Ahmed A. Azad, ~,2. Paul Failla, 1 Anna Lucantoni, 1 John Bentley, 2 Chris Mardon, 2 Andrew Wolfe, 2 ... pYEULCBX (Macreadie et al., 1992) and the baculo-.
Journal of General Virology(1994), 75, 651 655. Printedm Great Britain
651
Large-scale production and characterization of recombinant human immunodeficiency virus type 1 Nef Ahmed A. Azad, ~,2. Paul Failla, 1 Anna Lucantoni, 1 John Bentley, 2 Chris Mardon, 2 Andrew Wolfe, 2 Kerri Fuller, ~ D e a n Hewish, 2 S h o m i k Sengupta, 2 Sonia Sankovich, ~ Elizabeth Grgacic, 3 D a l e M c P h e e 3 and Ian Macreadie I 1Biomolecular Research Institute and 2 CSIRO Division of Biomolecular Engineering, 343 Royal Parade, Parkville, Victoria 3052 and 3Macfarlane Burnet Centre for Medical Research, Fairfield Hospital, Fairfield, Victoria, Australia
Sequences encoding the 27K and 25K nefgene products (Nef 27 and Nef 25) were amplified by PCR from a human immunodeficiency virus type 1 infectious clone and subcloned directly into Escherichia coli, yeast and baculovirus expression vectors. The yeast- and baculovirus-derived Nef had native N termini but the expression levels were low. The expression levels of the E. col#derived glutathione S-transferase-Nef fusion proteins were very high and a major portion was soluble. Large-scale production orE. coli-derived Nef27 and Nef 25 was carried out by growing recombinant cells in a fermenter under fed-batch conditions followed by affinity purification on glutathione-Sepharose before and after thrombin cleavage. Large quantities of highly
purified recombinant Nef proteins have been produced for functional and structural studies. Under nonreducing conditions both Nef 27 and Nef 25 existed as a mixture of monomers, dimers and small amounts of higher oligomers, but when reduced were monomeric. The highly purified Nef proteins had no G protein activities, however Nef27 was biologically active. When electroporated into uninfected CD4 + T lymphocytes both E. coli-derived Nef 27 and yeast-derived myristylated Nef 27 down-regulated the surface expression of CD4, demonstrating that this method can be used to assess the biological activity of purified recombinant Nef.
The conservation of the nefgene throughout the primate lentiviruses and the fact that infection with only these lentiviruses can be correlated to immunodeficiency clearly suggests that nefis critical for the development of AIDS. Kestler et al. (1991) have shown that although deletion of simian immunodeficiency virus nef gene sequences has no detectable effect on virus replication in cultured cells, the intact nef gene is indispensable for both the establishment of persistent infection and the development of immunodeficiency in rhesus monkeys. Furthermore, the animals infected with the nef genedeleted virus proved resistant to challenge with wild-type virus (Daniel et al., 1992). These results strongly suggest that nef is a critical gene for the development of AIDS and should, therefore, be targeted for drug design. The rational design of drugs aimed at affecting the Nef protein requires a knowledge of this protein's threedimensional structure and an understanding of its function(s) and mechanism(s) of action. For these analyses large quantities of Nef in a soluble and highly purified form which is biologically active are required. Sequences of human immunodeficiency virus type 1 (HIV-1) encoding the 27K and 25K forms of the nefgene product were amplified from a BalI-SacI fragment of the
molecular clone pNL4.3 (Adachi et al., 1986) by using standard PCR protocols (Erlich, 1989) and the following oligonucleotides: Nef 27 initiation sequence primer 5' GCTCCGGATCCATGGGTGGCAAGTGGTC 3'; Nef 25 initiation sequence primer 5'GCTCCG G A T C C A T G A G A C G A G C T G A G C C 3 ' ; and Nef termination sequence primer 5' CGCCCGGGATCGATGTCAGCAGTTCTTG 3'. In both the initiation sequence primers a BamHI site (underlined) is present immediately upstream of the initiation codon (double underlined). The initiation codon in nef 25 corresponds to the methionine at position 20 of Nef 27. The termination sequence primer, common to both nef 27 and nef 25, includes a SmaI site (overlined) and the complement of the nef stop codon (double underlined). The PCR products were digested with BamHI and EcoRI (Boehringer Mannheim) and inserted into the BamHI-EcoRI sites of the Escherichia coli vector pGEX2T (Smith & Johnson, 1988), the yeast vector pYEULCBX (Macreadie et al., 1992) and the baculovirus vector pVL1393 (kindly provided by Dr Max Summers). Only Nef 27 was subcloned into the baculovirus vector. All the expression vectors were transformed into E. coli DH1 or TG1 cells and positive transformants
0001-2053 © 1994SGM
652
Short communication
1
2
3
4
5
6
7
8
9
10
Fig. 1. Western blots of Nef 27 and Nef 25 expressed in E. coli, yeast and baculovirus-infected insect cells and probed with anti-Nef MAb (lanes 1 to 5) and pooled HIV-l-positive sera (lanes 6 to I0). Lanes 1 and 6, E. coli-derived Nef 27; lanes 2 and 7, E. coli-derived Nef 25; lanes 3 and 8, yeast-derived Nef 27; lanes 4 and 9, yeast-derived Nef 25; lanes 5 and 10, baculovirus-derived Nef 27.
were selected by colony hybridization. Recombinant plasmids were subjected to dideoxynucleotide sequencing between the restriction sites used for insertion to confirm the reading frames where Nef fusion protein coding regions were expected, and also through the entire nef gene to ensure that no base changes had occurred during PCR amplification. The recombinant yeast plasmids pYEULCBX-nef27/25 were electrotransformed (Becker & Guarente, 1991) into Saccharomvces cerevisiae strain DY150 and the transformed yeast cells were further processed as described by Macreadie et aI. (1992). The recombinant baculovirus transfer vector pVL1393-nef 27 (20 lag) was cotransfected with 1 lag of baculovirus genomic DNA into Sf9 cells by the calcium phosphate precipitation method and then further processed as described by Summers & Smith (1987). In order to assess expression levels, lysates from approximately the same number of E. coli, yeast and baculovirus-infected insect cells were analysed by SDSPAGE and Western blotting (Fig. 1). The E. coli lysate was treated with thrombin prior to electrophoresis. Western blots were probed with either anti-Nef monoclonal antibody (MAb) (American Bio-Technologies) (Fig. 1, lanes 1 to 5) or pooled HIV-l-positive sera (lanes 6 to 10) obtained from patients at Fairfield Hospital. E. col#derived Nef 27 and Nef 25 reacted strongly with both the anti-Nef MAb (Fig. 1, lanes 1 and 2) and with pooled HIV-1-positive sera (Fig. 1, lanes 6 and 7). Yeastderived Nef 27 and Nef 25 also reacted with anti-Nef MAb (Fig. 1, lanes 3 and 4) and with HIV-l-positive sera (Fig. 1, lanes 8 and 9). Baculovirus-derived Nef 27 reacted weakly with anti-Nef MAb (Fig. 1, lane 5) and not at all with the HIV-l-positive sera (Fig. 1, lane 10) even though the Western blots were deliberately overdeveloped. The glutathione S-transferase (GST)-Nef fusion proteins present in E. coli lysates appeared as prominent bands on Coomassie blue-stained gels, however the yeast and insect cell lysates did not show any prominent Nef bands that stained stronger than the
background intracellular proteins (results not shown). We decided to concentrate on the E. col#derived Nef molecules for large-scale purification. Small amounts of yeast-derived Nef 27 were obtained by affinity purification using a polyclonal antibody raised against the N terminus of Nef 27. Large-scale production of E. col#derived Nef 27 and Nef 25 was carried out by fed-batch fermentation. Recombinant E. coli cells recovered by centrifugation from a 300 ml sample cultured overnight in Luria broth and ampicillin were suspended in 50 ml PBS and used to inoculate 3 1 of sterile batch medium (containing 30 g bacto-tryptone, 15 g yeast extract, 15 g glycerol, 9 g KH2PO 4, 21 g Na~,HPQ, 1.5 g NaC1, 1.5 g MgSO~, 15 mg thiamine and 300 mg ampicillin) in a Braun Biostat E fermenter with a 5 1 vessel. The fermentation was automatically maintained at 37 °C and pH 7 with the dissolved oxygen at around 50 % air saturation. Two variable-speed peristaltic pumps (Pharmacia 3P) were used to supply a complex medium (20 % w/v bactotryptone, 10 % w/v yeast extract and 0'5 % w/v of NaC1) and carbon energy source (70% v/v glycerol) when required. The complex feed rate was increased when dissolved oxygen levels rose as a consequence of imminent starvation and the glycerol feed rate was increased when the pH started to rise as a result of excess nitrogen. The feed profiles were roughly exponential so as to avoid accumulation of inhibitory levels of substrates or intermediary metabolites. Feeding was initiated at an OD~o0 of 4 to 5 and an additional 100 mg/1 ampicillin and 5 rag/1 of thiamine were added. A second addition of ampicillin and thiamine was made at an OD of about 25. The culture was induced with 0.8 mM-IPTG at an OD of 45 to 50 and the culture was fed for a further 2 h. The culture was then cooled rapidly and the cells were harvested by centrifugation and resuspended in a small volume of MTPBS buffer (150mM-NaC1, 16mMNa2HPO ~, 4 mM-NaH2PO4, pH 7-3). The final yield was 18 g/1 of cells, or about 70 g dry matter weight. Cells were thawed slowly on ice in the presence of a protease inhibitor cocktail (3 mM-PMSF, 5 mM-EDTA, 2 gg/ml pepstatin, leupeptin and aprotinin) and then harvested by centrifugation. The cells were resuspended in MTPBS buffer containing the protease inhibitor cocktail and Iysozyme (40 lag/ml), 5 mM-MgC12, DNase (1 lag/ml) and RNase (1 lag/ml) and left on ice for 1 h. Fresh PMSF was added prior to sonication and centrifugation at 4000 r.p.m, for 10 min. The 4000 r.p.m. supernatant was recentrifuged at 12000r.p.m. for 10 min. The soluble GST-Nef 27 or GST-Nef 25 in the supernatant was purified essentially as described by Smith & Johnson (1988). The SDS-PAGE analysis of Nef 27 during different stages of large-scale purification is shown in Fig. 2.
Short communication
1
2
3
4
5
6
7
8
(a)
653
"----- 3 B
106K 80K
1\\ 2
50K ¢-i
33K 28K
------ 3A
/
18K Elution profile
(b)
1
2
3
4
5
6
7
8
9
10 l l
12 13
94K Fig. 2. Coomassie blue-stained gels of E. coil-derived Nef 27 at different stages of large-scale purification. Lane 1, total lysate (4000 r.p.m. supernatant); lane 2, 12000 r.p.m, supernatant; lane 3, 12000 r.p.m. pellet; lane 4, affinity-purified GST Nef 27 fusion protein: lane 5, fusion protein cleaved with thrombin; lane 6, cleaved fusion protein after re-chromatography on glutathione-Sepharose; lane 7, ReactiveRed 120 dye column flowthrough fraction; lane 8, Reactive-Red 120 dye-bound fraction.
67K 43K
30K
20K
Densitometric measurement of the total lysate (Fig. 2, lane 1) was used to show that undegraded GST-Nef 27 fusion protein constitutes 11% of the total protein. If we assume that proteins constitute about half the mass of E. coli cells, then the total amount of protein produced in a single 3 1 fermentation run is about 35 g. Since undegraded GST-Nef fusion protein constitutes 11% of total cellular protein, the total yield of undegraded fusion protein is approximately 3.8 g per fermentation run. Western blot analysis of the 12000 r.p.m, pellet and supernatant fractions (Fig. 2, lanes 2 and 3) shows that 70 % of the undegraded fusion protein is soluble. The soluble form of the GST-Nef fusion protein was affinity-purified on glutathione--Sepharose (Fig. 2, lane 4), cleaved with thrombin (Fig. 2, lane 5), and rechromatographed on the same column to obtain cleaved Nef in the flowthrough fraction (Fig. 2, lane 6). The profiles were identical for Nef 27 and Nef 25, except that a band with an electrophoretic mobility slightly slower than GST persisted in the Nef 27 sample when the cleaved GST was readsorbed to the glutathioneSepharose (Fig. 2, lane 6). Amino-terminal sequencing of this protein, which is shorter than Nef 27 but larger than Nef 25, showed that the first 11 amino-terminal residues of Nef 27 had been removed. When a mixture of full-length Nef 27 and the truncated form of Nef was passed through a Reactive-Red 120 dye ligand column there was preferential adsorption of Nef 27 to the dye, leaving most of the truncated form in the unbound fraction (Fig. 2, lane 7). The fullqength Nef 27 was eluted with 0"5 M-NaC1 (Fig. 2, lane 8). Sometimes there was contamination with small amounts of E. coli proteins
14K
Fig. 3. (a) Gel filtration of Nef25 through a Superdex 75 column under non-reducing conditions (broken line) and after 30 rain incubation in 10 mM-DTT and elution with buffer containing 1 mM-DTT (solid line). (b) Coomassie blue-stained gel following SDS-PAGE of Nef 25 subjected to gel filtration. Lanes 1 and 13, M r markers; lanes 2 and 3, before gel filtration; lanes 4 and 5, fraction 1 of gel filtration peak 1; lanes 6 and 7, fraction 2 of gel filtration peak 1; lanes 8 and 9, gel filtration peak 3A: lanes 10 and 11. gel filtration peak 3B; lane 12, GST. Samples in lanes 3, 5, 7, 9 and II contained 10 mM-DTT, and no reducing agents were present in other samples.
which could be removed by gel filtration in the presence of a reducing agent. Amino-terminal sequencing of the purified proteins confirmed their identity and homogeneity. Both Nef 27 and Nef 25 form homo- and heterodimers and higher oligomers under non-reducing conditions as shown for Nef 25 in Fig. 3(a). Nef 25, obtained after thrombin cleavage of GST-Nef 25 fusion protein and rechromatography on glutathione-Sepharose, eluted as two peaks when subjected to gel filtration on a Superdex 75 (Pharmacia) column (broken line, Fig. 3a). When subjected to non-reducing SDS-PAGE, two prominent polypeptides of 25K and 45K could be seen on a Coomassie blue-stained gel (Fig. 3 b, lane 2). When Nef 25 was preincubated with 10 mM-DTT, the first peak in the gel filtration profile (Fig. 3 a) and the 45K band on the gel disappeared (Fig. 3 b, lane 3). Fraction 1 of the first peak (Fig. 3 b) contained oligomeric forms of Nef 25 which were converted to monomeric Nef 25 under
654
Short communication
reducing conditions (Fig. 3 b, lanes 4 and 5). Fraction 2 of the first peak (Fig. 3 a) showed the presence of a dimer on non-reducing SDS-PAGE, which on reduction gave rise to monomers (Fig. 3b, lanes 6 and 7). However, a GST band was also present and the dimer reacted with both anti-Nef and anti-GST MAbs. The gel filtration peaks 3A and 3B (Fig. 3 a), on the other hand, contained homogeneous monomeric Nef 25 under reducing conditions (Fig. 3b, lanes 9 and 11). On reoxidation, the highly purified Nef 25 formed a mixture of monomers and dimers (Fig. 3b, lanes 8 and 10). Although in this case contamination with GST was largely a consequence of incomplete removal of GST by affinity chromatography, a final gel filtration step in the presence of a reducing agent is an effective way of obtaining highly purified Nef since other proteins, such as GST, can copurify with Nef owing to the formation of intermolecular disulphide bonds through the three half-cysteines in the Nef molecule. The availability of large amounts of highly purified and soluble Nef allowed us to assess its alleged G protein activities (Guy et al., 1987, 1990). Both Nef 27 and Nef 25 bound GTP to a significant extent in comparison with other proteins such as BSA, lysozyme and chymotrypsin but this binding was negligible in comparison with p21 r~s (results not shown). Nef 27 and Nef 25 had no detectable GTPase activity and no autophosphorylation activity was associated with highly purified Nef preparations under conditions where we observed p21 ras autophosphorylation (results not shown). Our results with highly purified Nef confirm results that have attributed GTP-binding and GTPase activities to bacterial contaminants (Kaminchik et al., 1991 ; Nebreda et al., 1991 ; Backer et al., 1991). No detectable nucleotide-binding activity was found in n e f gene products derived in vivo (Harris et al., 1992) or in baculovirus-derived Nef (Matsuura et al., 1991). It has been shown previously that intracellular expression of the nefgene results in the down-regulation of CD4 surface expression in CD4 + T lymphocytes (Guy et al., 1987; Garcia & Miller, 1990; Benson et al., 1993; Anderson et al., 1993 ; Mariani & Skowronski, 1993). We wanted to see whether this effect could also be obtained by electroporation of purified recombinant Nef into CD4 + cells. Human CD4 + CEM cells were grown in RPMI cell culture medium (Cytosystems) containing 10 % fetal calf serum (FCS) at 37 °C and harvested by centrifugation. The cells were washed and resuspended in 1'5 mM-phosphate buffer at pH 7"2 containing 250 mmsucrose. Five tll Nef (2.5 gg) or cell lysate was introduced into 40 gl cells using a BAEKON 2000 Macromolecule Transfer System (BAEKON Corp.) which applies an electric field for electroporation. This method has been referred to as 'BAEKONization'. The parameters used
100 90 80 70 60
"~ 50 40
30 20 10 0
0
1;
2; 3; 4; 5; 610 Time after protein uptake (h)
7L0
80
Fig. 4. Effect on surface expression of CD4 of Nef 27 BAEKONized into CD4 + CEM cells, at different times after uptake of protein. +, Yeast lysate; II, E. coli lysate; ,, yeast-derived Nef 27; D , E. coilderived Nef 27.
for protein transfer were: voltage 5 to 6 kV: burst time 0.8 s; pulse time, 160 tas; pulse number 211, and cycles 5 to 7. After BAEKONization the cells were incubated in RPMI containing 10% FCS at 37 °C and immunostained using murine anti-CD4 MAb (Leu 3A and 3B; Becton-Dickinson) and fluorescein-labelled sheep antimouse IgG (Silenus). The stained cells were microscopically examined for fluorescence, and under phasecontrast. Counts were made of total cells, dead cells (showing an even staining throughout), CD4 + cells (clusters of surface staining) and CD4 cells (no surface staining). The CD4 + to total live cell ratio was determined field by field. The CD4 + cells as a percentage of total live cells after BAEKONization are shown in Fig. 4. There is a significant decrease in the proportion of CD4 ÷ cells in CEM cells that had been BAEKONized with intact Nef 27 from both E. coli and yeast. This effect persists for at least 72 h after BAEKONization. This is in contrast to the negative control, CEM cells that had been BAEKONized in the presence of cell lysates. Yeastderived Nef 27 is myristylated (Macreadie et aI., 1993) whereas the E. col#derived Nef 27 described in this report is not myristylated and has three additional amino acids preceding the myristylation site. Myristylation may not be required for down-regulation of CD4 surface expression by recombinant Nef introduced into cells by electroporation, because of possible membrane per-
Short communication
turbation which may obviate the need for Nef to be transported from the cytoplasm to the membrane. These results show that E. coli-derived Nef 27 produced on a large scale is biologically active and that the method described here is very useful for assessing the biological activity of recombinant Nef. We wish to thank Drs Neil McKern and Theo Dopheide for helpful discussions, Mrs Emma James for preparation of the manuscript and Dr Nur-e-Kamal for providing purified p21r"L This work was supported by a Commonwealth AIDS Research Grant.
References ADACHI, A . GENDELMAN,H. t.~ KOEN1G, S., FOLKS, T., WILLEY, R., RABSON, A. & MARTIN, M.A. (1986). Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. Journal of Virology 59, 284~291. ANDERSON, S., SHUGARS, D.C., SWANSTROM, R. & (~ARCIA, J.V. (1993). Nef from primary isolates of human immunodeficiency virus type 1 suppresses surface CD4 expression in human and mouse T cells. Journal of Virology 67, 4923-4931. BACKER, J.M., MENDOLA, C.E., FAIRHURST, J.L. & KOVESDI. I. (1991). The HIV-I nef protein does not have guanine nucleotide binding, GTPase, or autophosphorylating activities. AIDS Research and Htunan Retroviruses 7, 1015-1020. BECKER,D. M. & GUARENTE,L. (1991). High-efficiency transformation of yeast by electroporation. Methods in Enzymology 194, 182-187. BENSON,R. E., SANFRIDSON,A., OTTINGER,J. S., DOYLE,C. & CULLEN, B. R. (1993). Down regulation of cell-surface CD4 expression by simian immunodeficiency virus Nef prevents viral superinfection. Journal of Experimental Medicine 177, 1561 1566. DANIEL, M.D., KIRCHOFF, F., CZAJAK, S.C., SEHGAL, P.U. & DESROSmRS,R. C. (1992). Protective effects of a live attenuated SlY vaccine with a deletion in the nefgene. Science 258, 1938-1941. ERLICH, H. A. (1989). PCR technology; Principles and Applicationsfor DNA Amplification. New York: Stockton Press. GARClA, J.V. & MILLER, A.D. (1990). Serine phosphorylationindependent down-regulation of cell-surface CD4 by nef. Nature, London 350, 508-511.
655
GuY, B., KIENY, M. P., RIVIERE,Y., LE PEUCH, C., DOTT, K., GIRAD, M., MONTAGNIER,L. 8: LECOCQ,J.-P. (1987). HIV F/3' orfencodes a phosphorylated GTP-binding protein resembling an oncogene product. Nature, London 330, 26(%269. GuY, B., RIVmRE,Y., DOTT, K., R~GNAULT,A, & KIENY,M. P. (1990). Mutational analysis of the HIV nef protein. Virology 176, 413-425. HARRIS, M., HISLOP, S., PATSILINAKOS,P. & NEIL, J. C. (1992). In viva derived HIV-1 nef gene products are heterogeneous and lack detectable nucleotide binding activity. AIDS Research and Human Retrov#uses 8, 53~543. KAMINCHIK, J., BASHAN,N., ITACH, A., SARVER,N., GORECKI, M. & PANET, A. (1991). Genetic characterization of human immunodeficiency virus type 1 nef gene products translated in vitro and expressed in mammalian cells. Journal of Virology 65, 583-588. KESTLER, H.W., 1II, RINGLER, D.J., MORt, K., PANICALI,D.L., SEHGAL, P.K., DANIEL, M.D. & DESROSmRS, R.C. (1991). Importance of the nefgene for maintenance of high virus loads and for development of AIDS. Cell 65, 651-662. MACREADIE, I. G., FAILLA, P., HORAITIS, O. & AZAD, A.A. (1992). Production of HIV-1 Vpu with pYEULCBX, a convenient vector for the production of non-fused proteins in yeast. Biotechnology Letters 14, 639 642. MACREADIE,I. G., WARD, A. C., FAILLA,P., GRGACIC,E., McPttEE, D. & AZAD, A, A. (1993). Expression of H1V-1 nefin yeast: the 27 kDa Nefprotein is myristylated and fractionates with the nucleus. Yeast 9, 565 573. MARIANI, R. & SKOWRONSKI,J. (1993). CD4 down-regulation by nef alleles isolated from human immunodeficiency virus type 1-infected individuals. Proceedingsof the National Academy of Sciences, U.S.A. 90, 5549 5553. MATSUURA,Y., MAEKAWA,M., HATTORI,S., IKEGAMAI,N., HAYASHI, A., YAMAZAKI,S., MORITA,C. & TAKEBE,Y. (1991). Purification and characterization of human immunodeficiency virus type 1 nef gene product expressed by a recombinant baculovirus. Virology 184, 580-586. NEBREDA,A. R., BRYAN,T., SEGADE,F., WINGFIELD,P., VENKATESAN, S. & SANTOS,E. (1991). Biochemical and biological comparison of HIV-1 nefand ras gene products. Virology 183, 151-159. SMITH, D.B. & JOHNSON, K.S. (1988). Single-step purification of polypeptides expressed in E. cob as fusions with glutathione Stransferase. Gene 67, 31-40. SUMMERS, M. O. & SMITH, G.E. (1987). A manual of methods for baculovirus vectors and insect cell culture procedures. Texas A&M University Experimental Station Bulletor no. 1555.
(Received 1 September 1993; Accepted 18 October 1993)
