Listeria monocytogenes bile salt hydrolase is a ... - Wiley Online Library

Download PDF
7 downloads 0 Views 135KB Size Report
Comment
May 15, 2002 - Graves, L.M., et al. (1997) An outbreak of gastroenteritis ... Can J Microbiol 46: 878–884. Grill, J.P., Cayuela, C., Antoine, J.M., and Schneider, F.
Molecular Microbiology (2002) 45(4), 1095–1106

Listeria monocytogenes bile salt hydrolase is a PrfAregulated virulence factor involved in the intestinal and hepatic phases of listeriosis Olivier Dussurget,1 Didier Cabanes,1 Pierre Dehoux,1 Marc Lecuit,1 the European Listeria Genome Consortium,† Carmen Buchrieser,2 Philippe Glaser2 and Pascale Cossart1* 1 Unité des Interactions Bactéries-Cellules, and 2 Laboratoire de Génomique des Microorganismes Pathogènes, Institut Pasteur, 28 rue du Dr Roux, 75724 Paris Cedex 15, France. Summary Listeria monocytogenes is a bacterial pathogen causing severe food-borne infections in humans and animals. It can sense and adapt to a variety of harsh microenvironments outside as well as inside the host. Once ingested by a mammalian host, the bacterial pathogen reaches the intestinal lumen, where it encounters bile salts which, in addition to their role in digestion, have antimicrobial activity. Comparison of the L. monocytogenes and Listeria innocua genomes has revealed the presence of an L. monocytogenes-specific putative gene encoding a bile salt hydrolase (BSH). Here, we show that the bsh gene encodes a functional intracellular enzyme in all pathogenic Listeria species. The bsh gene is positively regulated by PrfA, the transcriptional activator of known L. monocytogenes virulence genes. Moreover, BSH activity increases at low oxygen concentration. Deletion of bsh results in decreased resistance to bile in vitro, reduced bacterial faecal carriage after oral infection of the guinea-pigs, reduced virulence and liver colonization after intravenous inoculation of mice. Taken together, these results demonstrate that BSH is a novel Accepted 15 May, 2002. *For correspondence. E-mail [email protected]; Tel. (+33) 1 45 68 88 41; Fax (+33) 1 45 68 87 06. †P. Glaser, L. Frangeul, C. Buchrieser, C. Rusniok, A. Amend, F. Baquero, P. Berche, H. Bloecker, P. Brandt, T. Chakraborty, A. Charbit, F. Chetouani, E. Couve, A. de Daruvar, P. Dehoux, E. Domann, G. Dominguez-Bernal, E. Duchaud, L. Durant, O. Dussurget, K.-D. Entian, H. Fsihi, F. Garcia-Del Portillo, P. Garrido, L. Gautier, W. Goebel, N. Gomez-Lopez, T. Hain, J. Hauf, D. Jackson, L.-M. Jones, U. Kaerst, J. Kreft, M. Kuhn, F. Kunst, G. Kurapkat, E. Madueno, A. Maitournam, J. Mata Vicente, E. Ng, H. Nedjari, G. Nordsiek, S. Novella, B. de Pablos, J.-C. Perez-Diaz, R. Purcell, B. Remmel, M. Rose, T. Schlueter, N. Simoes, A. Tierrez, J.-A. Vazquez-Boland, H. Voss, J. Wehland and P. Cossart.

© 2002 Blackwell Science Ltd

PrfA-regulated L. monocytogenes virulence factor involved in the intestinal and hepatic phases of listeriosis. Introduction Bile salts are end-products of cholesterol metabolism in mammals. Bile salts are mostly synthesized in hepatocytes, where >95% are conjugated to glycine or taurine before transport into the biliary canalicular system of the liver and/or storage in the gall bladder. In response to the ingestion of food, bile salts are released into the duodenum helping fat digestion and absorption. In addition to their role in digestion, bile salts have antimicrobial properties. Bile salts are amphipathic molecules, which can degrade lipid-containing bacterial and viral membranes. Some resident enteric microflora and intestinal pathogens have evolved mechanisms to resist the detergent action of bile salts by synthesis of porins, transport proteins, efflux pumps or lipopolysaccharide (LPS) (Gunn, 2000). Others have developed the capacity to transform bile salts by modification of the steroid ring or hydrolysis of the conjugated bile salts. The latter deconjugation reaction is catalysed by bile salt hydrolase (BSH), also called conjugated bile acid hydrolase (CBAH). This cytoplasmic enzyme is produced by many Gram-positive and Gramnegative commensal bacteria of the resident enteric microflora, including strains of genera such as Bacteroides (Stellwag and Hylemon, 1976; Kawamoto et al., 1989), Clostridium (Gopal-Srivastava and Hylemon, 1988; Coleman and Hudson, 1995) and Enterococcus (Kobashi et al., 1978; Franz et al., 2001). It has also been characterized in lactic acid bacteria such as Bifidobacterium (Grill et al., 1995; 2000a) and Lactobacillus (Elkins and Savage, 1998; Grill et al., 2000b; Moser and Savage, 2001), some strains of which are part of the human enteric microflora and/or are used in the dairy industry as probiotics, owing to their safety for humans when administered orally and their beneficial effects on human health (Schiffrin and Blum, 2001). BSH has not been described in enteropathogens, such as Salmonella, Shigella, Yersinia or Campylobacter. BSHs are believed to protect commensal bacteria from bile salt toxicity and to contribute to bacterial survival and intestinal colonization (De Boever et al., 2000; Grill et al., 2000a,b).

1096 O. Dussurget et al. Here, we demonstrate that BSH of the enteropathogen Listeria monocytogenes is a virulence factor involved in bacterial survival in the intestinal lumen and liver, two host environments in which L. monocytogenes has to resist the antibacterial effects of bile salts. As described for previously identified L. monocytogenes virulence genes such as inlA, hly and actA, bsh is positively regulated by the transcriptional activator PrfA. BSH activity is increased at low oxygen tension, a condition that is encountered after bacterial ingestion. Moreover, we show that the bsh gene and BSH activity are present in all human pathogenic Listeria species, thus establishing an epidemiological link between Listeria resistance to bile salts and its ability to colonize and infect humans. Results The bsh gene of L. monocytogenes does not have an orthologue in the non-pathogenic Listeria species L. innocua We have compared the genomes of the pathogen L. monocytogenes and the non-pathogenic species Listeria innocua in order to identify putative genes involved in L. monocytogenes virulence (Glaser et al., 2001). A total of 270 DNA fragments that are absent from the L. innocua genome were identified, including a 975 bp open reading frame (ORF), the putative gene product of which displayed 67% identity (219/324 amino acids) to Lactobacillus plantarum BSH (EC 3.5.1.24). The genomic organization of the region surrounding the L. monocytogenes bsh gene was identical to that of L. innocua (Fig. 1). In L. monocytogenes, the bsh gene is preceded by the groES–groEL operon and followed by an ORF of unknown function, Lmo 2066, both genes being in the

same orientation. In L. innocua, the groES–groEL operon is directly upstream from the orthologue of Lmo 2066, the ORF 3530.1. The sizes of these three sequences, 285, 1629 and 300 bp, respectively, are identical in the two species. Their G+C content (38–41%) was also conserved in the two species. In contrast, the bsh gene has a lower G+C content, i.e. 36% (Fig. 1). The bsh gene encodes an active enzyme in L. monocytogenes The expression of the bsh gene during exponential growth of L. monocytogenes in brain–heart infusion (BHI) at 37∞C was assessed by reverse transcription polymerase chain reaction (RT-PCR), which revealed that bsh is transcribed in these conditions (data not shown). BSH activity was demonstrated by plating L. monocytogenes onto MRS medium supplemented with 0.5% glycodeoxycholic acid (MRS-GDCA). According to the principle of the assay developed by Dashkevicz and Feighner (1989), bacteria producing BSH deconjugate GDCA and release free deoxycholate acid (DCA), which precipitates in the acidic medium. In contrast to L. innocua, incubation of L. monocytogenes on MRS-GDCA plates at 37∞C resulted in the production of a white halo of precipitated free bile acids around colonies, thus demonstrating the presence of BSH activity (Fig. 2B). In order to determine whether the bsh gene was responsible for the BSH activity and to study the role of the enzyme, an isogenic BSH-deficient mutant was constructed in L. monocytogenes by gene replacement (see Experimental procedures). Southern blot analysis confirmed the replacement of the bsh gene (Fig. 2A). To verify the absence of any BSH activity in the mutant strain,

groES

groEL

G+C=38%

G+C=41%

bsh G+C=36%

Lmo2066 G+C=39%

PrfA box

Listeria monocytogenes

Listeria innocua groES

groEL

3530.1

G+C=39%

G+C=41%

G+C=39%

1kb Fig. 1. Genomic organization of the bsh gene region. Data from the complete genome sequences of L. monocytogenes and L. innocua were used to draw this map approximately to scale. Arrows indicate the orientation of the genes. Hairpins depict putative terminators. The black triangle shows the PrfA box. The G+C percentage is indicated below each gene name. The open reading frames Lmo 2066 and 3530.1 are orthologues. © 2002 Blackwell Science Ltd, Molecular Microbiology, 45, 1095–1106

kb

B

EG

A

De EG De ∆b sh

Listeria monocytogenes bile salt hydrolase 1097

EGDe

EGDe∆bsh L. innocua

EGDe +bsh

EGDe∆bsh L. innocua +bsh +bsh

3.02.01.61.00.5-

Fig. 2. Disruption of the bsh gene. A. Chromosomal DNAs from L. monocytogenes EGDe and the L. monocytogenes EGDe Dbsh were digested with AccI and analysed by Southern blotting with a 32P-labelled probe corresponding to the bsh gene. The 1.4 kb fragment containing the bsh gene is indicated by an arrow. B. L. monocytogenes EGDe and L. monocytogenes EGDe Dbsh, L. innocua and these strains transformed with a plasmid carrying the bsh gene under the control of its own promoter were patched onto MRS-GDCA medium. Strains expressing the bsh gene produced a halo of precipitated DCA.

L. monocytogenes EGDe and L. monocytogenes EGDe Dbsh were patched onto MRS-GDCA. Only L. monocytogenes EGDe showed BSH activity (Fig. 2B), demonstrating unambiguously that the BSH activity resulted solely from the bsh gene, in agreement with the absence of a close paralogous gene in the L. monocytogenes genome. Indeed, the gene product of the ORF Lmo0446 has been annotated as a putative bile salt hydrolase, but shows 42% homology to Bacillus subtilis penicillin amidase and only weak homologies to the Clostridium perfringens BSH (36%) and L. monocytogenes BSH (31%). Complementation of the mutant strain with the bsh gene under the control of its promoter restored BSH activity (Fig. 2B). The wild-type, mutant and complemented strains had a similar morphology, as assessed by light microscopy. They produced similar colonies on BHI agar medium, and their growth rates were similar in BHI at 37∞C. Heterologous expression of bsh in L. innocua also resulted in BSH activity (Fig. 2B). The bsh gene is specific to pathogenic Listeria Strains from the six Listeria species and 12 L. monocytogenes serovars were screened for BSH activity on MRS-GDCA. The two pathogenic strains, L. monocytogenes and Listeria ivanovii, as well as Listeria seeligeri, exhibited BSH activity (Fig. 3). The non-pathogenic species, L. innocua, Listeria welshimeri and Listeria grayi, did not produce any precipitation zone. All L. monocytogenes serovars except serovar 4e, which is not found in © 2002 Blackwell Science Ltd, Molecular Microbiology, 45, 1095–1106

mammals, had BSH activity (Fig. 3). DNA hybridization carried out on 91 additional Listeria strains confirmed the activity data except for the BSH-negative L. monocytogenes serovar 4e, in which a sequence homologous to bsh was nevertheless detected (M. Doumith, personal communication). The bsh gene is positively regulated by PrfA The bsh transcriptional start point was determined by primer extension using RNA extracted from L. monocytogenes growing exponentially in BHI at 37∞C (see Experimental procedures). The transcriptional start point is located 103 nucleotides upstream of the bsh start codon (Fig. 4A). A sequence similar to the Escherichia coli s70 consensus -10 region was identified upstream of the transcriptional start point. The E. coli -35 consensus TTGACA hexamer was lacking from the bsh promoter. A perfect palindromic sequence, TTAAAAATTTTTAA, was found 133 bp upstream of the bsh start codon. The sequence had two mismatches when compared with the consensus PrfA box found in the listeriolysin gene regulatory region (Table 1). Thus, the transcript starts 30 bp downstream from the PrfA box, and the PrfA box is located in the -41 region, a position that is conserved in most PrfA-regulated promoters (Table 1, Fig. 4B). The role of PrfA in the transcription of the bsh gene was assessed by RT-PCR. cDNA synthesis and PCR were performed using bsh-specific oligonucleotides and RNAs that were isolated from L. monocytogenes and L. mono-

1098 O. Dussurget et al.

14

Halo size (mm)

12 10 8 6 4 2

7

4e

4d

4c

4b

4a

3c

3b

3a

1/2c

1/2b

1/2a

Lgr

Lwe

Lin

Lse

Liv

Lmo

0

Fig. 3. Detection of BSH activity in Listeria ssp. Strains of each Listeria species (grey bars) and L. monocytogenes serovars (white bars) were patched onto MRS-GDCA medium, and the diameter of the halo was measured. Lmo, L. monocytogenes; Liv, L. ivanovii; Lse, L. seeligeri; Lin, L. innocua; Lwe, L. welshimeri; Lgr, L. grayi.

cytogenes DprfA during exponential growth in BHI at 37∞C. As shown in Fig. 5A, the levels of bsh mRNA were lower in the DprfA strain, demonstrating that PrfA regulates BSH transcription. Northern blots confirmed that higher amounts of the 1.1 kb specific bsh transcript were detected in the RNAs from the wild-type strain compared with the RNAs from the DprfA strain (data not shown). In order to confirm the role of PrfA on BSH synthesis, the hydrolase activities of L. monocytogenes and L.

monocytogenes DprfA were compared using the MRS agar plate assay. The BSH activity of the DprfA strain was much lower than that of the wild-type strain, as revealed by the difference in halo size (Fig. 5B). BSH activity is increased by hypoxia As host tissues in which L. monocytogenes faces bile salts have oxygen tensions lower than atmospheric air,

A T C G TSP

A A T T A T T T G A

B -10 start RBS -35 ATTTAAAAATTTTTAAAGGAGCCAAATCATATTGTATGAGGTAATAAACT(N82)TTGAGGAGGGATTTTTAATG PrfA box Fig. 4. Identification of the bsh gene promoter. A. Determination of the 5¢-terminus of the bsh transcript. RNA was prepared from a logarithmic culture of L. monocytogenes EGDe growing in BHI broth at 37∞C. The transcriptional start point (TSP, +1) shown in the right lane was determined by primer extension. The +1 is indicated by an arrow, and the corresponding nucleotide is boxed. B. Schematic organization of the bsh promoter. The putative -10 and -35 PrfA boxes of the bsh promoter are underlined, as well as a possible ribosome binding site (RBS) and the start codon. The +1 is indicated by an arrow. © 2002 Blackwell Science Ltd, Molecular Microbiology, 45, 1095–1106

Listeria monocytogenes bile salt hydrolase 1099 Table 1. Comparison of the promoter sequences regulated by the PrfA activator. Gene

Function

PrfA box

 hly plcA mpl actA inlA prfA bsh

Pore-forming toxin Phosphatidylinositol-specific phospholipase C Zinc-metalloprotease processing the phospholipase C, PlcB Surface protein responsible for actin-based motility Invasin responsible for the crossing of the intestinal barrier Transcriptional activator of virulence genes Bile salt hydrolase

D1

D2

33 32 32 32 31 30 30

131 24 150 148 397 31 103



CA T TAACATT TGTTA A CG CGT TAACAAATGTTA A T G A A T TAACAAATGTAA A AG GA T TAACAAATGTTA GAG GGATAACATAAGTTA A T T A GCTAACAATTGTTGT T A A T T TAAAAATT T TTA A A G

Palindromes are indicated by arrows. Distances between palindromes and the +1 (D1) and between the +1 and the start codon (D2) are indicated in nucleotides.

we hypothesized that BSH activity could be increased by hypoxia. L. monocytogenes was patched onto MRSGDCA and incubated at 37∞C in jars under ª 45 mmHg oxygen tension. Hydrolase activity detected on these plates was compared with that on plates incubated at atmospheric oxygen tension (159 mmHg). L. monocytogenes deconjugated higher amounts of GDCA in microaerophilic conditions than in aerobic conditions (Fig. 6A). These results indicate that L. monocytogenes BSH activity increases in response to a decrease in the level of external oxygen. To determine whether the higher BSH activity was the result of increased levels of the bsh messenger RNAs, Northern blots were performed using the bsh gene as a probe. The probe was hybridized to RNAs that were isolated from L. monocytogenes grown exponentially at 159 mmHg or 45 mmHg oxygen tension in BHI at 37∞C. Similar amounts of the 1.1 kb bsh transcript were detected in the RNA from cultures exposed to 159 mmHg and 45 mmHg oxygen tension (Fig. 6B), suggesting that oxygen acts on BSH at the post-transcriptional level. Although the transcription of the bsh gene was not altered by hypoxia, we were interested to test the putative effect of oxygen on PrfA expression. Whole-cell extracts of L. monocytogenes growing exponentially at 159 mmHg or 45 mmHg oxygen tension in BHI at 37∞C were analysed by Western blot using anti-L. monocyto-

A kb

rfA rfA p p e∆ e e∆ De D D D EG EG EG EG

BSH is involved in resistance to bile in vitro In order to study the possible role of BSH in resistance to bile toxicity, the minimal inhibitory concentrations (MICs) of porcine bile and purified bile salts were determined for L. monocytogenes EGDe and L. monocytogenes EGDe Dbsh. Both bile and purified bile salt MICs for the mutant were twofold lower than that of the wild-type strain, 0.08% and 0.15% respectively. BSH activity contributes to L. monocytogenes survival within the intestinal lumen To study the possible role of BSH in the intestinal phase of listeriosis, i.e. in the earliest stage of the infectious process, the persistence of the BSH-deficient strain was studied and compared with the parental strain or the complemented strain. To this end, oral infection with either the BSH-deficient strain or the L. monocytogenes parental strain was performed in guinea pigs, a species in which L. monocytogenes oral inoculation results in systemic disease (Lecuit et al., 2001). Quantification of stool

B EGDe EGDe∆prfA

1.00.5bsh

genes PrfA polyclonal antibodies. Comparable amounts of PrfA were detected in both cell extracts (data not shown). Thus, hypoxia does not contribute to increased expression of prfA.

rrn

© 2002 Blackwell Science Ltd, Molecular Microbiology, 45, 1095–1106

Fig. 5. Effect of PrfA on L. monocytogenes bsh gene and BSH activity. A. Effect of PrfA on the expression of the bsh gene. The bsh gene transcription was analysed by RT-PCR using RNA prepared from logarithmic cultures of L. monocytogenes EGDe and L. monocytogenes EGDe DprfA growing in BHI broth at 37∞C. The 0.9 kb fragments correspond to the bsh RT-PCR product, and the 0.8 kb fragments correspond to rrn RT-PCR control product. B. Effect of PrfA on BSH activity. L. monocytogenes EGDe and L. monocytogenes EGDe DprfA were patched onto MRS-GDCA medium, and plates were exposed to 45 mmHg oxygen tension at 37∞C.

B

A 159 mmHg 45 mmHg

kb

15 9m 45 m m Hg m Hg

1100 O. Dussurget et al.

2.01.00.5-

BSH activity is involved in L. monocytogenes virulence after intravenous inoculation BSH is a cytosolic enzyme, and it is unlikely that it could play a role in crossing the intestinal barrier. To study the role of BSH in the infectious steps following this step and to bypass the intestinal intraluminal effect of BSH, intravenous infection with either the BSH-deficient strain or its parental counterpart was performed in mice, the best characterized model so far to study the systemic phase of listeriosis. LD50 values after intravenous injection into BALB/c mice were determined for L. monocytogenes EGDe and L. monocytogenes EGDe Dbsh. The LD50 obtained for the mutant was two- to threefold higher than that of the wild-type strain (3 ¥ 104 and 8 ¥ 103 cfu respectively). The significance of this attenuation in the BSH mutant was studied further by comparing over a time course the infection level of liver, spleen and brain of mice infected intravenously with either the mutant and the wildtype bacteria. An unambiguous difference between the two strains could be observed 2 days after inoculation in the liver and spleen, but only by the third day after

inoculation in the brain (Fig. 8). These results suggest that BSH contributes to the survival of L. monocytogenes in target organs other than the intestine, particularly in the liver filter, which bacteria have to cross and in which bile salt concentration is high. Discussion This study describes the existence and role of BSH activity in pathogenic Listeria species. BSH is a novel type of virulence factor that allows bacterial survival within the host, in the intestinal lumen and in the liver tissue, thus playing a key role in the intestinal and hepatic phase of listeriosis. It is the first description of a BSH produced by a pathogenic bacterial species that is not considered as a member of the normal resident enteric microflora. The bsh gene was discovered by comparing the L. monocytogenes genome with that of the non-pathogenic species

8

Log10 L. monocytogenes/g

microorganisms after intragastric injection of a sublethal inoculum (ª 1010 bacteria) into Hartley guinea pigs was performed for L. monocytogenes EGDe, L. monocytogenes EGDe Dbsh and L. monocytogenes EGDe Dbsh complemented with the bsh gene. For the wild-type strain in our experimental conditions, the number of bacteria in stools was 107 after 24 h and decreased only slightly with time. Bacterial counts of the bsh mutant were reduced by 4–5 log at 48 h after infection compared with the wild-type and complemented strains and continued to decrease with time (Fig. 7). These results demonstrate that BSH plays a role in L. monocytogenes persistence within the gastrointestinal tract. In agreement with our data, preliminary results show that, when L. innocua or L. monocytogenes are transformed with a plasmid carrying the bsh gene, there is a gain of function, i.e. intestinal multiplication is increased by ª 1 log compared with the parental strains.

Fig. 6. Effect of oxygen tension on L. monocytogenes BSH. A. Effect of hypoxia on BSH activity. L. monocytogenes EGDe was patched onto MRS-GDCA medium, and plates were exposed to 159 mmHg or 45 mmHg oxygen tension at 37∞C. B. Effect of hypoxia on the expression of the bsh gene. The bsh gene transcript was analysed by Northern blot using RNA prepared from logarithmic cultures of L. monocytogenes EGDe growing at 159 mmHg or 45 mmHg oxygen tension in BHI broth at 37∞C. The 1.1 kb transcript corresponding to the bsh transcript is indicated by an arrow.

EGDe EGDe Dbsh EGDe Dbsh+bsh

7 6 5 4 3 2 1 0

24

48

72

Time (h) Fig. 7. Effect of BSH on persistence in the guinea pig gastrointestinal tract. L. monocytogenes EGDe (black), L. monocytogenes EGDe Dbsh (white) and L. monocytogenes EGDe Dbsh complemented (grey) were inoculated intragastrically in groups of three guinea pigs with ª 1010 cfu. Listeria growth was followed in the stools at 24, 48 and 72 h. © 2002 Blackwell Science Ltd, Molecular Microbiology, 45, 1095–1106

Listeria monocytogenes bile salt hydrolase 1101 Fig. 8. Effect of L. monocytogenes BSH on virulence in mice. L. monocytogenes EGDe (black) and the L. monocytogenes EGDe Dbsh (white) were inoculated intravenously in groups of four BALB/c mice with ª 104 cfu. Bacterial growth was followed in the spleen, the liver and the brain at 24, 48 and 72 h.

Log10 L. monocytogenes

10 9

liver

8 7 EGDe EGDe Dbsh

6 5 24

48

72

Log10 L. monocytogenes

9

8

spleen

7

6

EGDe EGDe Dbsh

5 24

48

72

Log10 L. monocytogenes

5 4

brain

3 2 1

EGDe EGDe Dbsh

0 24

48

72

Time (h) L. innocua and searching for genes that were absent from the sequence of the latter species. It is not clear how and why L. monocytogenes acquired the bsh gene. The G+C content of L. monocytogenes bsh, 36%, is lower than those of neighbouring genes, and it may have been acquired from low-G+C content bacteria. Indeed, when the BSH amino acid sequence of Listeria was compared with bacterial BSHs from public databases, Lactobacillus plantarum was the closest relative of L. monocytogenes, © 2002 Blackwell Science Ltd, Molecular Microbiology, 45, 1095–1106

showing 67% identity. In addition to the sequence homology, the G+C percentage of the L. plantarum bsh gene is closest to that of L. monocytogenes after Lactobacillus acidophilus, 34% and 36% respectively. Lactobacilli, along with Bifidobacterium and Lactococcus, are nonpathogenic bacteria that are part of the human resident microflora and are referred to as lactic acid bacteria. Some strains are probiotics used in many dairy products because they are believed to be safe and could be

1102 O. Dussurget et al. beneficial to human health, possibly by stimulation of the immune system (Miettinen et al., 1996). At several stages of their life cycle, L. monocytogenes and Lactobacilli share the same microenvironments, e.g. not only do they have a similar intestinal tropism, but they also grow on decaying vegetation, in food and in silage. It has been proposed that the intestine could be a reservoir for L. monocytogenes, as asymptomatic faecal carriage of L. monocytogenes in healthy adults is estimated at between 2% and 10% (Schlech, 2000), thus placing Listeria at the border between pathogen and commensal microorganisms. It is possible that Lactobacilli or other bacteria from the normal enteric microflora and L. monocytogenes might be able to exchange genetic material. The L. monocytogenes bsh gene could have resulted from one of these exchanges. In agreement with this hypothesis, putative competence genes have been detected in the L. monocytogenes genome (Glaser et al., 2001). The extremely conserved genomic organization of the region surrounding the bsh locus in L. monocytogenes and L. innocua suggests that L. innocua has lost the bsh gene, in agreement with the current opinion that L. innocua is derived from L. monocytogenes (Chakraborty et al., 2000; Glaser et al., 2001). BSH was shown to be produced as an active enzyme by all assayed strains pathogenic for mammals. Indeed, L. ivanovii and all L. monocytogenes serovars, except serovar 4e, produced the enzyme. However, a sequence orthologous to the L. monocytogenes EGDe bsh gene was detected in the serovar 4e, in which it might not be transcribed or might encode a non-functional enzyme. It is of interest to note that strains of serovar 4e are mostly found in amphibians (Weber et al., 1995) and that BSH activity may not be necessary for Listeria to infect or colonize these hosts, as they have been shown to synthesize atypical bile salts, such as varanic acid, bile alcohol sulphates and unconjugated bile salts (Yoshii et al., 1994; Une et al., 1996). Interestingly, the only non-pathogenic Listeria that produced a BSH was L. seeligeri. Although it has been implicated in one case of human meningitis (Rocourt et al., 1986), this species is experimentally nonpathogenic. It is closely related to pathogenic Listeria, as it is haemolytic and possesses the prfA–plcA–hly mpl–actA–plcB virulence gene cluster in its genome, but this cluster is slightly modified (Gouin et al., 1994; Chakraborty et al., 2000). Expression of these virulence genes might be too low in this species to confer pathogenicity (Gouin et al., 1994). The observation that the BSH was only produced by strains that also expressed the virulence gene regulator PrfA led us to investigate the role of PrfA in the expression of BSH. The transcriptional start point was mapped, and a PrfA box was identified in the -35 region, a distance that is conserved in the PrfA-dependent promoters. PrfA-

dependent promoters are related to class II CRP-dependent promoters. They have a -35 region that is not similar to the E. coli consensus and to which the positive regulator binds (Raibaud and Schwartz, 1984; Sheehan et al., 1995; Niu et al., 1996; Bockmann et al., 2000). The BSH PrfA box is a perfect palindrome, albeit with 10 of the 12 nucleotides of the PrfA-binding consensus sequence conserved. Sequence data were completed by a functional analysis showing that the transcription of the bsh gene was positively regulated by PrfA. Not only was BSH production controlled by PrfA, but its activity was dependent on the oxygen tension, as hypoxia increased its hydrolytic activity. A similar observation has been made in the case of L. acidophilus, which requires a low redox potential to deconjugate bile salts (Gilliland and Speck, 1977). In contrast, the BSHs from strict anaerobes such as Clostridium and Bacteroides are oxygen insensitive (Masuda, 1981). Once ingested, L. monocytogenes encounters oxygen tensions that are much lower than atmospheric air (159 mmHg). Interestingly, microenvironments in which bacteria can encounter bile salts, i.e. the intestine and the liver (two tissues that are L. monocytogenes targets during invasive listeriosis), constitute microaerophilic environments. Measurement of intraluminal oxygenation in the gastrointestinal tract of mice shows an oxygen gradient ranging from 58 mmHg in the stomach to 32 mmHg in the duodenum and 3 mmHg in the sigmoid colon (He et al., 1999). When the invasion process starts, L. monocytogenes faces low oxygen tensions inside cells, i.e. 5– 40 mmHg (Jiang et al., 1996). Like temperature, reduced oxygen tension in the host could be a signal sensed by Listeria to switch on the expression of its virulence machinery where, when and to the extent needed. The activator PrfA and its interaction with target genes have been shown to respond to various environmental signals such as temperature (Renzoni et al., 1997) and iron concentration (Bockmann et al., 1996). However, as described in this work, the level of production of the PrfA protein itself does not seem to be influenced by oxygen tension, and transcription of the bsh gene was not altered by hypoxia. These data suggest that the oxygendependent regulation of BSH activity is independent of PrfA. The post-transcriptional mechanism by which the BSH is activated and/or stabilized by hypoxia is not known. The enzyme itself might be sensitive to oxygen and/or regulated post-transcriptionally by a redox sensor. Little is known about the molecular mechanisms evolved by enteric bacteria to resist bile toxicity. Specific inducible bile tolerance responses might co-exist with non-specific constitutive mechanisms of resistance to bile, such as the outer membrane, which is an important barrier to bile (Gunn, 2000). Some enteric pathogens not only produce proteins that confer resistance to bile, but also sense bile and use this signal to know where and © 2002 Blackwell Science Ltd, Molecular Microbiology, 45, 1095–1106

Listeria monocytogenes bile salt hydrolase 1103 when to express virulence factors (Gunn, 2000; Prouty and Gunn, 2000). Bile has been shown to alter the pattern of expression of several virulence factors such as Vibrio parahaemolyticus haemolysin (Osawa and Yamai, 1996), the toxin co-regulated pilus and the cholera toxin from Vibrio cholerae (Gupta and Chowdhury, 1997; Schuhmacher and Klose, 1999). The influence of bile on virulence factors and the role of bile tolerance mechanisms in establishing intestinal commensalism led us to study the effect of BSH deficiency in vivo. Faecal carriage, a reflection of intestinal persistence, was determined after oral infection of guinea pigs. L. monocytogenes BSH was shown to be critical for bacterial faecal carriage in stools as the multiplication of the BSH-deficient mutant was dramatically reduced compared with the wild-type strain. If BSH contributes to survival in the gastrointestinal tract by conferring resistance to bile toxicity in the intestine, one could hypothesize that it could also promote colonization by providing an advantage to L. monocytogenes when competing with other intestinal pathogens or the normal enteric microflora. This could be tested in a gnotobiotic model of infection. In addition, the BSH-deficient mutant was less virulent than its parental strain in the BALB/c mouse model of infection after intravenous injection, and was impaired in its ability to infect liver, spleen and, at a later stage, brain. The presence of bile salts in hepatocytes most probably accounts for this defect in the liver. The reduced bacterial counts in the spleen and brain could be secondary to, and possibly a consequence of, the impaired multiplication in the liver. BSH could thus have a role in the intestinal and hepatic phases of invasive human listeriosis and/or during human febrile gastroenteritis associated with L. monocytogenes (Dalton et al., 1997; Aureli et al., 2000). More importantly, our data argue for a role for BSH in L. monocytogenes oral–faecal transmissibility (Wing and Gregory, 2002).

Experimental procedures Bacterial strains, media and growth conditions Listeria monocytogenes EGDe and L. monocytogenes EGDe DprfA was obtained from Dr M. Kuhn. All other Listeria strains were obtained from the Centre National de Référence des Listeria, Institut Pasteur, Paris. Listeria were grown routinely in BHI medium (Difco) at 37∞C. When appropriate, Listeria were grown under microaerophilic conditions in jars using Campygen sachets (Oxoid). When required, antibiotics were added at the following concentrations: chloramphenicol, 7 mg ml-1; kanamycin, 20 mg ml-1. E. coli strains were grown in LB medium (Difco) at 37∞C. When required, antibiotics were included at the following concentrations: ampicillin, 100 mg ml-1; kanamycin, 20 mg ml-1. For detection of BSH activity, the plate assay developed by Dashkevicz and Feighner (1989) was used with minor modifications. Bacteria were grown onto Man Rogosa and Sharpe (MRS) agar medium (Difco) sup© 2002 Blackwell Science Ltd, Molecular Microbiology, 45, 1095–1106

plemented with 0.5% (w/v) glycodeoxycholic acid (Sigma), and plates were incubated at various oxygen tensions. Colonies of bacteria producing BSH were surrounded with white halos of free bile acids, which precipitated at acidic pH.

DNA techniques DNA manipulations were performed by standard procedures as described previously (Sambrook et al., 1989). DNA fragments used in the cloning procedures and PCR products were isolated from agarose gels with the Qiaquick gel extraction kit (Qiagen) according to the manufacturer’s instructions. Plasmid DNA from E. coli was isolated and purified with a Qiaprep spin miniprep kit (Qiagen) or a Qiagen plasmid midi kit. Isolation of genomic DNA from Listeria was performed using the DNeasy tissue kit (Qiagen), starting with digestion of the bacterial cell wall in 4 mg ml-1 lysozyme-containing TE buffer for 1 h at 37∞C. For PCR on Listeria colonies, bacteria were microwaved for 4 min at 620 W before adding the PCR reagents.

Mutagenesis The aminoglycoside 3¢-phosphotransferase gene from pUC4K (Amersham) was amplified by PCR using oligonucleotides Kan-KpnI (5¢-GCTCTAGAGCGATTAGAAAAA-3¢) and Kan-XbaI (5¢-TACCCCAAAGCCACGTT-3¢). The KpnI– XbaI PCR product was cloned into the thermosensitive plasmid pKSV7 (Smith and Youngman, 1992), creating pOD23. A DNA fragment containing 0.5 kb of the bsh upstream sequence was generated by PCR using oligonucleotides U50 and L50 (5¢-GGGGTACCCCAAATTTTTCACC TTACAT-3¢). The fragment was cloned into EcoRI– KpnI-digested pOD23, constructing pOD30. A DNA fragment containing 0.5 kb of the bsh downstream sequence was generated by PCR using oligonucleotides U51 (5¢-GCTCTAGA GCCCTTGTCATAGTTTTTTT-3¢) and L51 (5¢-ACCTGCAG GTTAAAACCAACTATTATAA-3¢). The fragment was cloned into XbaI–PstI-digested pOD30, constructing pOD38. To achieve allelic exchange, pOD38 was electroporated into L. monocytogenes EGDe at 2500 V, 200 W and 25 mF. Transformants were selected at 30∞C on BHI medium containing chloramphenicol (BHI-Cm). One colony was grown in BHICm broth at 43.5∞C, and the culture was plated onto BHI-Cm agar at 43.5∞C. One colony was resuspended in 100 ml of BHI, and 10 ml of BHI broth was inoculated with 1ml of this suspension and incubated at 30∞C. BHI broth (10 ml) was inoculated with 1 ml of a 1:10 dilution of the previous culture and incubated at 43.5∞C. Tenfold serial dilutions of this culture were plated onto BHI agar and incubated at 43.5∞C. Colonies were screened onto BHI agar, BHI-Cm agar and BHI agar containing kanamycin. Kanamycin-resistant chloramphenicol-sensitive colonies were analysed by PCR using oligonucleotides P11 (5¢-TAACTTATACAACGAAGG3¢) and P12 (5¢-GACGAGTGGATAAATAGC-3¢), which were complementary to the sequence between nucleotides 14–31 and 928–945, respectively, relative to the BSH start codon. The gene replacement of bsh was verified by Southern blotting of genomic DNA from clones that did not lead to amplification of the bsh gene by PCR. Southern blot analysis was

1104 O. Dussurget et al. performed using Hybond N+ nylon membrane (Amersham) according to standard protocols (Sambrook et al., 1989). The bsh gene, used as a probe, was 5¢ end labelled with T4 polynucleotide kinase and [g-32P]-ATP (Amersham). Detection was carried out by autoradiography.

Complementation and transformation A DNA fragment containing the bsh gene and its promoter was amplified by PCR using oligonucleotides U50 (5¢-AGGAATTCCTTATTGTGGATCCAACTAA-3¢) and L68 (5¢-ACAACTGCAGGTTTTGGTTTTTCCTCAC-3¢). The PCR product was cut with EcoRI and PstI and cloned into the replicative plasmid pMK4 (Sullivan et al., 1984), creating pOD48. Plasmid pOD48 was electroporated into L. monocytogenes EGDe, L. monocytogenes EGDe Dbsh and L. innocua.

RNA techniques RNA from Listeria was isolated and purified with the RNeasy kit (Qiagen), starting with digestion of the bacterial cell wall in 4 mg ml-1 lysozyme-containing TE buffer for 1 h at 37∞C. Purified RNA was treated with DNase I (Ambion) according to the manufacturer’s procedure. The absence of any significant DNA contamination of the RNA was checked by PCR. RT-PCR was performed using Superscript II reverse transcriptase and Taq DNA polymerase in a single tube according to the protocol of the Superscript one-step RT-PCR system (Life Technologies). Oligonucleotides P11 (5¢-TAACT TATACAACGAAGG-3¢) and P12 (5¢-GACGAGTGGATAAA TAGC-3¢), and oligonucleotides U141 (5¢-TTGCTCTTCCAA TGTTAG-3¢) and L142 (5¢-GAGTGCTTAATGCGTTAG-3¢), were used for the cDNA synthesis and PCR amplification of a 930 bp bsh DNA fragment and a 806 bp rrnA DNA fragment respectively.

Primer extension experiments The bsh transcriptional start point was determined by primer extension analysis using the primer extension system from Promega. Briefly, oligonucleotide L140 (5¢-TACCCTCGGA GTTTGGAG-3¢), complementary to the sequence between nucleotides -43 and -60 relative to the BSH start codon, was 5¢ end labelled with T4 polynucleotide kinase and [g-32P]-ATP (Amersham). The labelled oligonucleotide was annealed to 20 mg of RNA and extended with AMV reverse transcriptase for 30 min at 42∞C. To determine the size of the extended product, a PCR was first performed on L. monocytogenes chromosomal DNA using oligonucleotides U50 (5¢-AGGAA TTCCTTATTGTGGATCCAACTAA-3¢) and L133 (5¢-AAAATA GTGATCCTTCGTTG-3¢). Then, the PCR product corresponding to the region upstream from the bsh gene and oligonucleotide L140 were used to generate a sequencing ladder by the dideoxy-chain termination method with the Sequenase DNA polymerase (Sequenase PCR product sequencing kit; Amersham). The primer extension product and the sequencing ladder were loaded onto a 8% polyacrylamide sequencing gel and run for 3 h at 1200 V.

Northern blot analyses Quantitative detection of RNA was carried out using the Northernmax-Gly glyoxal-based system (Ambion). Briefly, 1 mg of RNA was denatured in glyoxal, loaded onto a 1% agarose gel and run at 5 V cm-1. The RNA was transferred to a positively charged nylon membrane by downward transfer for 2 h and cross-linked for 3 min at 312 nm. The blot was prehybridized in Ultrahyb buffer (Ambion) for 30 min at 42∞C. Approximately 500 ng of DNA corresponding to the bsh gene obtained by PCR was labelled with psoralen-biotin for 45 min at 365 nm according to the Brightstar psoralen-biotin protocol (Ambion). Labelled DNA probes were denatured by heat treatment and added to the blot at a final concentration of ª 1 ng ml-1 in Ultrahyb buffer. The blot was hybridized overnight at 42∞C, washed, and the biotinylated probes were detected by chemiluminescence using the Brightstar biodetection kit according to the manufacturer’s procedures (Ambion).

Sensitivity to bile salts and bile Listeria were grown to log phase in BHI broth at 37∞C. Cultures were diluted in BHI, and ª 5 ¥ 103 bacteria ml-1 were challenged with increasing concentrations of bile salts and bile in microtitre plates. Plates were incubated at 37∞C in aerobic or microaerophilic conditions. MIC was determined by assessing bacterial growth at 600 nm using a spectrophotometer (Multiskan RC; Labsystems).

Animal studies Oral infections were performed as described previously (Lecuit et al., 2001). Briefly, 300 g male Hartley guinea pigs (Charles River) were starved for 2 days and anaesthetized (15 mg ml-1 ketamine injected intramuscularly). Five millilitres of 25 mg ml-1 CaCO3 in PBS was injected intragastrically followed by 1 ml of a sublethal bacterial inoculum, ª 1010 cfu. Stool specimens were recovered at 24, 48 and 72 h after infection. Stool pellets were weighed, homogenized in 8 ml of sterile BHI broth, serially diluted in BHI broth and plated on Oxford agar (Oxoid) for quantification of Listeria. Fifty per cent lethal dose (LD50) experiments were performed by injecting 4- to 6-week-old specific pathogen-free female BALB/c mice (Charles River) intravenously with 0.3 ml of serial dilutions of bacteria. Bacterial growth in vivo was studied by injecting mice intravenously with ª 104 cfu. At 24, 48 and 72 h after infection, the number of cfu was determined by plating serial dilutions of organ homogenates on BHI agar medium.

Acknowledgements We thank Michael Kuhn for providing L. monocytogenes EGDe DprfA, Michel Doumith, Paul Martin and Christine Jacquet for sharing unpublished results and providing Listeria type strains. This research was supported by Institut Pasteur, the Ministère de l’Education Nationale, de la Recherche et de la Technologie (Programme de Recherche Fondamentale en Microbiologie et Maladies Infectieuses © 2002 Blackwell Science Ltd, Molecular Microbiology, 45, 1095–1106

Listeria monocytogenes bile salt hydrolase 1105 et Parasitaires) and by the European Commission (contract QLG2-CT 1999-00932). P.C. is an international scholar from the Howard Hughes Medical Institute.

References Aureli, P., Fiorucci, G.C., Caroli, D., Marchiaro, G., Novara, O., Leone, L., and Salmaso, S. (2000) An outbreak of febrile gastroenteritis associated with corn contaminated by Listeria monocytogenes. N Engl J Med 342: 1236–1241. Bockmann, R., Dickneite, C., Middendorf, B., Goebel, W., and Sokolovic, Z. (1996) Specific binding of the Listeria monocytogenes transcriptional regulator PrfA to target sequences requires additional factor(s) and is influenced by iron. Mol Microbiol 22: 643–653. Bockmann, R., Dickneite, C., Goebel, W., and Bohne, J. (2000) PrfA mediates specific binding of RNA polymerase of Listeria monocytogenes to PrfA-dependent virulence gene promoters resulting in a transcriptionally active complex. Mol Microbiol 36: 487–497. Chakraborty, T., Hain, T., and Domann, E. (2000) Genome organization and the evolution of the virulence gene locus in Listeria species. Int J Med Microbiol 290: 167–174. Coleman, J.P., and Hudson, L.L. (1995) Cloning and characterization of a conjugated bile acid hydrolase gene from Clostridium perfringens. Appl Environ Microbiol 61: 2514–2520. Dalton, C.B., Austin, C.C., Sobel, J., Hayes, P.S., Bibb, W.F., Graves, L.M., et al. (1997) An outbreak of gastroenteritis and fever due to Listeria monocytogenes in milk. N Engl J Med 336: 100–105. Dashkevicz, M.P., and Feighner, S.D. (1989) Development of a differential medium for bile salt hydrolase-active Lactobacillus spp. Appl Environ Microbiol 55: 11–16. De Boever, P., Wouters, R., Verschaeve, L., Berckmans, P., Schoeters, G., and Verstraete, W. (2000) Protective effect of the bile salt hydrolase-active Lactobacillus reuteri against bile salt cytotoxicity. Appl Microbiol Biotechnol 53: 709–714. Elkins, C.A., and Savage, D.C. (1998) Identification of genes encoding conjugated bile salt hydrolase and transport in Lactobacillus johnsonii 100-100. J Bacteriol 180: 4344–4349. Franz, C.M., Specht, I., Haberer, P., and Holzapfel, W.H. (2001) Bile salt hydrolase activity of Enterococci isolated from food: screening and quantitative determination. J Food Protect 64: 725–729. Gilliland, S.E., and Speck, M.L. (1977) Deconjugation of bile acids by intestinal lactobacilli. Appl Environ Microbiol 33: 15–18. Glaser, P., Frangeul, L., Buchrieser, C., Rusniok, C., Amend, A., Baquero, F., et al. (2001) Comparative genomics of Listeria species. Science 294: 849–852. Gopal-Srivastava, R., and Hylemon, P.B. (1988) Purification and characterization of bile salt hydrolase from Clostridium perfringens. J Lipid Res 29: 1079–1085. Gouin, E., Mengaud, J., and Cossart, P. (1994) The virulence gene cluster of Listeria monocytogenes is also present in Listeria ivanovii, an animal pathogen, and Listeria seeligeri, a nonpathogenic species. Infect Immun 62: 3550–3553. © 2002 Blackwell Science Ltd, Molecular Microbiology, 45, 1095–1106

Grill, J., Schneider, F., Crociani, J., and Ballongue, J. (1995) Purification and characterization of conjugated bile salt hydrolase from Bifidobacterium longum BB536. Appl Environ Microbiol 61: 2577–2582. Grill, J.P., Perrin, S., and Schneider, F. (2000a) Bile salt toxicity to some bifidobacteria strains: role of conjugated bile salt hydrolase and pH. Can J Microbiol 46: 878–884. Grill, J.P., Cayuela, C., Antoine, J.M., and Schneider, F. (2000b) Isolation and characterization of a Lactobacillus amylovorus mutant depleted in conjugated bile salt hydrolase activity. Relation between activity and bile salt resistance. J Appl Microbiol 89: 553–563. Gunn, J.S. (2000) Mechanisms of bacterial resistance and response to bile. Microbes Infect 2: 907–913. Gupta, S., and Chowdhury, R. (1997) Bile affects production of virulence factors and motility of Vibrio cholerae. Infect Immun 65: 1131–1134. He, G., Shankar, R.A., Chzhan, M., Samouilov, A., Kuppusamy, P., and Zweier, J.L. (1999) Noninvasive measurement of anatomic structure and intraluminal oxygenation in the gastrointestinal tract of living mice with spatial and spectral EPR imaging. Proc Natl Acad Sci USA 96: 4586–4591. Jiang, J., Nakashima, T., Liu, K.J., Goda, F., Shima, T., and Swartz, H.M. (1996) Measurement of PO2 in liver using EPR oximetry. J Appl Physiol 80: 552–558. Kawamoto, K., Horibe, I., and Uchida, K. (1989) Purification and characterization of a new hydrolase for conjugated bile acids, chenodeoxycholyltaurine hydrolase, from Bacteroides vulgatus. J Biochem 106: 1049–1053. Kobashi, K., Nishizawa, I., Yamada, T., and Hase, J. (1978) A new hydrolase specific for taurine-conjugates of bile acids. J Biochem 84: 495–497. Lecuit, M., Vandormael-Pournin, S., Lefort, J., Huerre, M., Gounon, P., Dupuy, C., et al. (2001) A transgenic model for listeriosis: role of internalin in crossing the intestinal barrier. Science 292: 1722–1725. Masuda, N. (1981) Deconjugation of bile salts by Bacteroides and Clostridium. Microbiol Immunol 25: 1–11. Miettinen, M., Vuopio-Varkila, J., and Varkila, K. (1996) Production of human tumor necrosis factor alpha, interleukin6, and interleukin-10 is induced by lactic acid bacteria. Infect Immun 64: 5403–5405. Moser, S.A., and Savage, D.C. (2001) Bile salt hydrolase activity and resistance to toxicity of conjugated bile salts are unrelated properties in lactobacilli. Appl Environ Microbiol 67: 3476–3480. Niu, W., Kim, Y., Tau, G., Heyduk, T., and Ebright, R.H. (1996) Transcription activation at class II CAP-dependent promoters: two interactions between CAP and RNA polymerase. Cell 87: 1123–1134. Osawa, R., and Yamai, S. (1996) Production of thermostable direct hemolysin by Vibrio parahaemolyticus enhanced by conjugated bile acids. Appl Environ Microbiol 62: 3023–3025. Prouty, A.M., and Gunn, J.S. (2000) Salmonella enterica serovar typhimurium invasion is repressed in the presence of bile. Infect Immun 68: 6763–6769. Raibaud, O., and Schwartz, M. (1984) Positive control of transcription initiation in bacteria. Annu Rev Genet 18: 173–206.

1106 O. Dussurget et al. Renzoni, A., Klarsfeld, A., Dramsi, S., and Cossart, P. (1997) Evidence that PrfA, the pleiotropic activator of virulence genes in Listeria monocytogenes, can be present but inactive. Infect Immun 65: 1515–1518. Rocourt, J., Hof, H., Schrettenbrunner, A., Malinverni, R., and Bille, J. (1986) Acute purulent Listeria seeligeri meningitis in an immunocompetent adult. Schweiz Med Wochenschr 116: 248–251. Sambrook, J.E., Fritsch, E.K., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Schiffrin, E.J., and Blum, S. (2001) Food processing: probiotic microorganisms for beneficial foods. Curr Opin Biotechnol 12: 499–502. Schlech, W.F., III (2000) Foodborne listeriosis. Clin Infect Dis 31: 770–775. Schuhmacher, D.A., and Klose, K.E. (1999) Environmental signals modulate ToxT-dependent virulence factor expression in Vibrio cholerae. J Bacteriol 181: 1508–1514. Sheehan, B., Klarsfeld, A., Msadek, T., and Cossart, P. (1995) Differential activation of virulence gene expression by PrfA, the Listeria monocytogenes virulence regulator. J Bacteriol 177: 6469–6476. Smith, K., and Youngman, P. (1992) Use of a new integrational vector to investigate compartment-specific expression of the Bacillus subtilis spoIIM gene. Biochimie 74: 705–711.

Stellwag, E.J., and Hylemon, P.B. (1976) Purification and characterization of bile salt hydrolase from Bacteroides fragilis subsp. fragilis. Biochim Biophys Acta 452: 165– 176. Sullivan, M.A., Yasbin, R.E., and Young, F.E. (1984) New shuttle vectors for Bacillus subtilis and Escherichia coli which allow rapid detection of inserted fragments. Gene 29: 21–26. Une, M., Inoue, A., and Hoshita, T. (1996) Formation of varanic acid, 3 alpha, 7 alpha, 12 alpha, 24-tetrahydroxy5 beta-cholestanoic acid from 3 alpha, 7 alpha, 12 alphatrihydroxy-5 beta-cholestanoic acid in Bombina orientalis. Steroids 61: 639–641. Weber, A., Potel, J., Schafer-Schmidt, R., Prell, A., and Datzmann, C. (1995) Studies on the occurrence of Listeria monocytogenes in fecal samples of domestic and companion animals. Zentralbl Hyg Umweltmed 198: 117– 123. Wing, E.J., and Gregory, S.H. (2002) Listeria monocytogenes: clinical and experimental update. J Infect Dis 185: S18–S24. Yoshii, M., Une, M., Kihira, K., Kuramoto, T., Akizawa, T., Yoshioka, M., et al. (1994) Bile salts of the toad, Bufo marinus: characterization of a new unsaturated higher bile acid, 3 alpha, 7 alpha, 12 alpha, 26-tetrahydroxy-5 beta-cholest-23-en-27-oic acid. J Lipid Res 35: 1646– 1651.

© 2002 Blackwell Science Ltd, Molecular Microbiology, 45, 1095–1106