change in expression of Cacna1cEgr2 compared to Cacna1cfl/fl. Statistical analysis was performed as mentioned above.

genotype. Sections were then analyzed using ImageJ, and statistical analysis was performed as mentioned above.

Extracellular matrix immunohistochemistry and determination of cell diameters—Control and Cacna1cEgr2 animals (P70, n = 3, 3) were perfused transcardially under deep CO2 anesthesia with 100 ml 0.9% NaCl and 0.1% heparin following 100 ml fixative containing 4% paraformaldehyde and 0.1% glutaraldehyde in 0.1 M phosphate-buffered saline (PBS, pH 7.4). Brains were removed from the skull and postfixed in the same fixation solution overnight. The tissue was cryoprotected in 30% sucrose containing 0.01% sodium azide. 30-µm-thick coronal sections were individually collected in PBS containing 0.1% azide. Before staining, sections were pre-treated with 60% methanol containing 1% H2O2 for 30 min following a blocking step with a blocking solution containing 2% BSA, 0.3% milk powder, and 0.5% donkey serum in PBS-Tween (0.05%) for 1 h. All antibodies were incubated in the same blocking solution overnight at 4 °C and were applied as follows: a polyclonal rabbit antiaggrecan antibody (1:1,000, AB1031, Millipore) that recognizes an epitope within amino acids 1177-1326 near the central domain of aggrecan at chondroitin sulfate glycosaminoglycan binding sites (41); a monoclonal mouse antibrevican antibody (1:1,000, BDB610894 clone2, BD Biosciences), detecting an 50 kDa Nterminal fragment and full length brevican (41), and a polyclonal sheep anti-neurocan antibody (1:1,000, AF5800, R&D Systems) recognizing full-length neurocan (42). Visualization of primary antibodies was performed by Cy3-conjugated anti-rabbit, antigoat, anti-sheep, or anti-mouse antibodies raised in donkeys (1:1,000, Dianova). Image stacks were taken with a BZ 9000 fluorescence microscope (Keyence). Cell diameters were determined on full focus image stacks. Based on the neurocan immunoreaction in about 10 consecutive sections, cell diameters were measured of 10 principal cells per section using the BZ analyzer software. Statistical analysis

4


Quantitative RT-PCR analysis—SOC tissue was collected from P2 animals as described (39). Briefly, 200-µm-thick brainstem slices were used to dissect the SOC from both sides under visual inspection. Tissue was stored at -80 °C until further use. For RNA isolation, SOC tissue from five animals was pooled to obtain sufficient yield per biological replicate. Two biological replicas were prepared for each genotype. Total RNA was extracted using the innuPREP RNA Mini Kit (Analytik Jena, Jena, Germany). cDNA was synthesized following the protocol of the RevertAid RT reverse transcription kit (Fermentas, Waltham, Massachusetts, USA). In order to confirm Cre-mediated deletion of exons 14 and 15 in dissected SOC tissue of Cacna1cEgr2 mice, RT-PCR was performed as previously described (23) with the primer pair VS11 (CTGGAATTCCTTGAGCAACCTTGT) and VS16 (AATTTCCACAGATGAAGAGGATG). GAPDH12 was amplified using the primers GAPDH forward (AATTTCCACAGATGAAGA GGATG) and GAPDH reverse (CTTGGCAGCACCAGTGGATG). Quantitative RT-PCR was performed on a LightCycler 96 system (Roche, Basel, Switzerland) using the FastStart Essential DNA Green Master (Roche) containing SYBR green. Primers used were as follows: RPL313 forward (GGTTTGCGCAAAGTTGCCTG), RPL3 reverse (ACCATCTGCACAAAGTGGTC), Fas14 forward (CCAGAAATCGCCTATGGTTG) Fas reverse (GTCATGTCTTCAGCAATTCTC), FasL15 forward (GACAGCAGTGCCACTTCATC) FasL reverse (ACTCCAGAGATCAGAGCGGT), p75NTR forward (AGACCTCATAGCCAGCACAG), p75NTR reverse (ACTGTAGAGGTTGCCATCAC), Sort1 forward (TTGATGACCTCAGTGGCTCAG) and Sort1 reverse (CCAAACATACTGCTTTGTGG). Each reaction was run in triplicate with the following thermocycling protocol: 95 °C for 5 min; 95 °C for 10 s, 60 °C for 10 s and 72 °C for 10 s for a

Role of Cav1.2 in auditory neurons

Auditory evoked brainstem responses and otoacoustic emissions—Auditory brainstem responses (ABR)16 and distortion product otoacoustic emission (DPOAE)17 were recorded in adult mice, anesthetized with a mixture of ketamine hydrochloride (75 mg/kg body weight, Pharmacia, Erlangen, Germany) and xylazine hydrochloride (5 mg/kg body weight, Bayer, Leverkusen, Germany). Electrical brainstem responses to free field click (100 µs), noise burst (1 ms), and pure tone (3 ms, 1 ms ramp) stimuli were recorded with subdermal silver wire electrodes at the ear, the vertex, and the back of the animals. After amplification and bandpass filtering (200 Hz - 5 kHz), signals were averaged for 64-256 repetitions at each sound pressure presented (usually 0-100 dB SPL in steps of 5 dB). Thresholds were determined by the lowest sound pressure that evoked visually distinct potentials from above threshold to near threshold. The cubic 2f1-f2 DPOAE was measured for f2 = 1.24×f1 and L2 = L1-10 dB. Emission signals were recorded during sound presentation of 260 ms and averaged four times for each sound pressure and frequency presented. First, the 2f1-f2 distortion product amplitude was measured with L1 = 50 dB SPL and f2 between 4 and 32 kHz. Subsequently, the 2f1-f2 distortion product amplitude was measured for L1 ranging from -10 to 65 dB SPL at frequencies of f2 between 4.0 and 32.0 kHz. Average ABR wave curves are presented as mean ± SEM. Peak amplitudes and latencies were collected, grouped in clusters of similar peak amplitudes and latencies, and averaged for ABR-wave input-output analysis. Clusters of peaks were found at average latencies n0.9-p1.2 (wave I), n1.5-p2.2 (wave II), n2.9-p3.5 (wave III), and n3.9-p4.9 (wave IV) (n = negative peak, p = positive peak, number = peak latency in ms). Differences of the mean were compared for statistical significance by Student’s t-test, alphalevels corrected for multiple testing by Bonferroni-Holms, and 2-way ANOVA (GraphPad Prism 2.01). Statistical significance was tested at alpha = 0.05, and resulting P-values are reported in the text and figures.

5


Electrophysiology—Patch-clamp recordings in the whole-cell configuration were performed in acutely prepared slices on principal LSO neurons showing an IH current (43). Animals were decapitated at P12±2 and their brains were quickly removed. Coronal brainstem slices containing the superior olivary complex (270 μm thick, 1-2 slices per animal) were cut on a vibratome (VT-1200 S, Leica, Bensheim, Germany) in ice-cold preparation solution (composition in mM: NaHCO3, 26; NaH2PO4, 1.25; KCl, 2.5; MgCl2, 1; CaCl2, 2; D-glucose, 260; sodium pyruvate, 2; myo-inositol, 3; kynurenic acid, 1; pH 7.4 when bubbled with 95% O2 and 5% CO2) and then stored at 37 °C for 1 h in artificial cerebro-spinal fluid (ACSF)13 (composition in mM: NaCl, 125; NaHCO3, 25; NaH2PO4, 1.25; KCl, 2.5, MgCl2, 1; CaCl2, 2; Dglucose, 10; sodium pyruvate, 2; myoinositol, 3; ascorbic acid 0.44; pH 7.4 when bubbled with 95% O2 and 5% CO2). Thereafter, they were stored at room temperature before being transferred into a recording chamber in which they were continually superfused with ACSF. The chamber was mounted on an upright microscope (Eclipse E600FN, Nikon, Tokyo, Japan) equipped with differential interference contrast optics (Nikon objectives: 4× CFI Achromat, 0.1 NA; 60× CFI Fluor W, 1.0 NA) and an infrared video camera system (CCD camera C5405-01, Hamamatsu, Herrsching, Germany; PC frame grabber card, pciGrabber4plus, PHYTEK, Mainz, Germany). Patch pipettes were pulled from borosilicate glass capillaries (GB150(F)-8P, Science Products, Hofheim, Germany) with a horizontal puller (P87, Sutter Instruments, Novato, USA). They had resistances of 3–6 MΩ when filled with artificial intracellular solution (composition in mM: potassium gluconate, 140; EGTA, 5; MgCl2, 1; HEPES, 10; Na2ATP, 2; Na2GTP, 0.3; pH 7.2 with KOH; liquid junction potential: 15.4 mV) and were connected to an EPC 10 patch-clamp amplifier (HEKA Elektronik, Lambrecht, Germany). The liquid junction potential was corrected online. Sample frequency was 20 kHz and cut-off frequency of low-pass filtering was 10 kHz. Series resistance was routinely compensated by 10-30%. Biophysical properties of the neurons were assessed at room temperature. To analyze passive membrane properties and spiking

was performed with Sigma Plot 12.5 software (Systat Software GmbH, Germany) by performing a Mann-Whitney U test.

Role of Cav1.2 in auditory neurons characteristics, recordings were performed in current-clamp mode and 200-ms-long rectangular current pulses were injected from 200 pA to +450 pA in 50 pA steps. Synaptic responses were analyzed from voltageclamp recordings at a holding potential of 70 mV and nearly physiological temperature (36±1°C). To evoke inhibitory postsynaptic currents (eIPSCs), a theta glass electrode (TST150-6, WPI) with a tip diameter of 10-20 μm was filled with ACSF and placed lateral to the MNTB. Biphasic pulses (each 100 μs) were applied through a programmable pulse generator (STG4004, Multi Channel Systems, Reutlingen, Germany). The amplitude of the stimulus pulses was 500-3,000 μA and was set to achieve stable synaptic responses with an amplitude jitter of