The long arm of chromosome 20 displays recurrent loss of het- erozygosity (LOH) for microsatellite markers in blast cells from children with acute lymphoblastic ...
Leukemia (1999) 13, 1972–1974 1999 Stockton Press All rights reserved 0887-6924/99 $15.00 http://www.stockton-press.co.uk/leu
Mapping of chromosome 20 for loss of heterozygosity in childhood ALL reveals a 1000-kb deletion in one patient N Couque1, C Chambon-Pautas1, H Cave´1,2, V Bardet1, M Duval3, E Vilmer3 and B Grandchamp1 1 3
INSERM U409 and Centre de Recherche Claude Bernard, Faculte´ de Me´decine Xavier Bichat, Paris; and 2Service de Biochimie Ge´ne´tique, Service d’He´matologie, Hoˆpital Robert Debre´, Paris, France
The long arm of chromosome 20 displays recurrent loss of heterozygosity (LOH) for microsatellite markers in blast cells from children with acute lymphoblastic leukemia. To further characterize the region of deletion and to precisely establish its frequency, we searched for LOH in 103 children with ALL using polymorphic markers in the previously described region of interest, namely between D20S101 and D20S887. LOH was detected in nine patients (ie with a frequency of 8.7%). Interestingly, in one patient, a small deletion was found, flanked proximally by D20S850 and distally by M201, a dinucleotide repeat identified from chromosome 20 sequences. The distance between these two markers is approximately 1000 kb. The occurrence of non-random deletions of the long arm of chromosome 20 has previously been observed in myeloid malignancies (myeloproliferative disorders and myelodysplastic syndromes) in 5–10% of patients. The small deletion in our patient is located within the common region of deletion of myeloproliferative disorders suggesting that a tumor suppressor gene may be the common target of the deletions in various types of hematological malignancies. Keywords: acute lymphoblastic leukemia; loss of heterozygosity; chromosome 20; microsatellite
region that is deleted on the 20q chromosomal arm in order to further localize the TSG involved in this tumor type. For this purpose, we searched for LOH in blasts from 103 patients with ALL using highly informative microsatellite markers located in the interval between D20S101 and D20S887. Patients and methods
Patients and sample collection One hundred and three children (1–14 years old) with B-lineage ALL were included in this study. Sixty-three of these patients were previously studied.5 They were not selected according to any risk factor or cytogenetic data. Karyotype studies were systematically performed at presentation (Table 1). Informed consent was obtained from the patients, their parents, or both, as appropriate. Sample collection and preparation of mononuclear cell lysate were performed as previously described.4
Introduction
Genotyping studies Acute lymphoblastic leukemia (ALL) is the most common malignancy in childhood. It is generally assumed that, like others tumors, leukemias initiate and progress as a result of a stepwise accumulation of stable genetic mutations. These mutations are thought to involve both the activation of protooncogenes and the inactivation of tumor suppressor genes (TSG). However, the usual strategy for localizing a TSG is to search for recurrent deletions.1 In childhood ALL, chromosomal regions of non-random deletions have been previously found by cytogenetics2 and molecular studies.3–5 These studies identified several such regions on 9p, 12p, 6q and 20q chromosomal arms. Little is known about the critical region involved in the 20q deletions in childhood ALL. Monosomy 20 is one of the most common monosomies in ALL with a frequency of 1–4% when it is observed as the only karyotypic abnormality in the blast cells.2,6,7 In addition, a dicentric chromosome (9;20)(p11;q11) has been reported in precursor-B lineage ALL.8–10 Altogether, these observations suggest that the long arm of chromosome 20 contains one or more genes, the loss or inactivation of which participates in leukemogenesis. A high-resolution allelotype previously performed in our laboratory revealed that the long arm of chromosome 20 displayed loss of heterozygosity (LOH) for microsatellite markers in six out of 63 patients with B-lineage ALL.4 The aim of the present study was to delineate more precisely the critical
Fifteen simple tandem repeat (STR) markers were used. D20S103 and and D20S194 map on the 20p chromosomal arm. All other markers: D20S206, D20S908, D20S435, D20S465, D20S607, D20S855, D20S99, D20S850, D20S108, D20S169, D20S911, D20S197, M201 map in the interval between D20S101 and D20S887. Primer sequences and percentages of heterozygosity were obtained from the Genome DataBase (http://gdb.infobiogen.fr), with the exception of M201. For this marker, oligonucleotides were designed as follow: M201aF, ATGATGGCTCCCTCCATACC and M201 m, GATCCTAAAGGAAATCCCAACAG. These Table 1 Karyotype of patients with molecular abnormalities on chromosome 20
Patients 5 13 18 30 49 63 70 71 73
Correspondence: B Grandchamp, INSERM U409, Faculte´ de Me´decine Xavier Bichat, BP 416, 75870 Paris cedex 18, France; Fax: (33)1 42 26 46 24 Received 10 June 1999; accepted 6 September 1999
Karyotype 46,XX [20] 46,XX[26] 53,XXYY,+6,+6,+14,+20,+21 Not available 52,XY,+6,+9,+14,+17,+21,+21 [18] 47,XX,del(1)(p14 p22),der(3),del(6)(q21)+mar 45,XX,−20,add(9)(p13)[20]/46,XX[5] 61,XY,+2,+4,+5,+6,+9,+10,+13,+15,+16,+18,+19, +20,+21,+22[10] 46,XY
Cytogenetic data from patients who displayed LOH for polymorphic marker on chromosome 20. Patients 5 to 63 were previously described5 and identical patient numbers have been used.
Mapping of chromosome 20 for loss of heterozygosity N Couque et al
delimited by D20S850 on the centromeric side and by D20S435 on the telomeric side (Figure 2). An additional dinucleotide repeat marker, M201, was identified between D20S107 and D20S435 from chromosome 20 sequences. This repeat was polymorphic and patient 49 was heterozygous for this new marker. The physical distance between D20S850 and M201 is spanned by a contig of PACs and can been estimated as approximately 1000 kb (based on a average size of 100 kb for one PAC).
Figure 1 Microsatellite analysis for patient 49. (a) DNA analysis from blast cells; (b) DNA analysis from normal cells (remission sample). The patient is heterozygote for all three markers, one allele of D20S107 is lost in blast cells (arrow) while heterozygosity is maintained for the two flanking markers (D20S850 and M201).
sequence data were produced by the Human Chromosome 20 Sequencing Group at the Sanger Center (ftp://ftp.sanger.ac.uk/pub/). PCR and analysis of amplified products were carried out as previously described.4 Results
Loss of heterozygosity mapping on the 20q chromosomal arm Two polymorphic markers localized on the 20p chromosomal arm and 13 polymorphic markers situated between D20S101 and D20S887 on the 20q chromosomal arm were analyzed by PCR in B-lineage childhood ALLs. For each patient results obtained with blast DNA were compared with corresponding matched normal cells. The PCR/electrophoresis data for patient 49 are illustrated in Figure 1. LOH was detected for at least one marker in nine out of 103 patients, three of whom had not previously been studied. In five cases, patients had LOH for all the markers of chromosome 20, indicating that loss of genetic material involved the entire chromosome (Figure 2). In three cases, LOH was limited to the chromosomal 20q arm (patients 13, 63 and 73, Figure 2). In one case, LOH was limited to a single marker (D20S107) (patient 49, Figure 2). For this patient, the minimal region of LOH was
Parental origin of LOH The parental origin of the alleles that were lost was revealed for three patients by genotyping DNA from their parents. Blast cells from patients 30 and 73 had lost alleles of paternal origin; blasts from patient 49 had lost the maternal allele (Table 2). Discussion Allelotype studies performed in our laboratory had shown that LOH is detected for chromosome 20 markers in a significant proportion of children with B-lineage ALLs.4 We analyzed 13 new STR markers in paired samples from 103 children with ALL. In these series, the overall frequency of LOH was 8.7%. This frequency is much higher than the average rate of LOH found in this type of disorder.4 The occurrence of non-random deletions of the long arm of chromosome 20 has been observed in myeloid malignancies (myeloproliferative disorders and myelodysplastic syndromes) in 5–10% of patients.11,12 The present study shows that a 20q deletion is also present in childhood B-lineage at a frequency similar to that seen in myelodysplastic syndromes or acute myeloblastic leukemia. A non-random abnormality, such as the 20q deletion, observed in myeloid as well as in lymphoid disorders, can occur in a multipotent precursor of both myeloid and B cells. Indeed, several studies clearly demonstrate that the 20q deletion can arise in an early progenitor, with both myeloid and lymphoid potential.13–15 Patient 49 displayed LOH for only the D20S107 marker, thus limiting the minimal region of LOH between markers D20S908 and M201. The physical distance between these two markers is estimated as 1000 kb. Recent studies have succeeded in delimiting the common region of deletion (CRD) in myeloid disorders with a 20q deletion. In one study, the CRD for myeloproliferative disorders was narrowed down to a region spanning approximately 8 Mb, between D20S206 and D20S424.16 In another study, it was mapped between D20S908 and D20S17 (8– 9 Mb) for myeloproliferative disorders and between D20S465 and D20S991 (7–8 Mb) for myelodysplastic syndromes.17 The small deletion in our patient 49 is included in the CRD of myeloproliferative disorders; however, it is different from that of myelodysplastic syndromes. Whether or not the same gene Table 2
Figure 2 Schematic representation of LOH in childrens who displayed LOH for polymorphic markers on chromosome 20. Underlying markers are polymorphic markers analyzed in this present study. (䊊) heterozygous, ( ) non-informative, (䊉) loss of heterozygosity. CRD: common region of deletion.
Parental origin of the alleles that were lost in blasts
Patients
D20S103 D20S908
D20S107
D20S109
D20S171
30 73 49
Paternal
Paternal Paternal Maternal
ND Paternal
Paternal Paternal
NI Paternal
NI, non-informative; ND, not done.
1973
Mapping of chromosome 20 for loss of heterozygosity N Couque et al
1974
is involved in ALL and myeloid malignancies has still to be verified. EHT, a member of the MTG8/ETO gene family recently mapped on the 20q11 chromosomal region was homozygously deleted in several cases of acute myeloid leukemias.18 Therefore, it was proposed as a candidate tumor suppressor gene. However, we found that this gene was not present on a YAC contig spanning the small deletion found in our patient with ALL (data not shown). Asimakopoulos and Green19 hypothesized that a ‘one hit’ model could account for the complete loss of function of a putative TSG on the 20q chromosomal arm, assuming that this TSG was expressed from only one allele. Our present data argue against a parental imprinting mechanism since, from three cases studied, LOH involved the paternal chromosome in two cases and the maternal one in the third case. Therefore, the ‘two hit’ model with inactivation of one copy of the gene by genetic alteration followed by loss of the second copy by deletion is still the most likely hypothesis.
7 8
9
10
11 12
Acknowledgements 13
This work was supported by INSERM, Universite´ Paris 7, Association Claude Bernard and The Association pour la Recherche sur le Cancer (ARC). 14
References 15 1 Lasko D, Cavenee W, Nordenskjold M. Loss of constitutional heterozygosity in human cancer. Annu Rev Genet 1991; 25: 281– 314. 2 Johansson B, Mertens F, Mitelman F. Cytogenetic deletion maps of hematologic neoplasms: circumstantial evidence for tumor suppressor loci. Gene Chromosome Cancer 1993; 8: 205–218. 3 Cave´ H, Guidal C, Elion J, Vilmer E, Grandchamp B. A low rate of loss of heterozygosity is found at many different loci in childhood B-lineage acute lymphocytic leukemia. Leukemia 1996; 10: 1486–1491. 4 Chambon-Pautas C, Cave´ H, Ge´rard B, Guidal-Giroux C, Duval M, Vilmer E, Grandchamp B. High-resolution allelotype analysis of childhood B-lineage acute lymphoblastic leukemia. Leukemia 1998; 12: 1107–1113. 5 Takeuchi S, Bartram CR, Wada M, Reiter A, Hatta Y, Seriu T, Lee E, Miller CW, Miyoshi I, Koeffler HP. Allelotype analysis of childhood acute lymphoblastic leukemia. Cancer Res 1995; 55: 5377–5382. 6 Betts DR, Kingston JE, Dorey EL, Young BD, Webb D, Katz FE, Gibbons B. Monosomy 20: a non-random finding in childhood
16
17
18
19
acute lymphoblastic leukemia. Genes Chromosome Cancer 1990; 2: 182–185. Silengo M, Vassallo E, Barisone E, Miniero R, Madon E. Monosomy 20 in childhood acute lymphoblastic leukemia. Cancer Genet Cytogenet 1992; 59: 177–179. Heerema NA, Maben KD, Bernstein J, Breitfeld PP, Neiman RS, Vance GH. Dicentric (9;20)(p11;q11) identified by fluorescence in situ hybridization in four pediatric acute lymphoblastic leukemia patients. Cancer Genet Cytogenet 1996; 92: 111–115. Slater R, Smit E, Kroes W, Bellomo MJ, Muhlematter D, Harbott J, Behrendt H, Hahlen K, Veerman AJ, Hagemeijer A. A non-random chromosome abnormality found in precursor-B lineage acute lymphoblastic leukaemia: dic(9;20)(p1?3;q11). Leukemia 1995; 9: 1613–1619. Rieder H, Schnittger S, Bodenstein H, Schwonzen M, Wormann B, Berkovic D, Ludwig WD, Hoelzer D, Fonatsch C: dic(9;20): a new recurrent chromosome abnormality in adult acute lymphoblastic leukemia. Genes Chromosome Cancer 1995; 13: 54–61. Mitelman F, Mertens F, Johansson B. A breakpoint map of recurrent chromosomal rearrangements in human neoplasia. Nat Genet 1997; 15: 417–474. Nacheva E, Holloway T, Carter N, Grace C, White N, Green AR. Characterization of 20q deletions in patients with myeloproliferative disorders or myelodysplastic syndromes. Cancer Genet Cytogenet 1995; 80: 87–94. Knuutila S, Teerenhovi L, Larramendy ML, Elonen E, Franssila KO, Nylund SJ, Timonen K, Mahlamaki E, Winqvist R, Ruutu T. Cell lineage involvement of recurrent chromosomal abnormalities in hematologic neoplasms. Genes Chromosome Cancer 1994; 10: 95–102. White NJ, Nacheva E, Asimakopoulos FA, Bloxham D, Paul B, Green AR. Deletion of chromosome 20q in myelodysplasia can occur in a multipotent precursor of both myeloid cells and B cells. Blood 1994; 83: 2809–2816. Hollings PE, Benjes SM, Rosman I, Fitzgerald PH. Deletion 20q in association with Philadelphia chromosome positive acute lymphoblastic leukemia: report of two cases. Cancer Genet Cytogenet 1995; 79: 32–35. Wang PW, Iannantuoni K, Davis EM, Espinosa R III, Stoffel M, Le Beau MM. Refinement of the commonly deleted segment in myeloid leukemias with a del(20q). Genes Chromosome Cancer 1998; 21: 75–81. Bench AJ, Aldred MA, Humphray SJ, Champion KM, Gilbert JG, Asimakopoulos FA, Deloukas P, Gwilliam R, Bentley DR, Green AR. A detailed physical and transcriptional map of the region of chromosome 20 that is deleted in myeloproliferative disorders and refinement of the common deleted region. Genomics 1998; 49: 351–362. Fracchiolla NS, Colombo G, Finelli P, Maiolo AT, Neri A. EHT, a new member of the MTG8/ETO gene family, maps on 20q11 region and is deleted in acute myeloid leukemias. Blood 1998; 92: 3481–3484. Asimakopoulos FA, Green AR. Deletions of chromosome 20q and the pathogenesis of myeloproliferative disorders. Br J Haematol 1996; 95: 219–226.
