Hum Genet (2005) 117: 452–459 DOI 10.1007/s00439-005-1309-9
O RI GI N AL IN V ES T IG A T IO N
Tim Forshew Æ Colin A. Johnson Æ Shagufta Khaliq Shanaz Pasha Æ Catherine Willis Æ Rashida Abbasi Louise Tee Æ Ursula Smith Æ Richard C. Trembath Syed Qasim Mehdi Æ Anthony T. Moore Eamonn R. Maher
Locus heterogeneity in autosomal recessive congenital cataracts: linkage to 9q and germline HSF4 mutations Received: 16 December 2004 / Accepted: 15 March 2005 / Published online: 16 June 2005 Springer-Verlag 2005
Abstract Isolated (non-syndromic) congenital cataract may be inherited as an autosomal dominant, autosomal recessive, or X-linked recessive trait. Considerable progress has been made in identifying genes and loci for dominantly inherited cataract, but the molecular basis for autosomal recessive disease is less well defined. Hence we undertook genetic linkage studies in four consanguineous Pakistani families with non-syndromic autosomal recessive congenital cataracts. In two families linkage to a 38 cM region 9q13-q22 was detected. Although a locus for recessive congenital cataracts had not been mapped previously to this region, the target interval encompasses the candidate region autosomal recessive adult-onset pulverulent cataracts (CAAR). The CAAR was mapped previously to 9q13-q22, and may therefore be allelic to non-syndromic autosomal recessive congenital cataracts. The other two families did not demonstrate linkage to 9q, but both had a region of homozygosity at 16q22 containing the heat shock transcription factor 4 (HSF4) gene. The HSF4 mutations
T. Forshew Æ C. A. Johnson Æ S. Pasha Æ L. Tee Æ U. Smith E. R. Maher (&) Section of Medical and Molecular Genetics, Institute of Biomedical Research, University of Birmingham, Edgbaston, Birmingham, B15 2TT, UK E-mail:
[email protected] Tel.: +44-121-6272741 Fax: +44-121-4142538 S. Khaliq Æ R. Abbasi Æ S. Q. Mehdi Biomedical and Genetic Engineering Division, Dr. AQ Khan Research Laboratories, Islamabad, Pakistan C. Willis Æ A. T. Moore Institute of Ophthalmology, University College London, 11-43 Bath Street, London, EC1V 9EV, UK R. C. Trembath Division of Medical Genetics, Departments of Medicine and Genetics, University of Leicester, Leicester, LE1 7RH, UK
have been reported in four families with autosomal dominant cataracts and, recently, in a single kindred with autosomal recessive congenital cataract. Mutation analysis of HSF4 revealed homozygous mutations (p.Arg175Pro and c.595_599delGGGCC, respectively) in the two families. These findings confirm that mutations in HSF4 may result in both autosomal dominant and autosomal recessive congenital cataract, and highlight the locus heterogeneity in autosomal recessive congenital cataract. Keywords Cataract Æ Consanguinity Æ Mutation Æ Pakistan Æ Sequence analysis Æ HSF4
Introduction Cataracts are a major cause of blindness affecting approximately 16 million individuals worldwide and congenital cataract is a major cause of childhood blindness. The incidence of congenital cataracts is estimated to be approximately 1 per 4000 live births (Rahi and Dezateaux 2001; Wirth et al. 2002). Genetic factors play an important role in the aetiology of congenital cataract, with up to 50% of childhood cataract cases having a genetic basis. Furthermore, although the genetic basis for age related cataracts has not been defined, twin studies have demonstrated high heritability with approximately 50% of variation explained by genetic effects (at least in certain cataract subtypes) (Hammond et al. 2000). Non-syndromic familial cataracts are usually inherited as a dominant trait, whilst autosomal recessive and X-linked forms are less common (Francis et al. 2000). The genetics of cataracts are complex with extreme locus heterogeneity. Thus, over 20 genes or loci, including genes encoding the crystallins (CRYAA, CRYAB, CRYBB1, CRYBB2, CRYBA1, CRYGC and
453
CRYGD) (Litt et al. 1997, 1998; Kannabiran et al. 1998; Vicart et al. 1998; Heon et al. 1999; Stephan et al. 1999; Mackay et al. 2002), transcription factors (MAF, PITX3 and HSF4) (Semina et al. 1998; Bu et al. 2002; Jamieson et al. 2002), membrane transport proteins (MIP, CX46 and CX50) (Berry et al. 1999, 2000; Mackay et al. 1999), and the cytoskeletal protein BFSP2 (Conley et al. 2000; Jakobs et al. 2000) have been identified for autosomal dominant cataracts. However, only three loci, at 3p, 9q13-q22 and 19q13 (Heon et al. 2001; Pras et al. 2001; Riazuddin et al. 2005) and four genes (LIM2, C RYAA and recently HSF4 and GCNT2), have been implicated in autosomal recessive cataracts (Pras et al. 2000, 2002, 2004; Smaoui et al. 2004). The identification of congenital cataract genes can enhance understanding of the mechanisms of cataractogenesis, offer novel insights into the developmental biology and biochemistry of the lens, and provide candidate genes for identifying genetic factors in the pathogenesis of the more common age-related cataracts (Reddy et al. 2004). Autozygosity mapping studies in consanguineous kindreds provide a powerful strategy for mapping autosomal recessive disease genes. Furthermore, by recruiting families from a single ethnic group locus heterogeneity may be reduced. In order to further define the molecular basis for autosomal recessive congenital cataracts, we investigated four consanguineous families of Pakistani origin. Fig. 1 Pedigrees of consanguineous Pakistani families with congenital nonsyndromic autosomal recessive cataract. Families A and B map to chromosome 9q13-q22. Families C and D are mapped to chromosome 16q22 that contains the HSF4 gene
Materials and methods Patients Four consanguineous families of Pakistani origin (families A and B currently live in the UK and families C and D in Pakistan) were studied (see Fig. 1). In family A, there were four siblings with congenital cataracts. All had undergone cataract surgery so the lens phenotype could not be ascertained. Examination of affected individuals, however, did exclude other ocular and systemic abnormalities. Neither of the parents and none of the four clinically unaffected siblings had any evidence of cataracts. In family B, two siblings had undergone cataract surgery, but there was no evidence of any other ocular or systemic abnormalities. Neither the parents nor the clinically unaffected sibling had any evidence of cataracts. In family C, five siblings were diagnosed with congenital cataracts and in family D there were five affected relatives. Examination of patients from family C revealed a predominantly nuclear cataract in the mildest affected individual with additional cortical cataract in those with more severe lens opacities (see Fig. 2). Molecular genetic studies The DNA was available as indicated (numbered subjects). Informed consent was obtained from all par-
454
were consanguineous, the approach of autozygosity mapping was used. Following exclusion of linkage to known autosomal recessive cataract loci, we performed a genome wide linkage search in two affected subjects from family A and an affected individual from family B. Subsequently, three affected subjects and two unaffected siblings in family C, and three affected subjects and two unaffected siblings in family D were also studied. Four hundred microsatellite markers, spaced at 10 cM intervals, from the Research Genetics linkage mapping set Version 10, were amplified by PCR as described previously (Morgan et al. 2002). The PCR products were electrophoresed on an ABI 377 DNA Analyzer, and were analysed with Genescan Version 3.1.2 and Genotyper Version 2.5.2 software (Applied Biosystems). Collation and analysis of this data was performed using the SCAMP database system (Forshew and Johnson 2004). Mutational analysis of HSF4 was undertaken using primers flanking each exon (see Table 1). Each of the coding exons (including intron–exon boundaries) was amplified separately. The PCR products from both affected and unaffected subjects were sequenced in both directions by direct sequencing using the dideoxy chain termination method on an ABI 3730 DNA Sequencer. Sequencing data was analysed using the ABI sequencing analysis 5.0 software. Genetic linkage analysis
Fig. 2 Photographs of congenital nuclear cataract with additional cortical cataract in family C. a Individual IV:7, age 9 years, b individual IV:13, age 11 years and c individual IV:5, age 14 years
Two-point LOD scores (Zmax) for each family were calculated using the GENEHUNTER program (http:// www.hgmp.mrc.ac.uk) under the assumption of a fully penetrant autosomal recessive gene with a disease allele frequency of 0.001. In most cases, alleles for the marker loci were assumed to be codominant and to occur at equal frequencies, because population allele frequencies were not available. However, for three linked markers we genotyped 60 ethnically matched controls to demonstrate informativeness in the relevant population: the relevant heterozygosity values were D9S1781=0.804, D9S1780=0.661 and D9S1785=0.531. In addition to the proband, siblings and parents, the input files that defined the pedigree structure also included additional family members to create a first cousin consanguineous ‘‘loop’’.
Results ticipants and the relevant Local Research Ethics Committees approved the study. The DNA was isolated from blood samples by standard techniques. Linkage to LIM2, CRYAA, 3p21.3-p22.3 and the Iblood group locus was tested for by typing microsatellite markers flanking each gene (LIM2: D19S246, D19S589; CRYAA: D21S2055, D21S1411, D21S1446; short arm chromosome 3: D3S1768, D3S2409; I-blood group locus: f13a1, D6S1006). As all four families
Linkage to 9q13-q22 region Families A and B were ascertained first and after exclusion of linkage to LIM2, CRYAA, 3p21.3-p22.3 and the I-blood group locus (6p24) a genome wide scan was undertaken. Both families demonstrated linkage to an extensive region on chromosome 9. Genotyping of 35 microsatellite markers demonstrated
455 Table 1 Details of primer sequences for HSF4 mutation analysis. (Sequencies given in 5¢–3¢ direction.) All PCR reactions were performed with an annealing temperature of 60C Exon
Forward primer
Reverse primer
Product size (bp)
1 2 and 3 4 and 5 6 7 and 8 9 10 and 11 12 13
GGCAAACGCAGCACTTTC CGCTCACCCTCCTGGTC GGGAATGAGCAAAGAGGAGG TTCCTCCCTCACCTGGAAG GGAAGTGCAGGCCGAGG AGGGGTAGAGGGAGAAGTCAG TCTTGATGCATCTGGGTTCC TGTCACAGTGATTTCCCAGC CTGAAGAAAGGAGGGGGAAC
GTTCACTGACGTGGAGGGAC AAGGCAGGCAGTCCCAG GTGGAATGGGGTGTCGAG CTTGCAAGGGGACTTCTGG CCCCTACAGCCATCTGGG CTAGGAAGCTTTGTGGGCTG GACCAGAGGGCTTGACTCAG CAAGGTAGCTCAGCCCAATC CTGGACGCTTCTACAAATGC
262 437 590 205 620 355 405 204 453
a common 38 cM region of linkage in between D9S301 and D9S910 (see Fig. 3). Maximum cumulative lod scores for the two families were 3.378 at h=0 for D9S1780, D9S1843, D9S303, D9S1785, D9S1120, D9S318 and D9S1781. Comparison of alleles between the two families demonstrated identical sizes at markers D9S276, D9S1122, D9S1785, D9S167, D9S152, CAT9B12 and D9S1790 (alleles shaded in grey in Fig. 3), but different sized alleles at D9S175, D9S1123, D9S1780, D9S1843, D9S922, D9S933, D9S245, CAT9T5, D9S1111, D9S924, D9S1877, CAT9B11, CAT9B15, D9S1120, D9S249, D9S1680, D9S253, D9S318, D9S1781 and D9S1851. At D9S1785
Fig. 3 Comparison of haplotypes over common linked region (D9S301–D9S910) for family A, individual II:6 and family B, individual II:2 at chromosome 9q13-q22. The physical and genetic location of markers are based on the human genome May 2004 (hg17) assembly. Regions of the haplotypes with homozygous alleles are indicated by boxes, and alleles that are identical are shown by grey shading. The interval for the CAAR locus mapped by Heon et al. 1999 (between markers D9S1123 and D9S257) is indicated by the dashed lines. The approximate locations of GCNT1 (76.303– 76.351 Mb), RASEF (82.826– 82.907 Mb) and UBQLN1 (83.504–83.552 Mb) are also indicated
both families were fully informative and the 199 bp allele that was present in both families had a frequency of 0.05 in ethnically matched controls. The 38 cM candidate interval between D9S301 and D9S910 contains 162 known genes and encompasses a 14 cM interval (D9S1123 to D9S257, approximately 77.654–87.520 Mb), containing a locus for adult-onset pulverulent cataracts, CAAR, reported by Heon et al. (2001). On the basis that identical alleles in both families might have arisen from a founder effect, we sequenced two candidate genes within the 14 cM interval (Fig. 3). These were RASEF (described as RAS and EF hand domain containing, and also known as RAB45 at
456 Fig. 4 Selected electropherograms of members of two cataract families, C and D, with mutations in the HSF4 gene. a HSF4 p.Arg175Pro, and b HSF4 c.595_599delGGGCC
82.826–82.907 Mb), and UBQLN1 (described as ubiquilin 1 at 83.504–83.552 Mb), but we did not identify any pathogenic mutations.
Within the candidate interval, but proximal to the CAAR locus, we sequenced GCNT1, a close homologue of GCNT2. Mutations in GCNT2 have been recently
457
identified as a cause of autosomal recessive cataracts (Pras et al. 2004), but we did not identify any pathogenic changes in the two families. Germline HSF4 mutations Following the identification of linkage to 9q13-q22 in families A and B, two further consanguineous families with autosomal recessive congenital cataracts were identified. Linkage to LIM2, CRYAA, 3p21.3-p22.3, 6p24 and to 9q13-q22 was excluded in these kindreds (Zmax< 2 at h=0 for all markers tested). A genome wide scan was undertaken, and both families C and D demonstrated evidence of linkage to 16q12.2-q23.2. Further analysis demonstrated a 27 cM region of homozygosity between GATA138C05 and D16S3098 in Family C, and a 23 cM region of homozygosity between GATA138C05 and D16S3040 in Family D. Typing of additional markers defined a common 23 cM interval of homozygosity between GATA138C05 and D16S3040. A maximum two-point LOD score was obtained at D16S2624, Zmax=5.74 at h=0 (assuming equal allele frequencies of 0.2), which demonstrated significant linkage. As the common target interval contained a gene previously implicated in autosomal dominant cataracts, HSF4 mutation analysis was undertaken in the two families. A c.524G>C transversion/transition causing a non-conservative p.R175P missense substitution was identified in family C (see Fig. 4a). All affected individuals were homozygous for the R175P substitution and all at-risk individuals were heterozygous or homozygous wild type. The c.524G>C variant was not identified in 104 ethnically matched control chromosomes. Sequencing of the HSF4 exons and flanking sequences in Family D demonstrated a frameshift deletion (c.595_599delGGGCC) predicted to produce a truncated protein in the absence of nonsense-mediated decay (See Fig. 4b). All affected individuals were homozygous for the c.595_599delGGGCC mutation and unaffected family members were heterozygous for the mutation or homozygous wild type.
Discussion In order to reduce the likelihood of locus heterogeneity we undertook genetic linkage studies in four consanguineous families with the same ethnic origin. Although this revealed significant linkage to a novel locus for autosomal recessive congenital cataract at 9q13-q22 in two families, two different HSF4 mutations were discovered in the other two families. In the first two families we studied, we detected linkage to 9q. The candidate region for linkage contained the region to which Heon et al. (2001) mapped the CAAR locus in a large family from a relatively isolated region of Switzerland. In the Swiss kindred, there were eight affected individuals in one generation,
but none of their 22 children was affected. The cataract phenotype in this family was reported to be unique with mostly cortical, pulverulent (dustlike) opacity and occasional nuclear and posterior subcapsular involvement and with early nuclear sclerosis. There was progressive, but variable, opacification of the nucleus and/ or the posterior subcapsular area and cataract surgery was usually required by the age of 40 years. The candidate region for families A and B is large and contains many genes, none of which have been implicated in cataractogenesis. Furthermore, while the region has synteny with distal mouse chromosome 4, no known mouse cataract loci map to that region. Although the morphology of cataracts in families A and B is unknown, and the age of onset is clearly different from that seen in the Swiss kindred (Heon et al. 2001), the possibility remains that the two disorders are allelic. Germline CRYGD mutations, for example, can cause pulverulent (Stephan et al. 1999), nuclear (Santhiya et al. 2002), lamellar (Santhiya et al. 2002), aceuliform (Heon et al. 1999) and prismatic cataracts (Kmoch et al. 2000). It is therefore seems reasonable to consider that autosomal recessive congenital cataracts and lateronset pulverulent cataracts (CAAR) are allelic disorders. However, we also considered the possibility that the locus in our two families might not be allelic with CAAR. The genetics of familial cataracts are complex with multiple genes implicated, even for cataracts of the same morphological subtype. Thus, autosomal dominant pulverulent cataracts may be caused by mutations in at least six genes (CRYBB1 (Mackay et al. 2002), CRYBA1 (Bateman et al. 2000), CRYGC (Ren et al. 2000), CX46 (Mackay et al. 1999), CX50 (Shiels et al. 1998) and Maf (Jamieson et al. 2003)). Hence although GCNT1 maps outside the CAAR interval, we undertook mutation analysis, albeit with negative results. Although families A and B are not known to be related, the extensive sharing of alleles in the linked region strongly suggests a common founder effect. Further genotyping of families A and B may enable the target interval to be reduced further by identifying a core-conserved haplotype. The remaining two families with AR congenital cataract were found to have HSF4 mutations. The HSF4 is a member of the family of heat-shock transcription factors that bind heat shock elements and activate downstream heat-shock response genes under conditions of stress (Nakai et al. 1997). Previously four different missense mutations within the HSF4 DNA binding domain have been characterised in patients with autosomal dominant lamellar and Marner cataracts (Bu et al. 2002). During the preparation of this manuscript, Smaoui et al. (2004) reported a HSF4 homozygous splice mutation (c.1327+4A fi G causing skipping of exon 12) associated with autosomal recessive congenital cataracts. We have characterised two further mutations associated with recessive congenital cataracts. In family C, we identified a non-conservative arginine to proline missense substitution (p.R175P) within the hydrophobic
458
heptad repeats (HR-A/B) domain. The mutation segregated with the disease phenotype, was not found in normal controls and arginine 175 is conserved in chimp, mouse, rat and chicken HSF4 orthologues. The location of the mutation suggests that it will interfere with HSF4 trimerization and will affect both HSF4 isoforms (HSF4a and HSF4b). In family D, we identified a frame shift mutation (c.595_599delGGGCC). In the absence of nonsensemediated decay, this would specify a truncated protein (212 amino acids versus 492 in the wild type protein) that contained the DNA binding, HR-A and HR-B domains, but would truncate both HSF4 isoforms. The HSF4 is expressed in the human and rat lens and regulates the expression of aB-crystallin (Somasundaram and Bhat 2004). The aB-crystallin protein has chaperonelike activities (Horwitz 2003), and mutations in a Bcrystallin are associated with both isolated human cataract (Berry et al. 2001) and cataract associated with a desmin-related myopathy (Vicart et al. 1998). This suggests that the cataract seen with such mutations may be caused by a loss of chaperone function of the mutant a Bcrystallin. Disordered HSF4 function may therefore cause cataracts because of altered expression of a Bcrystallin. The HSF4 RNA and protein expression has been shown to be maximal in the lens, and although HSF4 RNA expression was also detected in the lung, muscle and small intestines, there was very little protein expression in these tissues (Somasundaram and Bhat 2004). In our small sample of Pakistani autosomal recessive congenital cataract families, we identified a novel locus for congenital cataract and identified HSF4 mutations in 50% of families. Further studies are required to confirm that HSF4 mutations are a common cause of autosomal recessive congenital cataracts in this population and to characterise the 9q13-22 susceptibility gene and its relationship to the CAAR locus. Acknowledgements We thank Birmingham United Hospitals Trust Fund and the Wellcome Trust for financial support.
References Bateman JB, Geyer DD, Flodman P, Johannes M, Sikela J, Walter N, Moreira AT, Clancy K, Spence M A (2000) A new betaa1crystallin splice junction mutation in autosomal dominant cataract. Invest Ophthalmol Vis Sci 41(11):3278–3285 Berry V, Mackay D, Khaliq S, Francis PJ, Hameed A, Anwar K, Mehdi SQ, Newbold RJ, Ionides A, Shiels A, Moore T, Bhattacharya SS (1999) Connexin 50 mutation in a family with congenital ‘‘zonular nuclear’’ pulverulent cataract of Pakistani origin. Hum Genet 105(1–2):168–170 Berry V, Francis P, Reddy MA, Collyer D, Vithana E, MacKay I, Dawson G, Carey AH, Moore A, Bhattacharya SS, Quinlan RA (2001) Alpha-B crystallin gene (CRYAB) mutation causes dominant congenital posterior polar cataract in humans. Am J Hum Genet 69(5):1141–1145 Berry V, Francis P, Kaushal S, Moore A, Bhattacharya S (2002) Missense mutations in MIP underlie autosomal dominant ‘‘polymorphic’’ and lamellar cataracts linked to 12q. Nat Genet 5(1):15–17
Bu L, Jin Y, Shi Y, Chu R, Ban A, Eiberg H, Andres L, Jiang H, Zheng G, Qian M, Cui B, Xia Y, Liu J, Hu L, Zhao G, Hayden MR, Kong X (2002) Mutant DNA-binding domain of HSF4 is associated with autosomal dominant Lamellar and Marner cataract. Nat Genet 31(3):276–278 Conley YP, Erturk D, Keverline A, Mah TS, Keravala A, Barnes LR, Bruchis A, Hess JF, FitzGerald PG, Weeks DE, Ferrell RE, Gorin MB (2000) A juvenile-onset, progressive cataract locus on chromosome 3q21-Q22 is associated with a missense Mutation in the beaded filament structural protein-2. Am J Hum Genet 66(4):1426–1431 Forshew T, Johnson CA (2004) SCAMP: a spreadsheet to collate autozygosity mapping projects. J Med Genet 41(12):e125 Francis PJ, Berry V, Bhattacharya SS, Moore AT (2000) The genetics of childhood cataract. J Med Genet 37(7):481–488 Hammond CJ, Snieder H, Spector TD, Gilbert CE (2000) Genetic and environmental factors in age-related nuclear cataracts in monozygotic and dizygotic twins. N Engl J Med 342(24):1786– 1790 Heon E, Priston M, Schorderet DF, Billingsley GD, Girard PO, Lubsen N, Munier FL (1999) The gamma-crystallins and human cataracts: a puzzle made clearer. Am J Hum Genet 65(5):1261–1267 Heon E, Paterson AD, Fraser M, Billingsley G, Priston M, Balmer A, Schorderet DF, Verner A, Hudson TJ, Munier FL (2001) A progressive autosomal recessive cataract locus maps to chromosome 9q13-Q22. Am J Hum Genet 68(3):772–777 Horwitz J (2003) Alpha-crystallin. Exp Eye Res 76(2):145–153 Jakobs PM, Hess JF, FitzGerald PG, Kramer P, Weleber RG, Litt M (2000) Autosomal-dominant congenital cataract associated with a deletion mutation in the human beaded filament protein gene BFSP2. Am J Hum Genet 66(4):1432–1436 Jamieson RV, Perveen R, Kerr B, Carette M, Yardley J, Heon E, Wirth MG, van Heyningen V, Donnai D, Munier F, Black GC (2002) Domain disruption and mutation of the BZIP transcription factor, MAF, associated with cataract, ocular anterior segment dysgenesis and coloboma. Hum Mol Genet 11(1):33–42 Jamieson RV, Munier F, Balmer A, Farrar N, Perveen R, Black GC (2003) Pulverulent cataract with variably associated microcornea and iris coloboma in a MAF mutation family. Br J Ophthalmol 87(4):411–412 Kannabiran C, Rogan PK, Olmos L, Basti S, Rao GN, KaiserKupfer M, Hejtmancik JF (1998) Autosomal dominant zonular cataract with sutural opacities is associated with a splice mutation in the betaA3/A1-crystallin gene. Mol Vis 4:21 Kmoch S, Brynda J, Asfaw B, Bezouska K, Novak P, Rezacova P, Ondrova L, Filipec M, Sedlacek J, Elleder M (2000) Link between a novel human gammad-crystallin allele and a unique cataract phenotype explained by protein crystallography. Hum Mol Genet 9(12):1779–1786 Litt M, Carrero-Valenzuela R, LaMorticella DM, Schultz DW, Mitchell TN, Kramer P, Maumenee IH (1997) Autosomal dominant cerulean cataract is associated with a chain termination mutation in the human beta-crystallin gene CRYBB2. Hum Mol Genet 6(5):665–668 Litt M, Kramer P, LaMorticella DM, Murphey W, Lovrien EW, Weleber RG (1998) Autosomal Dominant congenital cataract associated with a missense mutation in the human alpha crystallin gene CRYAA. Hum Mol Genet 7(3):471–474 Mackay D, Ionides A, Kibar Z, Rouleau G, Berry V, Moore A, Shiels A, Bhattacharya S (1999) Connexin46 mutations in autosomal dominant congenital cataract. Am J Hum Genet 64(5):1357–1364 Mackay DS, Boskovska OB, Knopf HL, Lampi KJ, Shiels A (2002) A nonsense mutation in CRYBB1 associated with autosomal dominant cataract linked to human chromosome 22q. Am J Hum Genet 71(5):1216–1221 Morgan NV, Gissen P, Sharif SM, Baumber L, Sutherland J, Kelly DA, Aminu K, Bennett CP, Woods CG, Mueller RF, Trembath RC, Maher ER, Johnson CA (2002) A novel locus for Meckel– Gruber syndrome, MKS3, maps to chromosome 8q24. Hum Genet 111(4–5):456–461
459 Nakai A, Tanabe M, Kawazoe Y, Inazawa J, Morimoto RI, Nagata K (1997) HSF4, a new member of the human heat shock factor family which lacks properties of a transcriptional activator. Mol Cell Biol 17(1):469–481 Pras E, Frydman M, Levy-Nissenbaum E, Bakhan T, Raz J, Assia EI, Goldman B, Pras EA (2000) Nonsense mutation (W9X) in CRYAA causes autosomal recessive cataract in an inbred Jewish Persian family. Invest Ophthalmol Vis Sci 41(11):3511– 3515 Pras E, Pras E, Bakhan T, Levy-Nissenbaum E, Lahat H, Assia EI, Garzozi HJ, Kastner DL, Goldman B, Frydman M (2001) A gene causing autosomal recessive cataract maps to the short arm of chromosome 3. Isr Med Assoc J 3(8):559–562 Pras E, Levy-Nissenbaum E, Bakhan T, Lahat H, Assia E, GeffenCarmi N, Frydman M, Goldman B, Pras EA (2002) Missense mutation in the LIM2 gene is associated with autosomal recessive presenile cataract in an inbred Iraqi Jewish family. Am J Hum Genet 70(5):1363–1367 Pras E, Raz J, Yahalom V, Frydman M, Garzozi HJ, Pras E, Hejtmancik JF (2004) A nonsense mutation in the glucosaminyl (N-Acetyl) transferase 2 gene (GCNT2): association with autosomal recessive congenital cataracts. Invest Ophthalmol Vis Sci 45(6):1940–1945 Rahi JS, Dezateaux C (2001) Measuring and interpreting the incidence of congenital ocular anomalies: lessons from a national study of congenital cataract in the UK. Invest Ophthalmol Vis Sci 42(7):1444–1448 Reddy MA, Francis PJ, Berry V, Bhattacharya SS, Moore A (2004) T. molecular genetic basis of inherited cataract and associated phenotypes. Surv Ophthalmol 49(3):300–315 Ren Z, Li A, Shastry BS, Padma T, Ayyagari R, Scott MH, Parks MM, Kaiser-Kupfer MI, Hejtmancik JF (2000) A 5-base insertion in the GammaC-crystallin gene is associated with autosomal dominant variable zonular pulverulent cataract. Hum Genet 106(5):531–537 Riazuddin SA, Yasmeen A, Zhang Q, Yao W, Sabar MF, Ahmed Z, Riazuddin S, Hejtmancik JF (2005) A new locus for autosomal recessive nuclear cataract mapped to chromosome 19q13 in a Pakistani family. Invest Ophthalmol Vis Sci 46(2):623–626
Santhiya ST, Shyam Manohar M, Rawlley D, Vijayalakshmi P, Namperumalsamy P, Gopinath PM, Loster J, Graw J (2002) Novel mutations in the Gamma-crystallin genes cause autosomal dominant congenital cataracts. J Med Genet 39(5):352– 358 Semina EV, Ferrell RE, Mintz-Hittner HA, Bitoun P, Alward WL, Reiter RS, Funkhauser C, Daack-Hirsch S, Murray JC (1998) A novel homeobox gene PITX3 is mutated in families with autosomal-dominant cataracts and ASMD. Nat Genet 19(2):167–170 Shiels A, Mackay D, Ionides A, Berry V, Moore A, Bhattacharya S (1998) A missense mutation in the human connexin50 gene (GJA8) underlies autosomal dominant ‘‘zonular pulverulent’’ cataract, on chromosome 1q. Am J Hum Genet 62(3):526–532 Smaoui N, Beltaief O, BenHamed S, M’Rad R, Maazoul F, Ouertani A, Chaabouni H, Hejtmancik JF (2004) A homozygous splice mutation in the HSF4 gene is associated with an autosomal recessive congenital cataract. Invest Ophthalmol Vis Sci 45(8):2716–2721 Somasundaram T, Bhat SP (2004) Developmentally dictated expression of heat shock factors: exclusive expression of HSF4 in the postnatal lens and its specific interaction with AlphaBcrystallin heat shock promoter. J Biol Chem 279(43):44497– 44503 Stephan DA, Gillanders E, Vanderveen D, Freas-Lutz D, Wistow G, Baxevanis AD, Robbins CM, VanAuken A, Quesenberry MI, Bailey-Wilson J, Juo SH, Trent JM, Smith L, Brownstein MJ (1999) Progressive juvenile-onset punctate cataracts caused by mutation of the GammaD-crystallin gene. Proc Natl Acad Sci USA 96(3):1008–1012 Vicart P, Caron A, Guicheney P, Li Z, Prevost MC, Faure A, Chateau D, Chapon F, Tome F, Dupret JM, Paulin D, Fardeau M (1998) A missense mutation in the AlphaB-crystallin chaperone gene causes a desmin-related myopathy. Nat Genet 20(1):92–95 Wirth MG, Russell-Eggitt IM, Craig JE, Elder JE, Mackey DA (2002) Aetiology of congenital and paediatric cataract in an Australian population. Br J Ophthalmol 86(7):782–786
