Lack of IL-10 synthesis by murine alveolar macrophages upon ...

Lack of IL-10 synthesis by murine alveolar macrophages upon lipopolysaccharide exposure. Comparison with peritoneal macrophages Laurent Salez,* Monique Singer,* Viviane Balloy,* Christophe Cre´minon,† and Michel Chignard* *Unite´ de Pharmacologie Cellulaire, Unite´ Associeé Institut Pasteur/Institut National de la Sante´ et de la Recherche Me´dicale 485, Paris; and †Service de Pharmacologie et d’Immunologie, Commissariat a` l’Eńergie Atomique, Saclay, France

Abstract: The central role of alveolar macrophages in the establishment of lipopolysaccharide (LPS)-induced lung inflammation is well demonstrated. They produce and release numerous proinflammatory molecules, among which is tumor necrosis factor ␣ (TNF-␣), a cytokine responsible in part for the neutrophilic alveolitis. Interleukin-10 (IL-10) produced by LPS-activated mononuclear phagocytes is a major anti-inflammatory cytokine that down-regulates TNF-␣ synthesis. We studied the ability of murine alveolar macrophages to produce IL-10 in vivo and in vitro, in response to LPS. Unexpectedly, the IL-10 protein was not detected in the whole lung and airspaces after LPS intranasal instillation. In addition, no IL-10 protein was found in supernatants of isolated and LPSstimulated alveolar macrophages. The lack of IL-10 synthesis was confirmed by the absence of specific RNA transcripts. By contrast and as expected, autologous peritoneal macrophages produced IL-10 upon LPS challenge. Drugs that usually modify the TNF-␣/IL-10 balance in favor of IL-10 were used without success. Thus, maneuvers allowing an increase in intracellular cAMP concentrations did not reverse this unexpected phenotype. Moreover, direct activation of protein kinase C with PMA was unable to trigger IL-10 formation by alveolar, by contrast to peritoneal, macrophages. The current findings describe a specific phenotype for murine alveolar macrophages during LPS-induced inflammation. J. Leukoc. Biol. 67: 545–552; 2000. Key Words: inflammation · cAMP · lung

INTRODUCTION Gram-negative sepsis is one of the most common causes of the acute respiratory distress syndrome (ARDS), a lung injury characterized by an overwhelming inflammatory reaction, during which cytokines play a central role [1, 2]. Administration of lipopolysaccharide (LPS), a component of the wall of gramnegative bacteria, to laboratory animals initiates many responses that mimic the clinical signs of ARDS, in particular the

migration of polymorphonuclear neutrophils (PMN) from the pulmonary microcirculation into the alveolar spaces [3]. LPS stimulates monocytes/macrophages to produce different mediators and particularly tumor necrosis factor ␣ (TNF-␣) [4], considered as a primary inducer of inflammation [5, 6]. Alveolar macrophages are active participants in the formation of TNF-␣, which in turn is involved in the genesis of the PMN alveolitis [7–9]. After the pioneering works of Spengler et al. [10] and Tannenbaum and Hamilton [11], a number of in vitro studies have shown that adenosine 3’,5’-cyclic monophosphate (cAMP) elevating agents down-regulate LPS-induced TNF-␣ synthesis. Experiments focusing on the use of phosphodiesterase (PDE) inhibitors extended the data to in vivo situations [12]. By contrast, these pharmacological agents increase the release of interleukin-10 (IL-10) from LPS-activated mononuclear phagocytes [13, 14]. It has been suggested that this elevated production of IL-10 contributes to the inhibition of TNF-␣ formation [13, 15]. Indeed, IL-10 is a cytokine with antiinflammatory properties [16, 17] which, through a negative feedback mechanism, deactivates macrophages [18, 19]. In vivo, IL-10 reduces the formation of TNF-␣ [20] and the intensity of cellular recruitment at the lung level upon LPS challenge [21, 22]. Our laboratory recently developed a mouse model to mimic the local lung inflammation caused by bacterial particles present in inhaled air. After LPS administration to the lung airspaces, a significant production of TNF-␣ was detected in the bronchoalveolar lavage fluids (BALF) followed by the infiltration of PMN [9]. In a subsequent study, it was shown that treatment of mice with a PDE inhibitor led to an increase of cAMP in alveolar macrophages with a significant reduction of both TNF-␣ synthesis and PMN recruitment [23]. According to the literature and our own data, we hypothesized that IL-10 production by alveolar macrophages should be increased under such conditions. As an end result, the TNF-␣/IL-10 balance would be tilted in favor of IL-10, limiting de facto the

Correspondence: Laurent Salez, Unite´ de Pharmacologie Cellulaire, Unite´ Associeé IP/INSERM 485, Institut Pasteur, 25 rue du Dr. Roux, 75015 Paris, France. E-mail: [email protected] Received July 19, 1999; revised November 18, 1999; revised December 20, 1999; accepted December 22, 1999.

Journal of Leukocyte Biology Volume 67, April 2000 545

inflammatory process. Experiments were thus undertaken to verify this assumption, leading to the unexpected finding that mice alveolar macrophages do not produce IL-10 upon LPS challenge. The defective presence of IL-10 in such circumstances may explain in part the complications during gramnegative infection-induced lung injury.

MATERIALS AND METHODS Reagents LPS (Escherichia coli 055:B5) was from Difco Laboratories (Detroit, MI). Rolipram was a gift from Rhoˆne Poulenc-Rorer. N6,O28-dibutyryladenosine-3’,5’cyclic monophosphate sodium salt monohydrate (dbcAMP) was from ICN Biochemicals (Aurora, OH). Pentoxifylline, diltiazem, glutaraldehyde, boranetrimethylamine complex, and phorbol 12-myristate 13-acetate (PMA) were from Sigma Chemical (St. Louis, MO). Thioglycollate broth was from Sanofi Diagnostics Pasteur (Marnes La Coquette, France). RPMI 1640 medium was from Life Technologies (Grand Island, NY). Fetal calf serum (FCS) was from Boehringer Mannheim (Mannheim, Germany).

Mice Seven-week-old male C57Bl/6 mice weighing 25–30 g were provided by the Centre d’Elevage R. Janvier (Le Genest St. Isle, France). A few experiments were performed with BALB/c and BP2 mice provided by the same center. Absence of subclinical infection was verified by the lack of interferon-␥ detection in the BALF of naive or LPS-treated mice (Cytosets, Biosource International, Camarillo, CA).

Analysis of airway cells after LPS administration Upon ether anesthesia, mice received different doses of LPS or an equivalent volume of saline intranasally (50 µL). At different time intervals, animals were killed by intraperitoneal administration of a lethal dose of pentobarbital sodium (Sanofi, Libourne, France), tracheas were cannulated, and lungs were washed eight times with 0.5 mL saline to provide 4 mL of BALF. Aliquots of each BALF were used to evaluate the differential cell number after centrifugation and hematoxylin/eosin staining. BALF supernatants were collected by centrifugation (300 g, 15 min, 4°C) and stored at ⫺20°C until assayed for IL-10 and TNF-␣ levels. In some experiments LPS was given intraperitoneally and the peritoneal cavity was lavaged at different time points with 2 mL saline. Lavages were then processed as BALF.

Preparation of lung homogenates At different times after LPS instillation, mice were killed and the thorax opened. Lung vessels were flushed to discard circulating blood. The left atrium was thus open, and 5 mL of saline were gently perfused into the right ventricle. Lungs were removed and then homogenized for 30 s (Potter-Elvejhem glass homogenizer, Thomas, Philadelphia, PA) at 4°C in 1 mL phosphate-buffered saline (PBS). Homogenates were then centrifuged (10,000 g, 10 min, 4°C), and supernatants were stored at ⫺20°C until assayed for IL-10 and TNF-␣.

Preparation of cells from bronchoalveolar and peritoneal lavages Naive mice were killed by an intravenous injection of a lethal dose of pentobarbital sodium. Resident alveolar macrophages were obtained by lung lavage performed as described above. Peritoneal macrophages were obtained from peritoneal lavages carried out with a sterile saline solution and represented ⬃50% of the total cell population. For experiments concerning the pharmacological modulations of IL-10 and TNF-␣ synthesis, mice were injected intraperitoneally with 1.5 mL of thioglycollate broth 4 days before peritoneal lavages. Inflammatory macrophages then represented 90% of the total cells recovered. Collected cells were counted (Coulter Electronics, Luton, UK) and centri-

546

Journal of Leukocyte Biology Volume 67, April 2000

fuged at 400 g for 20 min. Cells were resuspended in RPMI 1640 medium supplemented with 2 mM glutamine, 100 U/mL penicillin, 100 µg/mL streptomycin, and 3% FCS (v/v), and dispensed into 96-well tissue culture plates (TPP, ATGC Biotechnologie, Noisy le Grand, France). Cells (⬃2 ⫻ 105 macrophages) were incubated in a 5% CO2 humidified atmosphere for 1 h at 37°C before nonadherent cells were removed by washing with RPMI 1640 medium. Adherent macrophages thus obtained were incubated in a 5% CO2 humidified atmosphere at 37°C, possibly in the presence of different pharmacological agents before challenge with LPS. RPMI 1640 medium supplemented with antibiotics, glutamine, and 10% FCS was the culture medium employed in this study. Conditioned media (300 µL) were collected, centrifuged (400 g, 10 min, 4°C), and stored at ⫺20°C until assayed for IL-10 and TNF-␣. In all cases, experiments were performed with a pool of cells collected from several mice, as indicated in the figure legends. All time points were performed in triplicate.

Measurement of immunoreactive IL-10 production by enzyme immunometric assay Availability of only one rat anti-murine IL-10 mAb (JES-2A5) led us to perform a recently developed protocol known as solid-phase immunoenzyme assay (SPIE-IA) [24, 25]. This sequential method allowed us to perform an immunometric assay using the same antibody for both capture and revelation steps. The assay relies on the reaction of the thiol groups of mAb F(ab)’ fragments with maleimido groups previously introduced into acetylcholinesterase (AchE) as previously described [26]. Anti-IL-10 mAb was purified from ascitic fluids, and purification was achieved by affinity chromatography on a protein G column (HiTrap affinity columns, Pharmacia Biotechnology, Uppsala, Sweden) after precipitation by ammonium sulfate. Assays were performed in 96-well microtiter plates (MaxiSorp, Nunc, Roskilde, Denmark), coated with 10 µg/mL purified anti-IL-10 mAb, as described previously [27]. For the immunological capture, 100 µL of IL-10 standards (15.6–2,000 pg/mL) or samples were reacted with coated plates for 18 h at 4°C. This was followed by epitope immobilization and epitope release. Thus, after washing the plates (phosphate buffer 10 mM, pH 7.4, 0.1% Tween 20), a 0.25% glutaraldehyde solution (100 µL) was added into each well, and the reaction was allowed to proceed for 5 min at 20°C under stirring. Wells were then washed, and 100 µL/well of a 10 mg/mL borane-trimethylamine complex solution containing 1 N HCl were added for a further 5-min reaction under stirring. Finally, binding of the labeled antibody was performed, after washing, by adding 100 µL/well of the JES-2A5-AChE conjugate at the concentration of 10 Ellman U/mL for 18 h at 4°C. For measurements of the solid-phase bound enzyme activity, plates were extensively washed and solid-phase bound AchE activity was determined colorimetrically by adding 200 µL of Ellman’s medium. Absorbance was read at 405 nm. The lower limit of detection of this assay is ⬃10 pg IL-10/mL sample.

Measurement of immunoreactive TNF-␣ production by enzyme immunometric assay Levels of TNF-␣ in the BALF and cell supernatants were also determined by an enzyme immunometric assay. Rat anti-murine TNF-␣ mAbs MP6-XT22 and MP6-XT3 were purified from ascitic fluids (cloned hybridomas kindly provided by Dr. P. Minoprio, Institut Pasteur, Paris, France). Characteristics of these rat anti-murine TNF-␣ mAbs were described in detail elsewhere [28] and their purification was performed exactly as described for the IL-10 mAb. Immunometric assays were performed in 96-well microtiter plates (MaxiSorp, Nunc, Roskilde, Denmark), coated with 10 µg/mL anti-TNF-␣ mAb, MP6-XT3, as described previously [27]. The one-step procedure used for immunometric assays involved the simultaneous addition of 100 µL of TNF-␣ standards (7.8–1000 pg/mL) or samples, and 100 µL of the anti-TNF-␣ mAb, MP6-XT22-AchE conjugate, at the concentration of 10 Ellman U/mL. The remaining steps were performed exactly as described for IL-10. The lower limit of detection of this assay is ⬃15 pg TNF-␣/mL sample.

mRNA extraction and reverse transcriptase-polymerase chain reaction (RT-PCR) for TNF-␣ and IL-10 Total RNAs were isolated from 2 ⫻ 105 macrophages according to the method described by Chomczynski and Sacchi [29]. The cDNAs were produced by

http://www.jleukbio.org

incubating 5 µg of total RNAs, 0.5 µg hexamers as primers (Institut Pasteur, Paris, France), 0.5 U RNasin (Promega France, Charbonnie`res, France), and 200 U M-MTLV reverse transcriptase RNase H⫺ (Promega) in a total volume of 25 µL in the manufacturer’s buffer, for 1 h at 42°C. Intron-differential RT-PCR was performed using specific primers for TNF-␣ (sense, AAGCCTGTAGCCCACGTCGTAGCA; antisense, CCTTGGGGCAGGGGCTCTTGACGG), for IL-10 (sense, CTGGACAACATACTGCTAACCGAC; antisense, ATTCATTCATGGCCTTGTAGACACC) and for ␤-actin (sense, GGACTCCTATGTGGGTGACGAGG; antisense, GGGAGAGCATAGCCCTCGTAGAT) as control. Primer specificity was checked using restriction digestion of PCR products (BssH II for TNF-␣, Cla I for IL-10, and Bgl II for ␤-actin). Amplifications were performed on a Peltier thermal cycler apparatus type 200 (MJ Research, Watertown, MA). For a 100-µL reaction, 5 µL of cDNA (serial dilutions), primers (100 mM each), dNTP (0.2 mM each), MgCl2 (0.2–0.3 mM), and Eurobiotaq polymerase (2.5 U; Eurobio, Les Ulis, France) in the manufacturer’s buffer were used. The thermocycling protocol was as follows: 95°C for 3 min, then 38 cycles of denaturation at 95°C for 45 s, annealing at 62°C (␤-actin and IL-10) or 64°C (TNF-␣) for 45 s, and extension at 72°C for 45 s, then a final incubation at 72°C for 7 min. Amplification products were resolved on a 1.5% agarose gel containing 0.5 µg/mL ethidium bromide. Gels were recorded after amplification with an Ultra-Lum system (Ultra-Lum, CA) under ultraviolet light, and semi-quantification was achieved using ImageQuant on a Storm (Molecular Dynamics, Sunnyvale, CA). Serial dilutions for each time point (data not shown) verified that PCR was performed in the linear phase of the amplification reactions.

Fig. 1. Differential cell accumulation in the lung airways as a function of time after intranasal instillation of LPS to mice. Mice received 330 µg/kg LPS intranasally and BALF (4 mL) were collected at different times after LPS instillation. Neutrophils and mononuclear cells were counted after cytocentrifugation and hematoxylin/eosin staining. Results are expressed as mean ⫾ SEM obtained from 4–10 distinct animals for each time point.

Statistical analysis Results are expressed as means ⫾ SEM for the indicated number of independently performed experiments. Statistical significance between the different values was analyzed by Student’s t test for unpaired data with a threshold of P ⬍ 0.05.

RESULTS Time course of LPS-induced cell infiltration into lung airways To determine the effective dose of LPS inducing a maximum inflammatory response, different amounts were administered intranasally to mice and the recruitment of PMN into the airspaces was evaluated 24 h later. A small but significant increase was observed with 10 µg/kg LPS, and the highest value was reached with 330 µg/kg (data not shown), allowing for a time-dependent study. PMN recruitment was observed as soon as 3 h after LPS administration, with a progressive increase up to 48 h, followed by a rapid decrease (Fig. 1). By contrast, mononuclear cell count smoothly progressed to reach a peak by 96 h. For both cell populations, the basal conditions were restored by 7 days.

Effects of LPS on in vivo TNF-␣ and IL-10 production After the administration of 330 µg/kg LPS intranasally, immunoreactive TNF-␣ and IL-10 were evaluated in lung extracts. TNF-␣ detection was effective as soon as 1 h and peaked at 3 h before declining and vanishing by 24 h (Fig. 2A). By contrast, IL-10 displayed no significant variation in concentration, i.e., 0.048 ⫾ 0.007 ng/mL for base line, versus 0.086 ⫾ 0.012 ng/mL at 3 h (n ⫽ 5; P ⬎ 0.05). In another set of experiments, we studied the concentration of these two cytokines in the BALF (Fig. 2B). After LPS administration only TNF-␣ was detected with the same kinetic

Fig. 2. Time course of IL-10 and TNF-␣ in vivo production after intranasal instillation of 330 µg/kg LPS. (A) Measurements of cytokine concentrations in whole lungs. (B) Measurements of cytokine concentrations in the BALF. Results are expressed as mean ⫾ SEM obtained from five distinct animals for each time point.

Salez et al. Lack of IL-10 synthesis by alveolar macrophages

547

Fig. 3. Time course of IL-10 and TNF-␣ productions by alveolar macrophages after in vitro incubation with LPS. Macrophages were incubated with 1 µg/mL LPS, and at different time points, supernatants were removed and kept at ⫺20°C until the determination of IL-10 and TNF-␣ concentrations. Results are expressed as mean ⫾ SEM obtained from 5 distinct experiments, each performed with a pool of cells collected from at least 15 mice.

as that observed in the above experiment, i.e., a bell-shaped curve peaking at 3 h. Under these conditions, IL-10 was undetectable. Three lower concentrations of LPS, 10, 33, and 100 µg/kg, were also tested with the same end result, namely TNF-␣ but no IL-10 production (data not shown). By contrast, when 330 µg/kg LPS were administered intraperitoneally, IL-10 was recovered in the peritoneal fluid with a peak concentration of 0.242 ⫾ 0.099 ng/mL (n ⫽ 3) at 2 h.

Effect of LPS on in vitro TNF-␣ and IL-10 production by alveolar and peritoneal macrophages Alveolar macrophages were collected from naive mice and stimulated in vitro with LPS. A concentration-response curve from 0.01 to 10 µg/mL LPS was established, with as a result an optimum formation of TNF-␣ obtained with 1 µg/mL LPS (data not shown). Kinetics of production of the two cytokines were then performed during a 48-h time range using the latter concentration of LPS. As shown in Figure 3, alveolar macrophages were unable to produce IL-10, whereas TNF-␣ formation was evidenced. It is of note that this TNF-␣ production was absent when FCS was omitted (data not shown), indicating a probable activation of the cells through the CD14 pathway, which requires binding of LPS to the plasma LPS-binding protein (LBP) [30]. To validate the unexpected lack of IL-10 production, similar experiments were performed with autologous peritoneal macrophages, which are known to produce IL-10 in such circumstances [13]. Peritoneal macrophages were incubated with 1 µg/mL LPS and TNF-␣ or IL-10 productions measured at different time points within 48 h (Fig. 4). Results confirmed their capacity to produce both cytokines. Indeed, immunoreactive TNF-␣ and IL-10 were detected in the incubation medium even at a much higher concentration for IL-10 than for TNF-␣. Because the protein kinase C (PKC) pathway is involved in LPS-induced macrophage activation [31], alveolar 548


Fig. 4. Time course of IL-10 and TNF-␣ production by peritoneal macrophages after in vitro incubation with LPS. Macrophages were incubated with 1 µg/mL LPS, and at different time points, supernatants were removed and kept at ⫺20°C until the determination of IL-10 and TNF-␣ concentrations. Results are expressed as mean ⫾ SEM obtained from three distinct experiments, each performed with a pool of cells collected from at least six mice.

and peritoneal macrophages were incubated with PMA. Figure 5 shows that this pathway is functional in peritoneal, but stays ineffective in alveolar macrophages for the generation of IL-10. The inability of alveolar macrophages to synthesize IL-10 is not a strain-dependent phenotype. Indeed, alveolar macrophages from BALB/c and BP2 mice also failed to produce IL-10 upon LPS stimulation (Table 1).

Pharmacological modulations of in vitro TNF-␣ and IL-10 production cAMP has been described as an important intracellular mediator regulating positively and negatively IL-10 and TNF-␣ synthesis, respectively [10–14]. We hypothesized that drugs like rolipram, pentoxifylline, and dbcAMP, which elevate

Fig. 5. Production of IL-10 by alveolar and peritoneal macrophages after in vitro incubation with PMA. Cells were incubated with 15 or 50 nM PMA and supernatants were collected 3 h later. Results are expressed mean ⫾ SEM obtained from three distinct experiments, each performed with a pool of cells collected from five mice.


TABLE 1.

LPS-Induced TNF-␣ and IL-10 Production by Alveolar Macrophages from Different Murine Strains TNF-␣ (pg/mL)

Strain

C57Bl/6 BALB/c BP2

IL-10 (pg/mL)

3h

6h

3h

6h

2938 ⫾ 723 2742 ⫾ 230 492 ⫾ 101

3424 ⫾ 629 6404 ⫾ 877 1854 ⫾ 414

ND ND ND

ND ND ND

Alveolar macrophages (2 ⫻ 105) were stimulated in vitro with 1 µg/mL of LPS. ND, not detectable.

cAMP intracellular level, might reveal an IL-10 synthesis. We also tested diltiazem, a drug that blocks calcium entry in cells, inhibits TNF-␣, and potentiates IL-10 production in vivo [32]. As expected, the four drugs inhibited TNF-␣ and potentiated IL-10 production when incubated for 20 min before LPS challenge of inflammatory peritoneal macrophages (Fig. 6). It was checked in parallel that these drugs did not modify by themselves the basal formation of both cytokines by the cells. By contrast, these same pharmacological agents, when applied to alveolar macrophages, did not initiate IL-10 production: TNF-␣ was significantly inhibited by dbcAMP, pentoxifylline, and diltiazem (Fig. 7). Fig. 7. Pharmacological modulations of LPS-induced TNF-␣ (A) and IL-10 (B) productions by alveolar macrophages. Cells were pretreated with different drugs for 20 min before incubation for 6 h with 0.01 µg/mL LPS. Drug concentrations: dbcAMP 5 mM, rolipram 10 µM, pentoxifylline 1 mM, and diltiazem 200 µM. Results are expressed as mean ⫾ SEM obtained from 3 distinct experiments, each performed with a pool of cells collected from 10 mice. *Treated groups with values significantly different (P ⬍ 0.05) from the control ⫹ LPS group. Pentoxi, pentoxifylline.

TNF-␣ and IL-10 mRNA expression in macrophages

Fig. 6. Pharmacological modulations of LPS-induced TNF-␣ (A) and IL-10 (B) productions by peritoneal macrophages. Cells were pretreated with different drugs for 20 min before incubation for 6 h with 0.01 µg/mL LPS. Drug concentrations: dbcAMP 5 mM, rolipram 10 µM, pentoxifylline 1 mM, and diltiazem 200 µM. Results are expressed as mean ⫾ SEM obtained from three distinct experiments, each performed with a pool of cells collected from three mice. *Treated groups with values significantly different (P ⬍ 0.05) from the control ⫹ LPS group. Pentoxi, pentoxifylline.

The absence of detection of the IL-10 protein in the extracellular medium in vivo and in vitro might have resulted from immediate recapture of the molecule by macrophages or from its degradation. IL-10 and ␤-actin mRNA were thus evaluated in peritoneal macrophages challenged by 1 µg/mL LPS using the RT-PCR technique. As shown in Figure 8A, the ratios of IL-10 to ␤-actin increased consistently with a peak at 1 h followed by a progressive decline. These data were indicative of a clear induction of the expression of the IL-10 gene and corroborated the presence of the corresponding protein in the extracellular medium. It is worth noting that the ratio was higher at the beginning of the experiments (time 0 upon LPS challenge) than at the end of the experiment 6 h later without LPS (control). This may reflect an activation of macrophages due to their adhesion, an effect that vanished progressively with time. By contrast, when alveolar macrophages were treated under the same conditions with LPS, ratios of IL-10 to ␤-actin changed weakly and randomly (Fig. 8B). These data are in support of the absence of IL-10 protein detection in the extracellular medium. Considering the high level of sensibility of the gel analyzer and the high number of PCR cycles


549

Fig. 8. TNF-␣ and IL-10 mRNA expression by alveolar and peritoneal macrophages after in vitro stimulation with 1 µg/mL LPS. Total cellular mRNA was isolated, cDNA was produced by RT and amplified by the PCR technique (see Materials and Methods). (A, B) Specific IL-10 and ␤-actin DNA-PCR products obtained from each indicated time point and for each cell type were quantified by densitometry analysis, and ratios of IL-10 to ␤-actin calculated. Control represents a 6-h incubation of cells without LPS stimulation. (C) Electrophoresed and ethidium bromide stained IL-10, TNF-␣, and ␤-actin mRNA amplification products obtained after a 1-h incubation or not of cells with LPS. These results are representative of three separate experiments.

performed, it can be inferred that alveolar macrophages do not significantly express IL-10 mRNA. Obviously, cells were well activated under the present conditions because the TNF-␣ messengers were overexpressed upon LPS stimulation (Fig. 8C).

DISCUSSION Lung preservation from inflammatory diseases depends on the equilibrium between efficient innate defensive responses to inhaled infectious microorganisms, organic or inorganic agents, and equally effective mechanisms to down-regulate inflammation and limit tissue damage. As a predominant immune effector cell in the airspaces, the alveolar macrophage is critical to these homeostatic processes. Indeed, mononuclear phagocytes are an important source of cytokines and growth factors that play a central role in the induction and regulation of natural immunity and its counterpart inflammation. The two main cytokines generally involved in this equilibrium are 550


TNF-␣ and IL-10, a pro- and an anti-inflammatory cytokine, respectively [33]. The present study indicates that murine alveolar macrophages failed to synthesize IL-10 in response to LPS compared with autologous peritoneal macrophages. These unexpected results were verified in both in vivo and in vitro situations. Indeed, whether LPS was intranasally administered to mice, or incubated in vitro with alveolar macrophages collected from naive mice, IL-10 was never recovered in the extracellular compartments. These results are corroborated by the absence of detection of IL-10 mRNA. This failure of IL-10 synthesis was not due to an absence of alveolar macrophage activation because TNF-␣ was detected as expected. Moreover, it was noted that the induction of TNF-␣ synthesis was CD14 receptor dependent because the in vitro cell response was abrogated in absence of serum, and restored with recombinant murine LBP (data not shown). The lack of production of the protein and of the corresponding mRNA suggests that the IL-10 protein expression is regulated at the pretranscriptional level. Recently, progress has been achieved in characterizing the early intracellular events leading to monocyte activation, including inductions of cytokine synthesis in response to LPS. As reported by Meisel et al. [31], the patchwork of cytokine releases results from two waves of induction. The first wave is due to a direct effect of LPS on its receptor. This triggers the formation of TNF-␣ and, for a minor part, of IL-10. The second wave is mainly due to LPS-induced mediators such as TNF-␣. This secondary mechanism would be responsible for the major part of the IL-10 production by monocytes in response to LPS. In the case of the TNF-␣/IL-10 balance, it is clear that IL-10 secretion is the result of an autocrine/paracrine control, where TNF-␣ activates IL-10 synthesis [34, 35], and IL-10 down-regulates TNF-␣ formation by a negative feedback [18–20]. It appears that IL-10 synthesis requires an early activation of both protein tyrosine kinases (PTK) and PKC immediately after LPS stimulation, and a delayed activation of another PTK pathway, mediated by TNF-␣ or other LPS-induced mediators like prostaglandins [31]. To explain the lack of IL-10 gene expression, it can be hypothesized that neither the early activation pathway nor the late events are completely functional after LPS stimulation of alveolar macrophages. This is apparently the case for the PKC pathway because PMA was unable to induce IL-10 production, indicating that the observed deficiency is not restricted to LPS, but is a more general phenomenon. Moreover, a lot of studies have shown that IL-10 is produced through a mechanism involving adenylate cyclase, notably in peritoneal macrophages [13] or in PBMC [14], through the use of a model of LPS stimulation associated with pretreatment with cAMP-elevating drugs. Inhibitors of PDE were used in vivo, resulting in an up-regulation of IL-10 production in the plasma after intraperitoneal LPS injection [36]. In the present study, we used dbcAMP or other drugs that elevate intracellular cAMP, and we have not been able to reverse this lack of IL-10 production. The inhibitory activity of these drugs on TNF-␣ production by alveolar macrophages demonstrates the functionality of the cAMP pathway during LPS stimulation and proves that the absence of IL-10 production is not controlled by this system. http://www.jleukbio.org

Whatever the underlying mechanism accounting for the absence of IL-10 synthesis, the striking point is the difference observed between alveolar and peritoneal macrophages. Studies concerning the differentiation of monocytes to macrophages have shown modifications of the ability to produce various factors in response to LPS. Thus, in vitro the differentiation of human monocytes to macrophages leads to an increased response to LPS in terms of IL-6 and TNF-␣ production [37]. A recent study reported similar observations, showing that the differentiation of alveolar macrophages is accompanied by a decrease of TGF-␤ synthesis [38]. It is noteworthy that the regulation takes place at the gene activation level because the constitutive expression of TGF-␤ mRNA is lower in macrophages than in monocytes after 24 h of culture with LPS. More recently, a study using macrophages differentiated in vitro with monocyte-colony stimulating factor (M-CSF), revealed a possible irreversible down-regulation of IL-12 p70 production in response to LPS [39]. In fact, many groups have described the development and differentiation of tissue macrophages as being accompanied by specific phenotypic changes, depending on tissue-specific stimuli [40]. Several years ago, it was demonstrated that under a physiological steady state, the influx of monocytes is the source of cell renewal for pulmonary macrophages [41], and it is now accepted that the migration of monocytes into different tissues appears to be a random process in the absence of localized inflammation [42]. Thus, alveolar and peritoneal macrophages would both derive from the same whole population of circulating monocytes. Obviously, the differentiation of mononuclear cells in vivo allows the acquisition or loss of different functions that determine a new behavior, depending on the tissue environment. The current study suggests that the pulmonary environment would suppress IL-10 expression by alveolar macrophages. This could be effected by the surfactant, a lipoproteinic film controlling superficial tension of alveolar surface, which owns immunomodulator properties on cytokine production [43]. As an example, recent studies showed that surfactant protein A regulates cytokine production by the monocytic cell line THP-1 [44] or LPSstimulated macrophages [45]. Many studies have implicated an uncontrolled inflammatory response in the pathogenesis of ARDS. TNF-␣ is one of the earliest pro-inflammatory mediators, which induces many of the clinical manifestations of ARDS [46]. By contrast, IL-10 is susceptible to downgrade the inflammatory process. Thus, IL-10 gene transfer reduces pulmonary TNF-␣ level and decreases neutrophil infiltration in a murine model of LPSinduced lung inflammation [21]. It is interesting that an absence of IL-10 synthesis by LPS-activated human alveolar macrophages has been described [47, 48], although discrepant results have been reported [49, 50]. Nonetheless, the detected quantities of IL-10 were always far lower than those produced by circulating monocytes treated under the same conditions. As an example, Thomassen et al. [48] wrote that endogenous levels of IL-10 were undetectable or low in either unstimulated or LPS-stimulated macrophages; furthermore, IL-10 resulting from LPS stimulation was less than 10% of the exogenous IL-10 amount eliciting significant cytokine inhibition. In fact, very low concentrations of IL-10 were detected in the BALF of

ARDS patients [51], and this might be one of the factors contributing to the pathology. The current findings show that mice alveolar macrophages bear a rare phenotype, a feature that may be relevant for the understanding of the biology of human alveolar macrophages.

ACKNOWLEDGMENTS This work was supported in part by grants from the Ministe`re de la Recherche et de la Technologie (contrat no. 97230) and the Ministe`re de l’Ameńagement du Territoire et de l’Environnement (contrat no. EN97C13). The authors would like to thank Pr. B. Boris Vargaftig, Dr. Dominique Pidard, and Dr. Mustapha Si-Tahar for their critical review of the manuscript and Marie-Anne Nahori for technical assistance in immunometric assays.

REFERENCES 1. Meduri, G. U. (1996) The role of the host defence response in the progression and outcome of ARDS: pathophysiological correlations and response to glucocorticoid treatment. Eur. Respir. J. 9, 2650–2670. 2. Pittet, J. F., Mackersie, R. C., Martin, T. R., Matthay, M. A. (1997) Biological markers of acute lung injury: prognostic and pathogenetic significance. Am. J. Respir. Crit. Care Med. 155, 1187–1205. 3. Brigham, K. L., Meyrick, B. (1986) Endotoxin and lung injury. Am. Rev. Respir. Dis. 133, 913–927. 4. Beutler, B., Cerami, A. (1988) Tumor necrosis, cachexia, shock, and inflammation: a common mediator. Annu. Rev. Biochem. 57, 505–518. 5. Tracey, K. J., Cerami, A. (1993) Tumor necrosis factor: an updated review of its biology. Crit. Care Med. 21, S415–S422. 6. Strieter, R. M., Kunkel, S. L., Bone, R. C. (1993) Role of tumor necrosis factor-alpha in disease states and inflammation. Crit. Care Med. 21, S447–S463. 7. Windsor, A. C., Walsh, C. J., Mullen, P. G., Cook, D. J., Fisher, B. J., Blocher, C. R., Leeper-Woodford, S. K., Sugerman, H. J., Fowler III, A. A. (1993) Tumor necrosis factor-alpha blockade prevents neutrophil CD18 receptor upregulation and attenuates acute lung injury in porcine sepsis without inhibition of neutrophil oxygen radical generation. J. Clin. Invest. 91, 1459–1468. 8. Denis, M., Guojian, L., Widmer, M., Cantin, A. (1994) A mouse model of lung injury induced by microbial products: implication of tumor necrosis factor. Am. J. Respir. Cell Mol. Biol. 10, 658–664. 9. Goncalves de Moraes, V. L., Vargaftig, B. B., Lefort, J., Meager, A., Chignard, M. (1996) Effect of cyclo-oxygenase inhibitors and modulators of cyclic AMP formation on lipopolysaccharide-induced neutrophil infiltration in mouse lung. Br. J. Pharmacol. 117, 1792–1796. 10. Spengler, R. N., Spengler, M. L., Lincoln, P., Remick, D. G., Strieter, R. M., Kunkel, S. L. (1989) Dynamics of dibutyryl cyclic AMP- and prostaglandin E2-mediated suppression of lipopolysaccharide-induced tumor necrosis factor alpha gene expression. Infect. Immun. 57, 2837–2841. 11. Tannenbaum, C. S., Hamilton, T. A. (1989) Lipopolysaccharide-induced gene expression in murine peritoneal macrophages is selectively suppressed by agents that elevate intracellular cAMP. J. Immunol. 142, 1274–1280. 12. Teixeira, M. M., Gristwood, R. W., Cooper, N., Hellewell, P. G. (1997) Phosphodiesterase (PDE) 4 inhibitors: anti-inflammatory drugs of the future? Trends Pharmacol. Sci. 18, 164–171. 13. Strassmann, G., Patil-Koota, V., Finkelman, F., Fong, M., Kambayashi, T. (1994) Evidence for the involvement of interleukin-10 in the differential deactivation of murine peritoneal macrophages by prostaglandin E2. J. Exp. Med. 180, 2365–2370. 14. Platzer, C., Meisel, C., Vogt, K., Platzer, M., Volk, H. D. (1995) Up-regulation of monocytic IL-10 by tumor necrosis factor-alpha and cAMP elevating drugs. Int. Immunol. 7, 517–523. 15. Kambayashi, T., Jacob, C. O., Zhou, D., Mazurek, N., Fong, M., Strassmann, G. (1995) Cyclic nucleotide phosphodiesterase type IV participates in the regulation of IL-10 and in the subsequent inhibition of TNF-␣ and


551

16. 17. 18. 19. 20.

21.

22.

23.

24. 25. 26.

27. 28.

29. 30. 31. 32. 33.

IL-6 release by endotoxin-stimulated macrophages. J. Immunol. 155, 4909–4916. Moore, K. W., O’Garra, A., de Waal Malefyt, R., Vieira, P., Mosmann, T. R. (1993) Interleukin-10. Annu. Rev. Immunol. 11, 165–190. Lalani, I., Bhol, K., Ahmed, A. R. (1997) Interleukin-10: biology, role in inflammation and autoimmunity. Ann. Allergy Asthma Immunol. 79, 469–484. Fiorentino, D. F., Zlotnik, A., Mosmann, T. R., Howard, M., O’Garra, A. (1991) IL-10 inhibits cytokine production by activated macrophages. J. Immunol. 147, 3815–3822. Bogdan, C., Vodovotz, Y., Nathan, C. (1991) Macrophage deactivation by interleukin-10. J. Exp. Med. 174, 1549–1555. Gerard, C., Bruyns, C., Marchant, A., Abramowicz, D., Vandenabeele, P., Delvaux, A., Fiers, W., Goldman, M., Velu, T. (1993) Interleukin-10 reduces the release of tumor necrosis factor and prevents lethality in experimental endotoxemia. J. Exp. Med. 177, 547–550. Rogy, M. A., Auffenberg, T., Espat, N. J., Philip, R., Remick, D., Wollenberg, G. K., Copeland III, E. M., Moldawer, L. L. (1995) Human tumor necrosis factor receptor (p55) and interleukin-10 gene transfer in the mouse reduces mortality to lethal endotoxemia and also attenuates local inflammatory responses. J. Exp. Med. 181, 2289–2293. Pajkrt, D., Camoglio, L., Tiel-van Buul, M. C. M., de Bruin, K., Cutler, D. L., Affrime, M. B., Rikken, G., van der Poll, T., ten Cate, J. W., van Deventer, S. J. H. (1997) Attenuation of proinflammatory response by recombinant human IL-10 in human endotoxemia: effect of timing of recombinant human IL-10 administration. J. Immunol. 158, 3971–3977. Goncalves de Moraes, V. L., Singer, M., Vargaftig, B. B., Chignard, M. (1998) Effects of rolipram on cyclic AMP levels in alveolar macrophages and lipopolysaccharide-induced inflammation in mouse lung. Br. J. Pharmacol. 123, 631–636. Pradelles, P., Grassi, J., Creminon, C., Boutten, B., Mamas, S. (1994) Immunometric assay of low molecular weight haptens containing primary amino groups. Anal. Chem. 66, 16–22. Etienne, E., Creminon, C., Grassi, J., Grouselle, D., Roland, J., Pradelles, P. (1996) Enzyme immunometric assay of thyroliberin (TRH). J. Immunol. Meth. 198, 79–85. Grassi, J., Frobert, Y., Pradelles, P., Chercuitte, F., Gruaz, D., Dayer, J. M., Poubelle, P. E. (1989) Production of monoclonal antibodies against interleukin-1 alpha and -1 beta. Development of two enzyme immunometric assays (EIA) using acetylcholinesterase and their application to biological media. J. Immunol. Meth. 123, 193–210. Pradelles, P., Grassi, J., Maclouf, J. (1985) Enzyme immunoassays of eicosanoids using acetylcholine esterase as label: an alternative to radioimmunoassay. Anal. Chem. 57, 1170–1173. Abrams, J. S., Roncarolo, M. G., Yssel, H., Andersson, U., Gleich, G. J., Silver, J. E. (1992) Strategies of anti-cytokine monoclonal antibody development: immunoassay of IL-10 and IL-5 in clinical samples. Immunol. Rev. 127, 5–24. Chomczynski, P., Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156–159. Fenton, M. J., Golenbock, D. T. (1998) LPS-binding proteins and receptors. J. Leukoc. Biol. 64, 25–32. Meisel, C., Vogt, K., Platzer, C., Randow, F., Liebenthal, C., Volk, H. D. (1996) Differential regulation of monocytic tumor necrosis factor-alpha and interleukin-10 expression. Eur. J. Immunol. 26, 1580–1586. Szabo, C., Hasko, G., Nemeth, Z. H., Vizi, E. S. (1997) Calcium entry blockers increase interleukin-10 production in endotoxemia. Shock 7, 304–307. Armstrong, L., Millar, A. B. (1997) Relative production of tumour necrosis factor-alpha and interleukin-10 in adult respiratory distress syndrome. Thorax 52, 442–446.

552


34. Wanidworanun, C., Strober, W. (1993) Predominant role of tumor necrosis factor-alpha in human monocyte IL-10 synthesis. J. Immunol. 151, 6853–6861. 35. van der Poll, T., Jansen, J., Levi, M., ten Cate, H., ten Cate, J. W., van Deventer, S. J. H. (1994) Regulation of interleukin-10 release by tumor necrosis factor in humans and chimpanzees. J. Exp. Med. 180, 1985–1988. 36. Nemeth, Z. H., Hasko, G., Szabo, C., Vizi, E. S. (1997) Amrinone and theophylline differentially regulate cytokine and nitric oxide production in endotoxemic mice. Shock 7, 371–375. 37. Gessani, S., Testa, U., Varano, B., Di Marzio, P., Borghi, P., Conti, L., Barberi, T., Tritarelli, E., Martucci, R., Seripa, D., Perschle, C., Belardelli, F. (1993) Enhanced production of LPS-induced cytokines during differentiation of human monocytes to macrophages. Role of LPS receptors. J. Immunol. 151, 3758–3766. 38. Toossi, Z., Hirsch, C. S., Hamilton, B. D., Knuth, C. K., Friedlander, M. A., Rich, E. A. (1996) Decreased production of TGF-beta 1 by human alveolar macrophages compared with blood monocytes. J. Immunol. 156, 3461– 3468. 39. Smith, W., Feldmann, M., Londei, M. (1998) Human macrophages induced in vitro by macrophage colony-stimulating factor are deficient in IL-12 production. Eur. J. Immunol. 28, 2498–2507. 40. Naito, M., Umeda, S., Yamamoto, T., Moriyama, H., Umezu, H., Hasegawa, G., Usuda, H., Shultz, L. D., Takahashi, K. (1996) Development, differentiation, and phenotypic heterogeneity of murine tissue macrophages. J. Leukoc. Biol. 59, 133–138. 41. Blusse van oud Alblas, A., van Furth, R. (1979) Origin, kinetics, and characteristics of pulmonary macrophages in the normal steady state. J. Exp. Med. 149, 1504–1518. 42. Valledor, A. F., Borras, F. E., Cullell-Young, M., Celada, A. (1998) Transcription factors that regulate monocyte/macrophage differentiation. J. Leukoc. Biol. 63, 405–417. 43. Wright, J. R. (1997) Immunomodulatory functions of surfactant. Physiol. Rev. 77, 931–962. 44. Kremlev, S. G., Umstead, T. M., Phelps, D. S. (1997) Surfactant protein A regulates cytokine production in the monocytic cell line THP-1. Am. J. Physiol. 272, L996–L1004. 45. McIntosh, J. C., Mervin-Blake, S., Conner, E., Wright, J. R. (1996) Surfactant protein A protects growing cells and reduces TNF-␣ activity from LPS-stimulated macrophages. Am. J. Physiol. 271, L310–L319. 46. Tran van Nhieu, J., Misset, B., Lebargy, F., Carlet, J., Bernaudin, J. F. (1993) Expression of tumor necrosis factor-alpha gene in alveolar macrophages from patients with the adult respiratory distress syndrome. Am. Rev. Respir. Dis. 147, 1585–1589. 47. Berkman, N., John, M., Roesems, G., Jose, P. J., Barnes, P. J., Chung, K. F. (1995) Inhibition of macrophage inflammatory protein-1␣ expression by IL-10. J. Immunol. 155, 4412–4418. 48. Thomassen, M. J., Divis, L. T., Fisher, C. J. (1996) Regulation of human alveolar macrophage inflammatory cytokine production by interleukin-10. Clin. Immunol. Immunopathol. 80, 321–324. 49. John, M., Lim, S., Seybold, J., Jose, P., Robichaud, A., O’Connor, B., Barnes, P.J., Chung, K. F. (1998) Inhaled corticosteroids increase interleukin-10 but reduce macrophage inflammatory protein-1␣, granulocytemacrophage colony-stimulating factor, and interferon-␥ release from alveolar macrophages in asthma. Am. J. Resp. Crit. Care Med. 157, 256–262. 50. Magnan, A., van Pee, D., Bongrand, P., Vervloet, D. (1998) Alveolar macrophage interleukin (IL)-10 and IL-12 production in atopic asthma. Allergy 53, 1092–1095. 51. Chollet-Martin, S., Rousset, F., Chastre, J., Gibert, C., Banchereau, J., Gougerot-Pocidalo, M. A. (1994) Cytokines in adult respiratory distress syndrome. Lancet 344, 1440.
