Biometals DOI 10.1007/s10534-011-9456-z
Mechanisms underlying the protective effect of zinc and selenium against cadmium-induced oxidative stress in zebrafish Danio rerio Mohamed Banni • Lina Chouchene • Khaled Said Abdelhamid Kerkeni • Imed Messaoudi
•
Received: 29 July 2010 / Accepted: 20 April 2011 Ó Springer Science+Business Media, LLC. 2011
Abstract The present study was designed to elucidate the protective effect mechanism of Zinc (Zn) and Selenium (Se) on cadmium (Cd)-induced oxidative stress in zebrafish. For this purpose we investigate the response of oxidative stress markers, metallothionein accumulation and gene expression in liver and ovary of female zebrafish exposed to 0,4 mg/l Cd in water and supplemented with Zn (5 mg kg-1) and/or Se (2 mg kg-1) for 21 days in their diet. Liver and ovary Cd uptake was evaluated after the exposure period. Cd exposure significantly inhibited the antioxidant enzyme activities termed as catalase (CAT), superoxide dismutase (SOD) and glutathione peroxydase (GPx) and caused a pronounced malondialdehyde (MDA) accumulation in both organs. Co-administration of Zn and Se reversed the Cd-induced toxicity in liver and
ovary measured as MDA accumulation. Interestingly, gene expression patterns of Cat, CuZnSod and Gpx were up-regulated when related enzymatic activities were altered. Zebrafish metallothionein transcripts (zMt) significantly decreased in tissues of fish supplemented with Zn and/or Se when compared to Cd-exposed fish. Our data would suggest that Zn and Se protective mechanism against Cd-induced oxidative stress is more depending on the correction of the proteins biological activities rather than on the transcriptional level of related genes. Keywords Oxidative stress Gene expression Cd Zn Se Zebrafish Protective effect
Introduction M. Banni (&) Laboratoire de Biochimie et Toxicologie de l’Environnement (UR04AGR05), ISA, Chott-Mariem, 4042 Sousse, Tunisia e-mail:
[email protected] L. Chouchene K. Said I. Messaoudi Unite´ de Recherche: Ge´ne´tique, Biodiversite´ et Valorisation des Bioressources, Institut Supe´rieure de Biotechnologie de Monastir, Monastir, Tunisia A. Kerkeni De´partement de Biophysique, Faculte´ de Me´decine de Monastir, Unite´ de Recherche: Ele´ments Traces, Radicaux Libres, Antioxydants, Pathologies Humaines et Environnement, Monastir, Tunisia
Cadmium (Cd) is a highly toxic and widely spread pollutant that may cause adverse harmful effects. It has no known biological function, and prolonged exposure causes long-term toxic effects to humans and animals. Mainly because of its low rate of excretion from the body, Cd has a long biological half-life and accumulates over time in blood, kidney, and liver (EPA Agency EP 2004) as well as in the reproductive organs (Piasek et al. 2001; Bonda et al. 2004). The molecular mechanism responsible for the toxic effects of Cd is far from being completely
123
Biometals
understood. However, various studies connect Cd with oxidative stress since this metal can alter the antioxidant defense system in several tissues of several animals, causing a depletion in the levels of reduced glutathione, as well as an alteration in the activity of antioxidant enzymes, and a change in the structure of the cellular membrane through a process of lipid peroxidation (Cuypers et al. 2010). Therefore, it is reasonable to assume that antioxidant agents (enzymatic and non-enzymatic) may prevent or at least reduce the Cd toxicity. Se and Zn are well-established antioxidants. Se was recognized as an essential trace element within a relatively low concentration range and its physiological role was established when it was shown to be one of the glutathione peroxidase (GPx) components (Rotruck et al. 1973). Zn can act as an antioxidant since it is an essential component of Cu/Zn–SOD. Zn can also indirectly function as an antioxidant by inducing the synthesis of metallothionein (MT), a thiol-rich protein which can act by binding metals with pro-oxidant activity such as Cd and by providing thiol groups which can scavenge hydroxyl radicals and singlet oxygen (Dondero et al. 2005). The treatment with Se or Zn during Cd exposure has been demonstrated to have protective effects on Cd-induced toxicity in various organs and tissues such as liver, kidney, skeleton, and blood (Yiin et al. 1999; Hu et al. 2004). Using the rat as a model, our group found that the combined treatment with Se and Zn was more effective than that with either of them alone in reversing Cd-induced oxidative stress in kidney (Messaoudi et al. 2009), liver (Jihen et al. 2009; Banni et al. 2010) and erythrocytes (Messaoudi et al. 2010a, b). However, the exact mechanism behind these protective effects remains largely unexplored. On the other hand, molecular studies have indicated that aberrant gene expression can be an important factor in Cd-induced toxicity, but no information about Zn and Se effects on Cd-induced changes in the antioxidative enzymes genes expression, such as Sod, Cat and Gpx genes are available. Fish are particularly sensitive to water contamination and pollutants may impair many physiological and biochemical processes when assimilated by fish tissue. Due to the genomic resources available for zebrafish and the long experience with this organism in toxicity testing, it is easily possible to establish
123
biochemical and molecular endpoints for effects assessment (Liu and We 2007). Additionally, the zebrafish model offers a number of technical advantages including ease and cost of maintenance, rapid development and high fecundity (Segner 2008). Therefore, this study was conducted to provide new insights into the mechanism of reversing Cd-induced oxidative stress by Se and Zn. For this purpose a toxicity test was carried out to investigate Cd accumulation and metal-mediated oxidative stress responses in liver and ovaries of mature female zebrafish to chronic Cd exposure in presence of Zn and/or Se. The activities of SOD, CAT, GST, and the levels of MDA and MTs were used as oxidative stress biomarkers and specific response to Cd exposure. Moreover the transcriptional changes in zMt and a set of antioxidant genes, including Cat, CuZn-Sod and Gpx were investigated.
Materials and methods Chemicals Cadmium chloride (CdCl2) was obtained from Merck (Darmstadt, Germany). Sodium selenite (Na2SeO3) and Zn chloride (ZnCl2) were purchased from Sigma, St. Louis, MO, USA. All other chemicals were of analytical grade and were purchased from standard commercial suppliers. Experimental fish Healthy 6-month adult female fish were selected and kept in aquaria. In each aquarium, water was pumped continuously over a biofilter column at the rate of 4 l/min. The water was continuously aerated throughout the experiment. Prior to exposure experiments, the fish were acclimatized in a tank filled with water at ambient temperature (25 ± 1°C) for 1 week, with a photoperiod consisting of 14-h light/10-h dark segments for each day. The fish were fed twice a day with tetramin (free of Cd). Female (weight 0.92 ± 0.18 g and 4.1 ± 0.34 cm length) fish were randomly selected for exposure experiments. There were no statistically significant differences in body weight or length at the beginning of exposure (data not shown).
Biometals
Fish exposure and sample collection Fish were divided into 5 groups (n = 40 animals). The control group was maintained in clean water and was fed twice a day with ‘‘tetramin’’ (Diet I). In the second group, Cd was added in water at a concentration of 0.4 mg l-1 as CdCl2 and animals were fed using Diet I. In the third group fish were exposed to Cd and fed with control diet supplemented with 5 mg kg-1 Zn as (ZnCl2) (Diet II). In the fourth group fish were exposed to Cd and fed with control diet supplemented with 2 mg kg-1 Se as (Na2SeO3) (Diet III). Finally, in the fifth group animals were exposed to Cd and fed with control diet supplemented with 2 mg kg-1 Se as (Na2SeO3) and 5 mg kg-1 Zn as (ZnCl2) (Diet IV). In all conditions fish were fed twice a day to apparent satiation for 3 weeks. Water and exposure solutions were renewed every day and the proven exposure concentration for Cd was verified. The Cd tested concentration represented the 1/10 of the acute toxicity LC50 (for 96 h) (Canton and Slooff 1982). Previous studies showed that Zn and Se supplementation lower than 20 and 3 mg kg-1 diet had positive effects on animal growth and feed conversion rate and did not produce adverse effects in fish (Watanabe et al. 1997; Hamilton 2003). Thus, in the present study, the chosen Zn and Se levels (5 and 2 mg kg-1 diet respectively) would not cause toxic effects. Before dissection, the fish were anesthetized on ice. The livers and ovaries excised from the fish in each exposure aquarium were randomly divided into three samples: at least four fish were collected as one sample, resulting in four pooled samples for biochemical analysis; and four other samples were pooled for RNA extraction and finally other set of samples was used for Cd determination. These samples were kept on dry ice while being prepared and then stored at -80°C until they were analyzed. No fish died during the course of the exposure. Cadmium analysis Hepatic and ovary tissues for Cd analyses were ovendried (60°C) to constant weight. The dried tissues (100 mg pool from 4 animals) were digested with 3 ml trace pure nitric acid at 90°C for 24-48 h. The volume was then adjusted to 5 ml with deionized
water. These measures were implemented using a Zeenit 700-Analytik-Jena, Germany (Graphite-Furnace AAS), equipped with deuterium and Zeeman background correction, as recommended by the manufacturer. Detection limit was 0.002 lg/l for Graphite-Furnace AAS. The accuracy and precision of our analysis for tissue metals content were based on the analysis of Cd in a standard reference fish liver. Our results show that the analytical results of this study are of satisfactory quality. Samples were analyzed in triplicate. The variation coefficient was usually less than 10%. Concentrations of the metal in the liver and ovary were calculated on a dry weight basis and expressed as lg per gram dry tissue. Biochemical assays The tissue homogenates were obtained in 0.1 M sodium phosphate buffer pH 7.0 at a ratio of 1:10w/v. Homogenizations were carried out at 4°C followed by centrifugation at 12,0009g for 30 min at 4°C. The supernatants were collected and used to evaluate enzymatic (SOD, CAT, GPx) activities and MDA accumulation. Total protein content in the homogenate was measured following the Bradford method (Bradford 1976), at 595 nm, using bovine serum albumin as standard. CAT activity was determined according to Aebi (1974) by following the consumption of 15 mM H2O2 at 240 nm in 50 mM KH2PO4/K2HPO4 buffer, pH 7.0 and 50 ll supernatant. One unit of CAT activity was defined as the amount of enzyme required to consume 1 lmol H2O2 in 1mn and was expressed as U/mg protein. The total SOD activity measurement was determined based on the ability of the enzyme to inhibit the reduction of nitro blue tetrazolium (NBT) (Crouch et al. 1981), which was generated by 37.5 mM hydroxylamine in alkaline solution. The assay was performed in a 0.5 M sodium carbonate buffer (pH 10.2) with 2 mM EDTA and 10ll aliquot of the supernatant. The reduction of NBT by superoxide anion to blue formazan was measured at 560 nm. The SOD activity was calculated as relative to its ability to inhibit 50% reduction of NBT per 1mn and expressed as U/mg protein. The Se-dependent GPx activity was analyzed according to the method described by Hafeman et al. (1974). GPx degrades H2O2 in the presence of GSH thereby depleting it. The remaining GSH is then measured by
123
Biometals
using 5.50 -dithiobis 2-nitrobenzoic acid (DTNB). The reaction was carried out at 37°C in a medium containing 80 mM sodium phosphate buffer (pH 7.0), 80 mM EDTA, 1 mM NaN3, 0.4 mM GSH and 0.25 mM H2O2 and 10 ll supernatant of tissue homogenates. Absorbance was recorded at 412 nm. One unit of GPx enzyme activity was defined as 1 lmole of GSH consumed/min. The GPx activity was expressed in U/mg of protein. Lipid peroxidation was estimated in terms of thiobarbituric acid reactive species with use of 1,1,3,3- treaethyloxypropane as a standard. The reaction was determined at 532 nm using thiobarbituric acid reagent as per the method of Buege and Aust (1978). Malondialdehyde (MDA) content was expressed as nmoles equivalent MDA per milligram protein. MT protein levels in liver and ovary were determined using a spectrophotometric assay for MT using Ellman’s reagent (0.4 mM 5,5’ Dithio-Nitro-Benzoate (DTNB) in 100 mM KH2PO4) at pH 8.5 in a solution containing 2 M NaCl and 1 mM EDTA (Viarengo et al. 1997). In brief, aliquots were homogenized in three volumes of 0.5 M sucrose, 20 mM Tris–HCl buffer, pH 8.6, with added 0.006 mM leupeptine, 0.5 mM PMSF (phenylmethylsulphonyl_fluoride) as antiproteolitic and 0.01% 2-mercaptoethanol as reducing agent. The homogenate was then centrifuged at 15,0009g for 30mn at 4°C. The obtained supernatant was treated with ethanol/chloroform as described by Viarengo et al. (1997) in order to obtain the MT enriched pellet. The obtained MT pellet was resuspended in HCl/EDTA in order to remove metal cations still bound to the MT. Finally, 2 M NaCl was added to the solution to facilitate thiol interactions with DTNB by reducing the interaction of divalent metals with the apothionein. Gene expression analysis RNA isolation and cDNA synthesis Total RNA was extracted from about 10 mg frozen liver or ovary tissues using the Trizol reagent (SigmaAldrich, St. Louis, USA) according to the manufacture instruction. The RNA purity was verified by the OD260/OD280 absorption ratio ([1.8). RNA quality was verified by comparing 18S and 28S peaks on electropherograms for each samples tested. Only intact RNA was used for further analysis. A total amount of
123
1.5–2 lg of total RNA was reverse transcribed in a 20 ll reaction mixture using random hexamers primers (Roche) and 200 U of M-MuLV H- RT (Fermentas, Vilnius, LI), 0.5 mM dNTPs (Roche), 19 M-MulV RT buffer as described in Dondero et al. (2005). Briefly, the RNA was denatured by heating for 5 min at 70°C, cooled on ice, and incubated with reverse transcriptase reaction mixture. For reverse transcription, tubes were incubated at 42°C for 60 min, followed by rapid cooling. The volume of the RT mixture was raised to 100 ll with nucleasefree distilled water, and 6 ll was used for amplification of the gene targets. Real-time quantitative PCR Real-time quantitative PCR (RT-qPCR) was performed in a real time apparatus (iCycler, Bio-Rad Laboratories), in the presence of 19 QuantiTect Sybr Green PCR Master Mix (Qiagen), 10 nM fluorescein, 0.2 lM of each gene Q-PCR primers (Table 1). Relative expression data were geometrically normalized on 18S rRNA and a beta Actin gene RNA. 18S and beta Actin were chosen as internal reference genes based on their good average expression stability as previously reported by Tang et al. (2007) and McCurley and Callard (2008) in zebrafish tissues. The relative expression stability of the two reference genes was calculated in our experimental conditions using geNorm (Vandesompele et al. 2002). Our data showed expression stability values of 0.32 and 0.44, respectively for beta actin and 18S targets. The thermal protocol was as follows: 10 min at 95°C, followed by 40 cycles (10 s at 95°C, 20 s at 60°C, 30 s at 72°C where the signal was acquired). All primers were confirmed to produce only one gene product based on a single peak in the melting curve (60–90°C) and a single band of the predicted size detected on agarose gels in preliminary studies. All amplifications had a PCR efficiency value between 1.92 and 2.10. RT-qPCR reaction was performed in triplicate for each sample and a mean value used to calculate mRNA levels. Five biological replicates were measured for each group. Statistics To calculate the normalised relative gene expression levels (fold induction), data were analysed using the
Biometals Table 1 Nucleotide sequences of gene-specific primers for real-time PCR with their corresponding PCR product size of b actin, 18S, zMt, Zn-Sod, Cat and Gpx in zebrafish
Gene
Accession number
Primers(50 -30 )
Amplicon size (bp)
b actin
AF057040
ATGGATGAGGAAATCGCTGCC
106
CTCCCTGATGTCTGGGTCGTC 18S
BX296557
CGGAGGTTCGAAGACGATCA
150
TCGCTAGTTGGCATCGTTTATG zMt
NM_194273.1
Zn-Sod
Y12236
GTCGTCTGGCTTGTGGAGTG
113
AF170069
TGTCAGCGGGCTAGTGCTT AGGGCAACTGGGATCTTACA
499
GCCAAGACTGGAACTTGCAAC
130
CGCAGCCAGAGGCACACT
Cat
TTTATGGGACCAGACCTTGG Gpx
AW232474
AGATGTCATTCCTGCACACG
94
AAGGAGAAGCTTCCTCAGCC
Relative expression software tool (REST), in which the mathematical model used is based on mean threshold cycle differences between the sample and the control group (Pfaffl et al. 2002). For each analysed target it has been used the median PCR efficiency value obtained from at least 4 different experiments (3 replicate per experiments). REST was also utilized to perform a randomisation test with a pair-wise reallocation in order to assess the statistical significance of the differences in expression between the control and treated samples. For metal accumulation and biochemical data, data were analyzed by calculating mean and the standard error of the mean (SEM), and Mann–Whitney’s test was applied after a Bonferroni correction to find the statistical significance. Data were considered statistically significant at P \ 0.05 level.
Results Liver and ovary Cd content The liver and ovaries Cd contents after 3 weeks exposure to 0,4 mg/l Cd in the water are reported in Fig. 1. Our data indicated a significant (P \ 0.01) accumulation of Cd in the liver (Fig. 1a) in comparison to control fish. While Se supply was not effective in changing Cd accumulation pattern in liver, the Zn supply induced a significant increase in the levels of Cd uptake (14.26 ± 2.22 lg/g dry weight) when compared with the levels of the Cd group (8.06 ± 0.99 lg/g dry weight). The simultaneous administration of Se and
Zn resulted in a important accumulation of Cd (15.93 ± 1.94 lg/g dry weight) when compared to Cd-treated animals. The accumulation pattern in ovaries (Fig. 1b) was completely different from that observed in liver. Indeed, Zn supply rendered a significant decrease in the levels of Cd uptake (0.84 ± 0.12 lg/g dry weight) when compared to the Cd group (2.24 ± 0.41 lg/g dry weight). Moreover, the concomitant supply of Zn and Se resulted in a more pronounced decreased in ovaries Cd uptake (0.61 ± 0.081 lg/g dry weight). Effect of Zn and Se supply on antioxidant enzymes The antioxidant enzymes activities in the liver and ovaries of zebrafish exposed to Cd and supplemented with Zn and Se are reported in Fig. 2. Our results indicated a significant decrease in CAT, SOD and GPx activities in liver and ovaries of Cd-exposed fishes. Zn supply was effective in recovering CAT and SOD activities to control values in the investigated tissues of Cd-exposed animals. Se supply was only effective in recovering GPx activities to control values in Cd exposed fishes. The concomitant supply of Zn and Se resulted in a normalization of CAT, SOD and GPx activities in liver and ovaries. Effect of Zn and Se supply on lipid peroxidation The liver and ovaries TBA-reactive metabolites contents after 3 weeks exposure to 0.4 mg/l Cd in the water are reported in Fig. 3. Our data suggest a
123
Biometals
µg/g dry weight
18
A
16 14 12
a a
10
3
ab
ab
8 6 4
µg/g dry weight
20
B
a a
2,5 2 1,5 ab
1
ab
0,5
2 0
0 Control
Cd
Cd/Zn
Cd/Se Cd/Zn/Se
Control
Cd
Cd/Zn
Cd/Se Cd/Zn/Se
Fig. 1 Cadmium concentrations in the liver (a) and ovary (b) of female zebra fish exposed to Cd (0.4 mg/l) and supplemented with Zn and/or Se in their diet, during 3 weeks.
Each bar represents mean ± SE of 10 animals. Statistically significant differences: aP \ 0.01 in comparison with control. b P \ 0.01 in comparison with Cd group
strong increase of TBA-reactive metabolites accumulation in Cd-exposed fishes with respectively 1.84 ± 0.09 nmole/mg proteins and 1.14 ± 0.12 nmole/mg protein in liver and ovaries when compared with control animals (0.82 ± 0.07 nmole/mg proteins and 0.59 ± 0.06 nmole/mg proteins respectively in liver and ovaries). Zn or Se single supply, only partially reversed this increase. In fact, TBA-reactive metabolites concentrations in the Cd ? Zn and Cd ? Se groups was lower than in the Cd-exposed group (P \ 0.01) but still significantly higher than in the control animals (P \ 0.01). However, co-supply of Zn and Se was effective in reversing Cd-induced increase in liver and ovaries TBA-reactive metabolites concentrations.
exposed to Cd ? Zn ? Se when compared to control animals.
Effect of Zn and Se supply on total metallothionein accumulation Total metallothionein protein content was evaluated in the liver and ovaries of zebrafish exposed to Cd and supplemented with Zn and Se (Fig. 4). A significant increase in MT levels in comparison with to the control animals was registered in Cd-exposed fish with up to 97.26 ± 6.79 ng/mg proteins (2.76 fold increase) in liver and 46.71 ± 4.37 ng/mg proteins (2.23 fold increase) in ovaries. The increase of the MT content in animals supplemented with Zn, Se and their mixture was less pronounced than that of Cd (1.87, 2.07 and 1.62 fold respect to control animals) in the liver. The same pattern was observed in the ovaries of fishes supplemented with Zn or Se (1.42 and 1.52 fold increase respect to control animals). No significant variation of the MTs accumulation was registered in the ovaries of zebrafish
123
Effect of Zn and Se supply on mRNA expression Expression analysis of various genes (Cat, CuZn– SOD, Gpx, Mt) encoding antioxidant proteins and metallothionein was performed by real time quantitative PCR on liver and ovaries transcripts using 18S and beta actin as reference genes (Fig. 5). A significant increase in Mts (13.61 folds), Cat (6.35 folds), CuZn-Sod (5.41 folds) and Gpx (3.64 folds) transcription was observed in liver of Cd-exposed fishes when compared to control animals. The same pattern, but with lesser extend was observed in ovaries with an induction of 4, 2.70, 2.38 and 1.92 folds, respectively for Mts, Cat, CuZn–SOD and Gpx. Single Zn supply resulted in a decrease in CuZn-Sod and zMt in liver and ovaries when compared to Cdexposed fishes. Interestingly, the transcription of the antioxidant targets manifests values similar to control when fishes are supplemented with Zn and Se in both investigated organs. In deed no significant differences in genes expression was recorder in that condition. Concerning zMt mRNA abundance in liver and ovaries, our data indicate a decreasing trend of gene expression in presence of Zn or Se and a return to control values when the two elements are co-supplemented.
Discussion In this study we have presented data concerning a set of antioxidant enzyme activities, metallothionein
Biometals ab
A
100
ab
a
a
80
140
CAT U/mg proteins
CAT U/mg proteins
120
60 40 20
Control
Cd/Zn
b a
a
25 20 15 10
0
60 40 20
Cd
Cd/Zn
Cd/Se Cd/Zn/Se
E
ab
25
b
20
b
a 15 10 5 0
Cd
Cd/Zn
Cd/Se Cd/Zn/Se
C
b
40
b
35 30
Control 40
GPx U/mg proteins
Control
GPx U/mg proteins
ab
80
30
5
a
a
25 20 15 10
Cd
Cd/Zn
Cd/Se Cd/Zn/Se
ab
F b
35 30
a
25 20 15 10 5
5 0
0 Control
Cd
Cd/Zn
Cd/Se Cd/Zn/Se
Control
a
1,5
2,0
ab
ab
b
1,0
0,5
0,0
MDA nmole/mg proteins
A
Cd
Cd/Zn
Cd/Se Cd/Zn/Se
of 10 animals. Statistically significant differences: aP \ 0.01 in comparison with control. bP \ 0.01 in comparison with Cd group
Fig. 2 Activities of CAT (a, d), SOD (b, e) and GPx (c, f) in the liver (a, b and c) and ovary (d, e and f) of female zebrafish exposed to Cd (0.4 mg/l) and supplemented with Zn and/or Se in their diet, during 3 weeks. Each bar represents mean ± SE
MDA nmole/mg proteins
a
Control
ab
B
30
2,0
ab
100
Cd/Se Cd/Zn/Se
SOD U/mg proteins
SOD U/mg proteins
Cd
35
45
ab
0
0
40
D
120
B
1,5
a ab
1,0
ab b
0,5
0,0 Control
Cd
Cd/Zn
Cd/Se Cd/Zn/Se
Fig. 3 MDA contents in the liver (a) and ovary (b) of female zebrafish exposed to Cd (0.4 mg/l) and supplemented with Zn and/or Se in their diet, during 3 weeks. Each bar represents
Control
Cd
Cd/Zn
Cd/Se Cd/Zn/Se
mean ± SE of 10 animals. Statistically significant differences: a P \ 0.01 in comparison with control. bP \ 0.01 in comparison with Cd group
123
Biometals
A
60
a
100 80
ab
ab ab
60 40
MT ng/mg proteins
MT ng/mg proteins
120
B
a
50 40
ab
ab
b
30 20 10
20 0
0 Control
Cd
Cd/Zn
Cd/Se Cd/Zn/Se
Control
Cd
Cd/Zn
Cd/Se Cd/Zn/Se
Fig. 4 Metallothionein (MT) accumulation in the liver (a) and ovary (b) of female zebrafish exposed to Cd (0.4 mg/l) and supplemented with Zn and/or Se in their diet, during 3 weeks.
Each bar represents mean ± SE of 10 animals. Statistically significant differences: aP \ 0.01 in comparison with control. b P \ 0.01 in comparison with Cd group
accumulation and their related gene expression in the liver and ovaries tissues of female zebrafish exposed to Cd and supplemented with Zn and Se. Several environmental pollutants can become toxic through the induction of oxidative stress. The effects of Cd on aquatic organisms were largely documented (Giles 1988; Kraemer et al. 2005; Atli et al. 2006; Banni et al. 2009) however, and to our knowledge, no studies investigated the potential protective effects of Zn and Se on Cd-induced toxicity in fish species and the mechanism by which such protection occurs. Many aquatic organisms have unique systems for protecting themselves against reactive oxygen species (ROS) damaging effects (Jin et al. 2010). The antioxidant enzymes such as CAT, SOD and GPx are among the most important components of this defense mechanism (Atli et al. 2006; Ruas et al. 2008). In this study, heavy metals analysis clearly showed different degrees of Cd loads in the liver and ovaries tissue of zebrafish from the different experimental conditions. Our results indicated a significant increase in Cd level in the liver. The latter increase was more effective in presence of Zn. Our results are in agreements with a large number of studies indicating that Zn increases Cd concentration in hepatic tissues but reduces it in other organs in mammalian systems (Lamphere et al. 1984; Ueda et al. 1987; Banni et al. 2010). This redistribution of Cd in the organisms could be considered as a protective mechanism against the Cd-cellular toxicity and would explain the relatively lower effect of Cd in ovaries when compared with that observed in liver.
As expected, exposure to Cd, clearly decreased the activities of CAT, SOD and GPx and rendered a significant increase in MDA accumulation in both liver and ovaries. Cd was also responsible of the significant increase of MTs accumulation in the investigated tissues. Similar effects were reported in several aquatic biosystems (Banni et al. 2009; Isani et al. 2009; Cao et al. 2010). It is well known that the displacement of iron, Zn and copper from various intracellular sites by Cd increases the concentration of the ionic iron, Zn and copper (Casalino **et al. 1997). This causes oxidative stress through the Fenton reaction, producing hydroxyl radical species that are believed to initiate lipid peroxidation (Jurczuk et al. 2004; Dondero et al. 2005) and minimize the protective role of anti-oxidative stress enzymes such as CAT, SOD and GPx (Bauer et al. 1980; Jihen et al. 2009). Interestingly, in Cd-exposed animals, the gene expression analysis of the antioxidative stress genes showed a marked up-regulation pattern that could be attributed to the accumulation of ROS due to the anti-oxidative stress enzymes inhibition (Banni et al. 2010; Cuypers et al. 2010; Jihen et al. 2009). Like other organisms, fish can combat the increasing levels of ROS in their tissues producing protective ROS-scavenging enzymes such as SOD and CAT, which convert superoxide anions (O2-) into H2O2 and then into H2O and O2. Thus, it is possible that an increase in the transcription of these genes would contribute to the elimination of ROS from the cell induced by Cd exposure. Our data provided clues on the effects of dietary Zn supplementation on the oxidative stress status of the liver and ovaries tissues of zebrafish exposed to
123
Relative gene expression
8
A (Cat)
7 6
a
5
a a
4 3
b 2 1
Relative gene expression
Biometals 3,5 3
Cd+Se
B (Sod) a
7 6
a
5 4
ab
3
b
2 1
2
0,5
Cd 3,5
Cd+Se
C (Gpx) a a
3
a b
2 1
ab
ab
b
2 1,5 1 0,5
Cd 2,5
Cd+Zn
Cd+Se
Cd+Zn+Se
G (Gpx) a
2
a a
1,5
b
1 0,5 0
Cd+Zn
Cd+Se
Cd+Zn+Se
D (Mt) a
14 12 10
ab
8
ab
6 4
b
2
Cd
Relative gene expression
Cd
Relative gene expression
Cd+Zn+Se
a
2,5
0
16
Cd+Se
F (Sod)
3
Cd+Zn+Se
Relative gene expression
Relative gene expression
Cd+Zn
5
18
Cd+Zn
0 Cd
20
b
1
0
4
a
1,5
Cd+Zn+Se
Relative gene expression
Relative gene expression
Cd+Zn
8
6
a
0 Cd
9
a
2,5
0
10
E (Cat)
6
Cd+Zn
Cd+Se
Cd+Zn+Se
H (Mt) a
5 4
ab
3
ab 2
b
1 0
0 Cd
Cd+Zn
Cd+Se
Cd+Zn+Se
Cd
Cd+Zn
Cd+Se
Cd+Zn+Se
Fig. 5 Quantitative real time PCR expression-analysis of Cat (a, e), Zn-Sod (b, f), Gpx (c, g) and Mt (d, h) genes in the liver (a, b, c and d) and ovary (e, f, g and f) of female zebra fish exposed to Cd (0.4 mg/l) and supplemented with Zn and/or Se in their diet, during 3 weeks. Values were geometrically
normalized against b-actin and 18S (used as a house-keeping genes), and represent the mean mRNA expression value ± SEM (n = 5) relative to those of the controls. The asterisk represents a statistically significant difference when compared with the female controls; *at P \ 0.05
Cd. Indeed, a significant recover of the CAT and SOD activities to control values and a decrease in MDA accumulation when compared to Cd-exposed
animals were observed in both tissues. Moreover, Zn supply seems to affect the Cd distribution between organs. A maximum liver Cd-uptake was observed in
123
Biometals
presence of Zn, when the ovaries Cd-loads were low. Zn has important roles in the organism for growth, protein metabolism, energy production, gene regulation, maintaining the health of cell membranes and bones probably because it is a cofactor of numerous enzymes (Watanabe et al. 1997; Yamaguchi 1998). One of the most significant functions of Zn is related to its antioxidant potential and its participation in the antioxidant defense system (Powell 2000). Kucukbay et al. (2006) reported that supplemental Zn in the diet decreases serum and tissue lipid peroxidation in rainbow trout. The CuZn-Sod gene expression pattern decreased markedly in Zn-supplemented fishes when compared to Cd-exposed animals in liver and was similar to control animals in ovaries. Chung et al. (2005) demonstrated an apparent Zn dependency of H2O2-induced expression of antioxidant genes in rainbow trout gills cell culture, suggesting that Zn might act as a physiological signal to mediate the response to oxidative stress. Moreover, Zn stimulates transcription of specific genes by binding to metal regulatory Transcription Factor-1, which upon activation binds to metal-responsive elements of the target genes (Andrews 2001). Gene regulation by Zn is not restricted to those involved in Zn homeostasis (Cousins et al. 2003; Egli et al. 2003). This may explain the significant decrease in Mts mRNA abundance as well as CuZn-Sod mRNA in liver and ovaries of Zn-supplemented animals when compared to Cd-exposed animals. Indeed in recent works (Banni et al. 2010; Messaoudi et al. 2010a, b), Zn amounts significantly decreased in testis and plasma of rats exposed to Cd and to Cd ? Zn and increased in liver tissues. In our Study, Se supplementation alone decreased the Cd-induced toxicity promoting the maintenance of a normal steady state GPx activity in liver and ovaries. Moreover, the CAT and SOD activities were recovered to control values in the ovaries in Se-supplemented animals. One of the most important functions of Se is related to its antioxidant role and participation in the antioxidant defense system since it is a GPx cofactor (Ko¨hrle et al. 2005). GPx scavenges H2O2 and lipid hydroperoxides, using reducing equivalents from glutathione and protecting membrane lipids and macromolecules from oxidative damage (Watanabe et al. 1997). Recently, the effects of Se on oxidative stress biomarkers in the freshwater characid
123
fish Brycon cephalus exposed to the organophosphate methyl parathion was investigated, suggesting that dietary Se protects cells against the insecticideinduced oxidative stress (Monteiro et al. 2009). The gene expression patterns of the investigated targets did not manifest any significant changes respect to Cd-exposed animals except for Sod and Mt in ovaries that showed a slight decrease where the CAT activity was recovered to control values and the MTs protein content significantly decreased in comparison with Cd-Exposed animals. The latter could be attributed to the decrease of the intracellular concentration of free Cd. In this work, we report for the first time the potential protective effect of Zn and Se on Cd-induced toxicity in fish species. In deed, our results show that the co-supply of Zn and Se in the diet recovered the MDA accumulation in Cd-exposed animals to control values. Our data indicated also a significant improvement in the response of the anti-oxidative stress enzymes when compared to Cd-exposed and control animals. Moreover, the mRNA abundance of the Cat, Zn-Sod and Gpx were maintained at control levels. Similar effects were recently reported in mammalian biosystems (Jihen et al. 2009; Messaoudi et al. 2009). Interestingly, the up-regulation pattern of all investigated genes observed in Cd-exposed animals was abolished, except for Mts which maintained a slight up-regulation trend when fishes are supplemented with Zn and Se. Our data would suggest that the protective effect of Zn and Se against Cd-induced toxicity passes through non-MT gene expression mechanisms being more depending of the oxidative stress status of the cell as it has been recently proposed in rat tissues (Banni et al. 2010). Indeed, metallothionein induction was associated with the presence of some reactive oxygen species and thus, with the oxidative stress status of the cell (Dondero et al. 2005). It has been previously shown that hydrogen peroxide and other oxidants can stimulate Mt mRNA neosynthesis (Dalton et al. 1994), and it is well known that Mts bear a high antioxidant potential (Thornalley and Vasak 1985).
Conclusion In conclusion, our results indicate that dietary intake of Zn or Se can decrease the oxidative damages in zebrafish exposed to Cd. Interestingly, co-supply of
Biometals
Zn and Se efficiently protected against Cd-induced toxicity in two target organs; liver and ovaries. Our study further demonstrated that the mRNA abundances of genes, which encode antioxidant proteins (Cat, Zn-Sod, and Gpx) were higher when related enzymatic activities were altered. Finally, our data would suggest that protective effect of Zn and Se against Cd-induced toxicity passes through non-MT gene expression mechanisms being more depending of the oxidative stress status of the cell. Acknowledgments This work was supported by founds from ‘‘Ministe`re de l’Enseignement Supe´rieur et de la Recherche Scientifique; UR «Biochimie et Toxicologie Environnementale» , ISA Chott-Mariem, Universite´ de Sousse «Tunisia» and UR: «Ge´ne´tique, Biodiversite´ et Valorisation des Bioressources, Institut Supe´rieure de Biotechnologie de Monastir» , Universite´ de Monastir, «Tunisia» .Conflict of interest None.
References Aebi H (1974) Catalase. In: Bergmeyer H-U (ed) Methods of enzymatic analysis. Academic Press, New York, pp 671–684 Andrews GK (2001) Cellular zinc sensors: MTF-1 regulation of gene expression. Biometals 14:223–237 Atli G, Alptekin O, Tukel S, Canli M (2006) Response of catalase activity to Ag2? , Cd2? , Cr2? , Cu2? and Zn2? in five tissues of freshwater fish Oreochromis niloticus. Comp Biochem Physiol C 143:218–224 Banni M, Bouraoui Z, Clerandeau C, Narbonne JF, Boussetta H (2009) Mixture toxicity assessment of cadmium and benzo[a]pyrene in the sea worm Hediste diversicolor. Chemosphere 77:902–906 Banni M, Messaouidi I, Said L, El Heni J, Kerkeni A, Said K (2010) metallothionein gene expression in liver of rats exposed to cadmium and supplemented with zinc and selenium. Arch Environ Contam Toxicol. doi: 10.1007/ s00244-010-9529-y Bauer R, Demeter I, Hasemann V, Johansen JT (1980) Structural properties of the zinc site in Cu, Zn-superoxide dismutase; perturbed angular correlation of gamma rays pectroscopy on the Cu, 111Cd-superoxide dismutase derivative. Biochem Biophys Res Commun 94(4):1296–1302 Bonda E, Wlostowski T, Krasowska A (2004) Testicular toxicity induced by dietary cadmium is associated with decreased testicular zinc and increased hepatic and renal metallothionein and zinc in the bank vole (Clethrionomys glareolus). Biometals 17:615–624 Bradford M (1976) A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248–254 Buege JA, Aust SD (1978) Microsomal lipid peroxidation. Methods Enzymol 52:302–310
Canton JH, Slooff W (1982) Toxicity and accumulation studies of cadmium (Cd2?) with freshwater organisms of different trophic levels. Ecotoxicol Environ Saf 6(1): 113–128 Cao L, Huang W, Liu J, Yin X, Dou S (2010) Accumulation and oxidative stress biomarkers in Japanese flounder larvae and juveniles under chronic cadmium exposure. Compar Biochem Physiol Part C 151:386–392 Chung MJ, Walker PA, Brown RW, Hogstrand C (2005) ZINC-mediated gene expression offers protection against H2O2-induced cytotoxicity. Toxicol Appl Pharmacol 205(3):225–236 Cousins RJ, Blanchard RK, Popp MP, Liu L, Cao J, Moore B, Green CL (2003) A global view of the selectivity of zinc deprivation and excess on genes expressed in human THP-1 mononuclear cells. Proc Natl Acad Sci USA 100:6952–6957 Crouch RK, Gandy SC, Kinsey G (1981) The inhibition of islet superoxide dismutase by diabetogenic drugs. Diabetes 30:235–241 Cuypers A, Plusquin M, Remans T, Jozefczak M, Keunen E, Gielen H, Opdenakker K, Nair AR, Munters E, Artois TJ, Nawrot T, Vangronsveld J, Smeets K (2010) Cadmium stress: an oxidative challenge. Biometals 23(5):927–940 Dalton T, Palmiter RD, Andrews GK (1994) Transcriptional induction of the mouse metallothionein-I gene in hydrogen peroxide-treated Hepa cells involves a composite major late transcription factor/antioxidant response element and metal response promoter elements. Nucleic Acid Res 22:5016–5023 Dondero F, Piacentini L, Banni M, Rebelo M, Burlando B, Viarengo A (2005) Quantitative PCR analysis of two molluscan metallothionein genes unveils differential expression and regulation. Gene 345:259–270 Egli D, Selvaraj A, Yepiskopsyan H, Zhang B, Hafen E, Georgev O, Schaffner W (2003) Knockout of dmetalresponsive transcription factorT MTF-1 in Drosophila by homologous recombination reveals its central role in heavy metal homeostasis. EMBO J 22:100–108 EPA Agency EP (2004) Ebdocrine Disruptor Screening Program. Available online: http://www.epa.gov/scipoli/oscp endo/edspoverview/index.htm Giles MA (1988) Accumulation of cadmium by rainbow trout, Salmo gairdneri, during extended exposure. Can J Fish Aquat Sci 45:1045–1053 Hafeman DG, Sunde RA, Hoekstra WG (1974) Effect of dietary selenium on erythrocyte and liver glutathione peroxidase in the rat. J Nutr 104:580–587 Hamilton SJ (2003) Review of residue-based selenium toxicity thresholds for freshwater fish. Ecotoxicol Environ Saf 56:201–210 Hu Y, Jin T, Zhou T, Pang B, Wang Y (2004) Effects of zinc on gene expressions induced by cadmium in prostate and testes of rats. Biometals 17:571–572 Isani G, Andreani G, Cocchioni F, Fedeli D, Carpene E, Falcioni G (2009) Cadmium accumulation and biochemical responses in Sparus aurata following sub-lethal Cdexposure. Ecotoxicol Environ Saf 72:224–230 Jihen EH, Imed M, Fatima H, Abdelhamid K (2009) Protective effects of selenium (Se) and zinc (Zn) on cadmium (Cd)
123
Biometals toxicity in the liver of the rat: effects on the oxidative stress. Ecotoxicol Environ Saf 72:1559–1564 Jin Y, Zhang X, Shu L, Chen L, Sun L, Qian H, Liu W, Fu Z (2010) Oxidative stress response and gene expression with atrazine exposure in adult female zebrafish (Danio rerio). Chemosphere 78:846–852 Jurczuk M, Brzoska MM, Moniuszko-Jakoniuk J, GaazynSidorczuk M, Kulikowska-Karpinska E (2004) Antioxidant enzymes activity and lipid peroxidation in liver and kidney of rats exposed to cadmium and ethanol. Food Chem Toxicol 42(3):429–438 Ko¨hrle J, Jakob F, Contempre´ B, Dumont JE (2005) Selenium, the thyroid, and the endocrine system endocrine. Endocr Rev 26:944–984 Kraemer LD, Campbell PGC, Hare L (2005) Dynamics of Cd, Cu and Zn accumulation in organs and sub-cellular fractions in field transplantated juvenile yellow perch (Perca flavescens). Environ Poll 138(2):324–337 Kucukbay Z, Yazlak H, Sahin N, Tuzcu M, Cakmak MN, Gurdogan F, Juturu V, Sahin K (2006) Zinc picolinate supplementation decreases oxidative stress in rainbow trout (Oncorhynchus mykiss). Aquaculture 257:465–469 Lamphere DN, Dorn CR, Reddy CS, Meyer AW (1984) Reduced cadmium body burden in cadmium-exposed calves fed supplemental zinc. Environ Res 33(1):119–129 Liu L, We G (2007) Growth differentiation factor 9 and its spatiotemporal expression and regulation in the zebrafish ovary. Biol Reprod 76:294–301 McCurley AT, Callard GV (2008) Characterization of housekeeping genes in zebrafish: male-female differences and effects of tissue type, developmental stage and chemical treatment. BMC Mol Biol 12:90–102 Messaoudi I, El Heni J, Hammouda F, Saı¨d K, Kerkeni A (2009) Protective effects of selenium, zinc, or their combination on cadmium-induced oxidative stress in rat kidney. Biol Trace Elem Res 130:152–161 Messaoudi I, Hammouda F, El Heni J, Baati T, Saı¨d K, Kerkeni A (2010a) Reversal of cadmium induced oxidative stress in rat erythrocytes by selenium, zinc or their combination. Exp Toxicol Pathol 62(3):281–288 Messaoudi I, Banni M, Saı¨d L, Saı¨d K, Kerkeni A (2010b) Evaluation of involvement of testicular metallothionein gene expression in the protective effect of zinc against cadmium-induced testicular pathophysiology in rat. Reprod Toxicol 29(3):339–345 Monteiro DA, Rantin FT, Kalinin AL (2009) The effects of selenium on oxidative stress biomarkers in the freshwater characid fish matrinxa˜, Brycon cephalus (Gu¨nther, 1869) exposed to organophosphate insecticide Folisuper 600
123
BRÒ (methyl parathion). Comp Biochem Physiol C 149: 40–49 Pfaffl MW, Horgan GW, Dempfle L (2002) Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in realtime PCR. Nucleic Acid Res 30:e36 Piasek M, Blanua M, Kostial K, Laskey JW (2001) Placental cadmium and progesterone concentrations in cigarette smokers. Reprod Toxicol 15:673–681 Powell SR (2000) The antioxidant properties of zinc. J Nutr 130:1447S–1454S Rotruck JT, Pope AL, Ganther HE, Swanson AB, Hofeman DG, Hoekstra WG (1973) Selenium: biochemical role as a component of glutathione peroxidase. Science 179:578–590 Ruas CBG, Carvalho CdS, De Araujo HSS, Espindola ELG, Fernandes MN (2008) Oxidative stress biomarkers of exposure in the blood of cichlid species from a metalcontaminated river. Ecotoxicol Environ Saf 71:86–93 Segner H (2008) Zebrafish (Danio rerio) as a model organism for investigating endocrine disruption. Comp Biochem Physiol C 149:187–195 Tang R, Dodd A, Lai D, McNabb WC, Love DR (2007) Validation of zebrafish (Danio rerio) reference genes for quantitative real-time RT-PCR normalization. Acta Biochim Biophys Sin (Shanghai) 39(5):384–390 Thornalley PJ, Vasak M (1985) Possible role for metallothionein in protection against radiation-induced oxidative stress. Kinetics and mechanism of its reaction with superoxide and hydroxyl radicals. Biochim Biophys Acta 827:36–44 Ueda F, Seki H, Fujiwara H, Ebara K, Minomiya S, Shimaki Y (1987) Interacting effects of zinc and cadmium on the cadmium distribution in the mouse. Vet Hum Toxicol 29(5):367–372 Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F (2002) Accurate normalization of real-time quantitative QPCR data by geometric averaging of multiple internal controls. Genome Biol 3:34 Viarengo A, Ponzano E, Dondero F, Fabbri R (1997) A simple spectrophotometric method for metallothionein evaluation in marine organisms: an application to Mediterranean and Antarctic molluscs. Mar Env Res 44:69–84 Watanabe T, Kiron V, Datoh S (1997) Trace minerals in fish nutrition. Aquaculture 151:185–207 Yamaguchi M (1998) Role of zinc in bone formation and bone resorption. J Trace Elem Exp Med 11:119–135 Yiin SJ, Cheru CL, Sheu JY, Lin TH (1999) Cadmium-induced lipid peroxidation in rat testes and protection by selenium. Biometals 12:353–359
