Meningococcal Outer Membrane Protein NhhA Is Essential for ...

INFECTION AND IMMUNITY, Nov. 2008, p. 5412–5420 0019-9567/08/$08.00⫹0 doi:10.1128/IAI.00478-08 Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Vol. 76, No. 11

Meningococcal Outer Membrane Protein NhhA Is Essential for Colonization and Disease by Preventing Phagocytosis and Complement Attack䌤 Hong Sjo ¨linder, Jens Eriksson, Lisa Maudsdotter, Helena Aro, and Ann-Beth Jonsson* Department of Medical Biochemistry and Microbiology, Uppsala Biomedical Centre, Uppsala University, SE-751 23 Uppsala, Sweden Received 17 April 2008/Returned for modification 23 May 2008/Accepted 2 September 2008

Neisseria meningitidis is a leading cause of meningitis and septicemia worldwide, with a rapid onset of disease and a high morbidity and mortality. NhhA is a meningococcal outer membrane protein included in the family of trimeric autotransporter adhesins. The protein binds to the extracellular matrix proteins heparan sulfate and laminin and facilitates attachment to host epithelial cells. In this study, we show that NhhA is essential for bacterial colonization of the nasopharyngeal mucosa in a murine model of meningococcal disease. Successful colonization depends on bacterial attachment but also to the capacity to overcome innate host immune responses. We found that NhhA protected bacteria from phagocytosis, which is important for the mucosal survival of bacteria. In addition, NhhA mediated extensive serum resistance that increased bacterial survival in blood and promoted lethal sepsis. The presence of NhhA protected bacteria from complement-mediated killing by preventing the deposition of the membrane attack complex. Taken together, the results of this work reveal that NhhA inhibits phagocytosis and protects bacteria against complement-mediated killing, which enhances both nasal colonization and the development of sepsis in vivo. Neisseria meningitidis is a human-specific pathogen and a leading cause of bacterial meningitis and septicemia worldwide. The reservoir for this microbe is the nasopharynx, and up to 40% of the adult human population are asymptomatic carriers (42). Occasionally the bacteria can gain access to the bloodstream and spread to the cerebrospinal fluid (CSF). The progression of the disease is rapid, with high mortality despite antibiotic therapy and intensive care (36). N. meningitidis strains are divided into serogroups depending on the capsular structure. Serogroups A, B, C, W-135, X, and Y are most commonly associated with sporadic and epidemic disease. The first step of meningococcal disease is bacterial colonization of the nasopharyngeal mucosa. The initial attachment to epithelial cell surfaces is mediated by pilus structures that extend from the bacterial surface (24, 39). Each pilus is composed of thousands of tightly packed major PilE subunits and minor pilus-associated proteins, such as PilC. Pili play a crucial role in bacterial movement, and they mediate adhesion to surfaces, DNA uptake, and biofilm formation and evoke signaling responses in other cells (20, 24). Piliated Neisseria interacts with CD46, complement receptor 3, and I-domain-containing integrins (8, 9, 21). In addition to pili, there are several membraneassociated components involved in interaction with host cells, such as lipooligosaccharide (LOS) and the outer membrane proteins Opa, Opc, App, and NadA (3, 5, 34, 40, 41). NhhA, Neisseria Hia/Hsf homologue, is an outer membrane protein homologous to the Hia and Hsf adhesins of Haemophilus influenzae (14, 26). These proteins exhibit divergent functional properties and often contribute to bacterial adherence,

invasion, microcolony formation (12, 15), transepithelial trafficking (16), or serum resistance (2). The meningococcal NhhA protein is composed of 590 amino acids and is a trimeric autotransporter adhesin that is present in all tested meningococcal strains. The C-terminal part of the protein is highly conserved, whereas the N-terminal part contains both variable and conserved regions (26, 27, 31). In a reversed vaccinology approach, NhhA (also called GNA0992) was identified as a surface-exposed antigen able to induce a bactericidal antibody response (27). Recently it was demonstrated that NhhA facilitates bacterial attachment to host cells in vitro (31). NhhA-deficient meningococci showed impaired adherence to Chang conjunctiva epithelial cells, and Escherichia coli expressing NhhA adhered to host cells in a dose-dependent manner. Further, purified NhhA bound to the extracellular matrix components laminin and heparan sulfate, as well as to epithelial cells (31). In a proteomic study, we found that the expression of NhhA increased during bacterial interaction with human epithelial cells (unpublished results). Taken together, these data argue that NhhA has a critical role in bacterial pathophysiology. In this study, we aimed to investigate the role of NhhA in vivo by using a murine model of disease. We demonstrated that the protein is essential for bacterial colonization of the nasopharyngeal mucosa but dispensable for the induction of excessive proinflammatory responses in mice. Furthermore, NhhA has a determining role in protecting bacteria from host innate immune defenses, which subsequently affects the outcome of the disease process. Taken together, the results of this study reveal a multifaceted impact of NhhA during the development of meningococcal disease.

* Corresponding author. Mailing address: Department of Medical Biochemistry and Microbiology, Biomedical Centrum, Uppsala University, P.O. Box 582, Uppsala, Sweden. Phone: 46-(0)18-471 4507. Fax: 46-(0)18-471 4673. E-mail: [email protected]. 䌤 Published ahead of print on 15 September 2008.

Bacterial strains and growth conditions. N. meningitidis strain FAM20 belongs to serogroup C, multilocus sequence type 11. FAM20 and its NhhA-deficient mutant were grown at 37°C in a 5% CO2 atmosphere on GCB (GC medium base; Difco, Detroit, MI) or GC broth with Kellogg’s supplement (22). E. coli DH5␣

MATERIALS AND METHODS

5412

VOL. 76, 2008 was used for cloning and was cultivated on LB agar plates (Acumedia, Lansing, MI) at 37°C. To generate an NhhA-deficient mutant, a 720-bp upstream and a 1,200-bp downstream fragment of nhhA (gna0992) was amplified from FAM20 and ligated into the ScaI/XhoI and NotI/SacI sites, which flank the KanR-luciferase cassette in the plasmid pLKp (35). The resulting plasmid, pLKnhhA, was integrated into the genome of FAM20 by homologous allelic replacement after transformation as described previously (1). The following primers were used for cloning: upstream, 5⬘-GAGACCTTTGCAAAAGTACTTTCCCTCCCGACAGCCG-3⬘ and 5⬘-TGTTGGGGCAGGCTCGAGGTTTGAAGGGAAGGGTGG-3⬘, and downstream, 5⬘-GAGAAGCAGAAGCGGCCGCAAGCGTATCGGTC-3⬘ and 5⬘-CAC GTCCTAGATTCCCGAGCTCGCGGGAATGACG-3⬘. The mutant was selected on GCB agar plates containing 50 ␮g/ml of kanamycin. The abolition of nhhA was verified by PCR and sequencing with the following primers: P1, 5⬘-CACTTCAAA TGCGAATCCGCCGACC-3⬘; P2, 5⬘-AATCCAGCAACACAACGCAGCAG G-3⬘; and P3, 5⬘-TAGTGGATTAAATTTAAACCAGTACGG-3⬘. Cell lines and growth conditions. ME180 (ATCC HTB33), an epithelium-like human cell line from a cervical carcinoma, was maintained in RPMI medium (Invitrogen) supplemented with 10% heat-inactivated fetal bovine serum and 2 mM L-glutamine. Human pharyngeal cell lines FaDu (ATCC HTB-43) and Detroit 562 (ATCC CCL-138) were maintained in Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen) supplemented with 10% heat-inactivated fetal bovine serum and 2 mM L-glutamine. Isolation of RNA from cell-adherent bacteria and real-time PCR. A pharyngeal epithelial cell line, Detroit 562 (ATCC CCL-138; American Type Culture Collection, Manassas, VA), was maintained in DMEM-based complete medium (Invitrogen, Carlsbad, CA) and infected with strain FAM20 at a multiplicity of infection (MOI) of 100 for 2 h. Unbound bacteria were removed by washing, and the adhered bacteria were dissociated from cells by treatment with trypsinEDTA and harvested by centrifugation. As a control, FAM20 was treated identically to the description above except that no Detroit 562 cells were present. Total bacterial RNA was extracted, and cDNA was synthesized. For real-time PCR amplification, Power Sybr green PCR master mix was used with a Prism 7300 sequence detector system (Applied Biosystems, Foster, CA) according to the manufacturer’s guidelines. To normalize cycle threshold results between cDNA samples, the gene encoding ubiquinol-cytochrome c reductase cytochrome b subunit, which has been shown to exert no measurable regulation during adherence (7), was chosen as an internal control and amplified with the primers 5⬘-GACCATGAACTACAAACCCGAC-3⬘ and 5⬘-AACAATGAAGA AAAAGATGCGC-3⬘. The primers used for nhhA amplification were 5⬘-GTA CACATTACACTCGTCCAGC-3⬘ and 5⬘-GTAAGTGCGGACGAAATCGA C-3⬘. The data were analyzed by using the standard curve method, and the results are presented as the comparative mRNA levels after normalization. The experiment was performed in duplicate with three RNA samples prepared independently. Characterization of the ⌬NhhA mutant. The expression of meningococcal Opa, PilC, and pili was detected by Western blot analysis. Antibodies against pili, PilC, and Opa are described in reference 35. The sample preparation and Western blot conditions have been described previously (29, 35). Similar expression of pili in wild-type and mutant strains was confirmed by transmission electron microscopy. LOS was isolated, separated by Tricine-sodium dodecyl sulfatepolyacrylamide gel electrophoresis, and visualized by silver staining as described previously (1). Capsule levels were determined by whole-cell enzyme-linked immunosorbent assay (ELISA) analysis with monoclonal antibody 95/678 (1:500; National Institute for Biological Standards and Control [NIBSC], Potters Bar, Hertfordshire, United Kingdom). Sialylation was determined with a sialic acid quantification kit (Sigma, St. Louis, MO). Tracking of bacterial motility was done by live-cell-imaging microscopy and tracking software (Axiovision 4.5; Zeiss). Bacterial adherence to and invasion into the cells were determined by using the pharyngeal epithelial cell line Detroit 562 as described previously (1). Data were expressed in comparison to the data for the wild-type strain FAM20. Both assays were carried out in triplicate in three independent experiments. We complemented the NhhA mutant by introducing a wild-type gene copy. The nhhA gene was PCR amplified by using primers nhhAfwd (5⬘-ATAATGT GTGGAATTGTGAGCGGATAACAATTTATAATGTGTGGAATTGTGAG CGGATAACAATTT-3⬘ [including a consensus ␴70 promoter]) and nhhArev (5⬘-AAGAGCTTTTCAACAGCAGACAGGCGAAAA-3⬘), and the chloramphenicol resistance gene was PCR amplified from pACYC184 by using primers CATfwd (5⬘-TACGTCCTGATGACGGAAGATCACTTCGCA-3⬘) and CATrev (5⬘-CTCACAATTCCACACATTATACGAGCCGATGATTAATTGTCAACA GCTCAGGGCACCAATAACTGCCTT-3⬘). For chromosomal integration of nhhA by homologous recombination, two DNA fragments (UHS and DHS) from a region between orf73 and orf74 of the FAM20 genome, which does not contain

NhhA IN MENINGOCOCCAL DISEASE

5413

inverted repeat sequences, were amplified by using UHSfwd (5⬘-ATGCCGTCT GAATACTTCCCGGCAGGTCAAAT-3⬘), UHSrev (5⬘-TCTTCCGTCATCAG GACGTACAAACCAGCGAA-3⬘), DHSfwd (5⬘-TCTGCTGTTGAAAAGCTC TTGCATTAAGTTAATC-3⬘), and DHSrev (5⬘-TTCAGACGGCATGTGGCT ATTGCATGCGCTTAATGA-3⬘). The primers were designed with overlapping homologies at the ends. The four different PCR fragments were ligated in PCRs done in two steps, five cycles without any primers added followed by 30 cycles with two primers. The fragment obtained was incorporated into the vector pJET1.2/blunt. The linearized plasmid was transformed into the ⌬NhhA mutant strain as described previously (1). The transformation mixture was plated on GC agar plates containing 10 ␮g/ml chloramphenicol and 50 ␮g/ml kanamycin. Positive transformants were confirmed by PCR. Mouse model of infection and sampling procedures. Transgenic mice (6 to 8 weeks old) expressing human CD46 (19) were used for in vivo studies. These mice have been previously described and express CD46 in a human-like pattern (4, 18, 19). Prior to intranasal (i.n.) challenge, mice were treated with antibiotics as previously described (19). Each mouse was challenged with 108 bacteria in 10 ␮l phosphate-buffered saline (PBS) once per day for two days, and 5 mg of iron dextran/mouse was given intraperitoneally (i.p.) 2 h before and 24 h after challenge. Mice were monitored for 7 days. Nasal washes were collected as described previously (23), and head tissue samples were collected at 2 days postchallenge. Bacterial colonization was defined by the recovery of bacteria from nasal washes. The levels of the murine interleukin-8 (IL-8) homologue, KC, in nasal washes were determined by ELISA (Invitrogen) and normalized to total protein concentrations. To study systemic disease, CD46 transgenic mice were challenged i.p. with 108 bacteria in 100 ␮l PBS. In survival studies, mice were monitored for 7 days. Bacteremia was determined by the recovery of bacteria from blood samples taken from the tail vein at different time points after i.p. challenge. CSF samples were withdrawn from the cisterna magna and checked for the absence of red blood cells before the enumeration of bacterial counts. Blood smears were made for analysis of neutrophil/macrophage infiltration by light microscopy after Wright’s staining (Sigma). The levels of murine IL-6, tumor necrosis factor (TNF), KC, and C5a in sera were measured by ELISA (Invitrogen). Animal care and experiments were in accordance with institutional guidelines and have been approved by national ethical committees. Histology and immunofluorescence. Paraffin-embedded murine head tissue was sectioned and stained with hematoxylin and eosin. For immunofluorescence, rabbit polyclonal antibody (pAb) against N. meningitidis (1:100; United States Biological, Swampscott, MA) and rat monoclonal antibody against mouse Gr-1 (1:100; R&D Systems, Minneapolis, MN) were applied as primary antibodies. Goat anti-rabbit immunoglobulin G (IgG)-Alexa Fluor 488 (1:100; Invitrogen) and goat anti-rat IgG-Alexa Fluor 633 (1:100; Invitrogen) were applied as the secondary antibodies. Nuclear DNA was stained with 4⬘,6⬘-diamidino-2-phenylindole (DAPI) and mounted with Vectashield mounting medium (Vector Laboratories, Inc., Burlingame, CA). Images of the sections were captured by using an inverted Zeiss LSM 510 confocal microscope. Analyses of phagocytosis, killing of meningococci by murine macrophages, and cytokine stimulation. Uninfected CD46 transgenic mice were sacrificed, and peritoneal cells were harvested by lavage with 10 ml of ice-cold PBS containing 5 mM EDTA. After the washing, recovered cells were suspended in DMEMbased complete medium and seeded in tissue culture plates. After overnight incubation, the adherent cells were applied for experiments. To examine phagocytosis, 5 ⫻ 108 CFU of strain FAM20 or the ⌬NhhA mutant were suspended in 0.025% fluorescein isothiocyanate (FITC) solution containing 0.05 M Na2CO3 and 0.1 M NaCl, incubated on ice for 1 h, and washed three times with PBS. FITC-labeled bacteria were then added to the peritoneal cells in fresh cell culture medium at an MOI of 10. After 1 h, the wells were washed to remove unbound bacteria and stained for 1 min with 0.4% trypan blue to quench the extracellular fluorescence (30, 37). Peritoneal cells were then fixed and analyzed by using a FACSAria flow cytometer (BD Biosciences, San Jose, CA). For fluorescence imaging, cells were cultured on hexametaphosphate-metasilicatecoated 13-mm coverslips (Menzel GmbH, Braunschweig, Germany) to 50% confluence before exposure to bacteria. Cellular nuclear DNA was stained with Vectashield mounting medium containing DAPI (Vector Laboratories, Inc.). To access bacterial intracellular survival, FAM20 or ⌬NhhA mutant bacteria were added to the peritoneal cells (MOI ⫽ 100) and incubated for 1 h. Unbound bacteria were removed by washing with medium. The peritoneal cells were treated with 100 ␮g/ml gentamicin for 30 min, followed by incubation with fresh medium for 1.5 h. The numbers of viable bacteria in the cells were determined after lysis with 1% saponin, serial dilution, and plating. For in vitro cytokine stimulation analysis, peritoneal cells were infected with strain FAM20 or ⌬NhhA bacteria (MOI ⫽ 10), and the supernatants were collected at 4 h, 8 h, and 24 h

5414

¨ LINDER ET AL. SJO

postinfection and filtered. The amounts of IL-6 and TNF were measured by ELISA (Invitrogen). Serum bactericidal assay and complement deposition analysis. Amounts of 107 CFU/ml of either wild-type or mutant bacteria were suspended in DMEM cell culture medium and mixed 4:1 with normal human serum, heat-inactivated serum (30 min at 56°C), or complement factor C3-deficient human serum (C3⫺/⫺; Sigma) and incubated for 1 h at 37°C. The bacteria were serially diluted and spread on GCB plates to enumerate the surviving bacteria. The assays were performed twice in triplicate, and the data show the percentage of bacteria recovered in comparison to the initial inoculated dose (time zero). To measure membrane attack complex (MAC) deposition, 107 bacteria in 100 ␮l PBS were fixed in 4% paraformaldehyde for 15 min at room temperature, washed, and then incubated with 20 ␮l normal human serum for 30 min at 37°C. After being washed, the bacteria were stained for MAC binding with a rabbit anti-C5b-9 pAb (1:50; Dako, Glostrup, Denmark), followed by Alexa Fluor 488-conjugated goat anti-rabbit IgG (1:5,000; Invitrogen). The bacteria were then analyzed by using a FACSAria flow cytometer with CellQuest software (BD Biosciences). The experiment was repeated three times. Statistical analysis. Survival rates were assessed by using Fisher’s exact test. Bacterial counts in blood and nasal washes were analyzed by using a nonparametric Mann-Whitney test. Cytokine concentration, phagocytosis, intracellular killing, and complement deposition assay results were evaluated with a two-tailed Student’s t test. P values of ⬍0.05 were considered significant.

RESULTS Upregulation of nhhA upon meningococcal attachment to human cells. Several lines of evidence have demonstrated that the expression of certain meningococcal outer membrane components is regulated upon contact with the host epithelium, thereby facilitating meningococcal colonization (6, 33). In a proteomic analysis, we identified several meningococcal proteins whose expression was upregulated in bacteria attached to host cells compared to their levels in bacteria alone (unpublished results). One of the upregulated proteins was NhhA, an outer membrane protein reported to enhance bacterial adherence to target cells in vitro (31). To further monitor the regulation of NhhA, we infected the human pharyngeal epithelial cell line Detroit 562 with N. meningitidis FAM20 for 2 h and examined the gene transcriptional level by real-time PCR. The transcription of nhhA was significantly increased in adhered bacteria compared to that in bacteria grown in cell culture medium (Fig. 1). The transcriptional upregulation was less prominent than the apparent change in protein expression (data not shown). It is well established that changes in protein levels do not always correspond to equal levels of transcriptional changes. Taken together, these data argue that NhhA expression is upregulated in response to bacterial contact with cells. NhhA contributes to meningococcal attachment. The role of NhhA in vivo has not been evaluated. To investigate this, we constructed an isogenic NhhA-deficient mutant of N. meningitidis strain FAM20 by allelic exchange. The absence of nhhA was confirmed by PCR (data not shown). The ⌬NhhA mutant had a growth rate and colony morphology similar to those of the wild-type strain (Fig. 2A and data not shown). Also, the mutant was not affected in its expression of virulence-associated surface components, such as PilE, PilC, LOS, opacity proteins (Opa), capsule expression, and LOS sialylation (Fig. 2B and data not shown). As expected, NhhA facilitated attachment to the pharyngeal epithelial cell line Detroit 562 but did not affect invasion (Fig. 2C). A complemented mutant regained a level of adherence to Detroit 562 cells that was similar to that of the wild-type strain (data not shown). We could not

INFECT. IMMUN.

FIG. 1. NhhA transcription upon bacterial attachment to cells. Cells of human pharyngeal epithelial cell line Detroit 562 were exposed to strain FAM20 at an MOI of 100 for 2 h. Total RNA was isolated from adhered bacteria (⫹cells) or bacteria grown in cell culture medium without cells (⫺cells), which was set as control. Transcriptional levels of nhhA were quantified by real-time PCR. The gene encoding the ubiquinol-cytochrome c reductase cytochrome b subunit, which is not regulated during adherence, was set as an internal reference (7). Both nhhA and the control gene were amplified from the same amount of total RNA, and data are presented as levels of nhhA mRNA after normalization to expression level of the reference gene. Results shown represent means ⫾ standard deviations of results of three independent experiments. A statistically significant higher value compared to the value for the control (without cells) is indicated with an asterisk (P ⬍ 0.05; Student’s t test).

detect reduced attachment to the epithelial cell lines FaDu and ME180 (data not shown), indicating that other factors were more important than NhhA during the initial adherence to these host cells in vitro. Both the wild-type and mutant bacteria expressed equal amounts of pili and carried identical pilE sequences, as evaluated by transmission electron microscopy and nucleotide sequencing (data not shown). Further, the strains displayed similar motility characteristics, as evaluated by tracking of pilus-mediated twitching motility in a live-cell-imaging microscope (data not shown). These data support the conclusion that pilus functions remained intact in the NhhA mutant. NhhA facilitates bacterial colonization of the nasopharynx. Colonization of the nasopharyngeal mucosa is an essential early step in meningococcal pathogenesis. We have developed a murine model of meningococcal disease using CD46 transgenic mice. In these mice, i.n. infection with piliated meningococci caused lethal disease in 15% of the mice, whereas nonpiliated bacteria did not cause disease (18, 19). To provide further insights into the role of NhhA in bacterial colonization, CD46 transgenic mice were infected i.n. with piliated wild-type strain FAM20 or piliated ⌬NhhA mutant bacteria. The development of disease was monitored for 7 days. Neither lethal outcome nor bacteremia was observed after challenge with the mutant, whereas i.n. challenge with the wild-type strain led to death in 15% of mice with bacterial growth in their CSF samples (data not shown). Bacterial colonization was further assessed 2 days postinoculation by the recovery of bacteria from nasal washes. The mutant failed to colonize the mucosal surface, whereas wild-type bacteria were readily recovered from nasal washes (P ⬍ 0.05) (Fig. 3A). To confirm bacterial colonization, we collected tissue of infected and uninfected mice for histological examination. Staining for bacteria in nasal tissue sections showed clusters of wild-type bacteria along the epithelial surface. Nearly no bacteria could be detected in nasal sections of mice infected with the ⌬NhhA mutant (Fig.

VOL. 76, 2008

FIG. 2. Characterization of the ⌬NhhA mutant. (A) Analysis of growth of wild-type (wt) strain FAM20 or ⌬NhhA mutant in DMEM cell culture medium by measuring the optical density at 595 nm (OD595nm) at different time points. (B) Expression of PilE, PilC, LOS, and Opa in strain FAM20 and ⌬NhhA mutant. PilE, PilC, and Opa were analyzed by immunoblotting using appropriate antibodies. LOS was analyzed by Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis. (C) Adhesion to and invasion into the epithelial cell line Detroit 562. FAM20 and ⌬NhhA were added to the cells at an MOI of 100 for 2 h (adhesion) or 8 h (invasion), and unbound bacteria were washed away. For invasion assays, Detroit 562 cells were treated for 2 h with gentamicin (200 ␮g/ml) to kill extracellular bacteria. Cells were treated with 1% saponin for 5 min, serially diluted, and spread onto GCB plates. Data are expressed as percentages of bacteria recovered; recovery of the wild-type strain was set as 100%. Shown are means ⫾ standard deviations of the results of three independent experiments. The invasion levels are shown as percentages of bacteria recovered compared with the number of adhered bacteria at 2 h. Statistically significant lower level of adherence compared with that of the wild type is indicated with an asterisk (P ⬍ 0.05; Student’s t test).

3B). Immunofluorescent staining with a mouse anti-Gr-1 (granulocyte differentiation antigen-1) antibody demonstrated neutrophil infiltration both in mice infected with the wild type and in mice infected with the mutant (Fig. 3B). Histological examination of nasal sections showed that the wild type induced more influx of inflammatory cells in subepithelial tissues than the mutant (Fig. 3C). The levels of the murine IL-8 homologue KC were similar in mice infected with the wild type and the mutant (data not shown), and KC was not detected in control mice challenged with PBS, arguing that NhhA facilitates bacterial colonization without affecting chemokine levels. NhhA mediates resistance to phagocytosis. The colonization of mucosal surfaces requires efficient and specialized attachment events, as well as the capacity of the organism to survive host defenses, such as phagocytosis. The absence of bacterial colonization after infection with the ⌬NhhA mutant (Fig. 3B)


5415

raised the possibility of increased sensitivity to phagocytosis. To explain the absence of mucosal colonization by the mutant, we evaluated the interaction between bacteria and phagocytic cells in vitro. As a model system, we used mouse macrophages isolated from the peritoneal lavage. To monitor the uptake of bacteria, FITC-labeled wild-type FAM20 or ⌬NhhA mutant bacteria were exposed to macrophages for 1 h; the macrophages were stained for intracellular bacteria and analyzed by fluorescence microscopy and flow cytometry. The results of microscopic analysis (Fig. 4A) and flow cytometry (Fig. 4B) revealed higher numbers of ⌬NhhA mutant bacteria than of wild-type bacteria inside cells, suggesting that NhhA prevents phagocytosis. To determine whether the intracellular bacteria were viable, extracellular bacteria were killed with gentamicin before plating. The number of intracellular viable ⌬NhhA mutant bacteria was significantly lower than the number of wildtype FAM20 bacteria (Fig. 4C). As shown by the results in Fig. 4D, NhhA did not affect IL-6 or TNF production, since both strains induced similar levels of IL-6 and TNF-␣. Taken together, these results suggest that NhhA contributes to meningococcal colonization of the nasopharyngeal mucosa by mediating enhanced resistance to phagocytosis. NhhA promotes bacterial survival in the bloodstream. N. meningitidis causes sepsis and meningitis with high mortality. The mechanisms or pathways used by bacteria to enter the blood or CSF are far from fully understood. It is uncertain if bacteria can pass the mucosal barrier of healthy individuals, especially since 5 to 40% of the adult human population are asymptomatic carriers. In the CD46 transgenic mouse model, bacteria cannot be detected in the blood of healthy mice after i.n. infection and colonization. Instead, the bacteria directly reach the CSF in 15% of the mice, which is always linked to a lethal outcome. Therefore, to study meningococcal blood infection in healthy CD46 transgenic mice, i.p. infection was used. As shown by the results in Fig. 5A, the NhhA mutant was less virulent than the wild type. At day 3 postinfection, all mice challenged with wild-type bacteria had a lethal outcome, compared to 40% of the mice infected with the mutant. One major character of meningococcal disease is that bacteria pass the blood brain barrier and reach the CSF to cause meningitis. Therefore, we punctured the cisterna magna to measure bacterial counts in the CSF. Bacteria were detected in the CSF of all mice infected with the wild type, whereas they were detected in the CSF of only 30% of mice infected with the mutant (Fig. 5A). Further, the counts in blood of mice infected with the NhhA mutant were significantly lower than the counts in blood of mice infected with the wild-type (Fig. 5B). NhhA did not affect bacterial growth in vitro, as shown by the results in Fig. 2A, indicating that NhhA-deficient bacteria are more sensitive to host immune defenses. Thus, the expression of NhhA seems to be a survival advantage for bacteria in blood, leading to lethal sepsis in the host. Immunostimulatory properties of NhhA. Lethal sepsis is not only due to bacterial growth itself but also results from hypotension and organ failure characteristic of septic shock, which is the result of the excessive release of proinflammatory cytokines (38). The IL-6 and TNF responses at early time points were similar in mice infected with the wild-type or mutant strain, but at 24 h postinfection, significantly lower levels of cytokines were detected in mice infected with the ⌬NhhA

5416


INFECT. IMMUN.

FIG. 3. The ⌬NhhA mutant fails to colonize the nasal mucosa. CD46 transgenic mice (n ⫽ 10 per group) were challenged i.n. with strain FAM20 or ⌬NhhA mutant (108 CFU/mouse). (A) Bacterial colonization was determined by the recovery of bacteria from nasal washes collected at day 2 postinfection. Data are presented as means ⫾ standard errors of the means. The horizontal lines with the boxes represent mean values. Statistically significant lower bacterial count in comparison to count of the wild type is indicated with an asterisk (P ⬍ 0.05; nonparametric Mann-Whitney test). (B) At day 2 postchallenge, nasal tissue sections were collected and histologically examined. Tissue sections of mice infected with wild-type FAM20 (a), NhhA mutant (b), and PBS (c) were stained with pAbs against N. meningitidis (green) and monoclonal antibodies against mouse Gr-1 (red) to detect neutrophil-like cells. Cell nuclear DNA was stained with DAPI. Infiltrated neutrophil-like cells (red) were detected in the subapical layer of mucosa (a, d) and in the nasal cavity (b, e). Magnification, with a 40⫻ objective. Panels d to f show enlargements of the boxed areas in panels a to c. (C) Hematoxylin and eosin-stained mouse nasal tissue sections collected at day 2 postchallenge with strain FAM20 or ⌬NhhA mutant. Images show the luminal space in nasal cavity. Magnification, with a 20⫻ objective. Lower panels show higher magnification (⫻100) of the boxed areas in upper panels; arrows indicate infiltrated cells.

mutant (Fig. 6A and B). Thus, in spite of the differences in levels of bacteremia throughout the course of systemic infection (Fig. 5B), changes in the levels of cytokine activation were only significant 24 h after infection. Furthermore, both wildtype and mutant bacteria showed similar levels of KC production and stimulation of the influx of neutrophils/macrophages into the blood following infection (Fig. 6C and data not shown). Mouse serum levels of C5a, an anaphylotoxin generated upon the activation of the complement cascade, were also measured. Again, we could not identify any differences after challenge with each strain (Fig. 6D). We conclude from the

results of these experiments that NhhA is not involved in the induction of proinflammatory responses. NhhA contributes to serum resistance of N. meningitidis and protects bacteria from MAC deposition. The complement system is of central importance in the host innate immune defense against meningococcal proliferation in the circulation (25, 28). N. meningitidis has developed various mechanisms to evade complement attack and is therefore inherently more resistant to complement-mediated killing than other gram-negative pathogens (10, 13, 17, 32). We speculated that sensitivity of the ⌬NhhA mutant to complement might be a reason for its at-

VOL. 76, 2008


5417

FIG. 5. Attenuated virulence of the ⌬NhhA mutant during systemic infection. CD46 transgenic mice (n ⫽ 10 per group) were infected i.p. with strain FAM20 or ⌬NhhA mutant (108 CFU/mouse). (A) Mortality in infected mice and detection of bacteria in CSF are shown as percentages of total numbers of mice. Mice were monitored for seven days, and data are representative of the situation at day 3 for both wild-type infection and infection with mutant bacteria. Detection of bacteria in CSF was always associated with lethal disease. (B) Bacterial counts in blood (CFU/ml) were determined at 1 h, 4 h, 8 h, and 24 h postchallenge with each strain. Challenge with the ⌬NhhA mutant resulted in lower levels of bacteremia than challenge with the wild type at all tested time points. Error bars show standard deviations. Statistically significant lower bacteremia compared with bacteremia in mice infected with the wild type at each time point is indicated with an asterisk (P ⬍ 0.05; nonparametric Mann-Whitney test).

were observed with mouse serum or plasma (data not shown). As a further proof, recovery of the ⌬NhhA mutant was restored to wild-type levels in a complement factor C3-deficient serum (C3⫺/⫺). These results provide clear evidence that NhhA is required for the avoidance of complement-mediated

FIG. 4. Interactions of the ⌬NhhA mutant with phagocytic cells. (A) Immunofluorescence imaging of mouse macrophage cells after exposure to FITC-labeled strain FAM20 or ⌬NhhA mutant (MOI ⫽ 10) for 1 h. Cell nuclear DNA was stained with DAPI. Magnification, with a 63⫻ objective. (B) Results of flow cytometry showing phagocytosis of FITC-labeled strain FAM20 (gray-shaded histogram) or ⌬NhhA mutant (solid line) by mouse macrophages. Representative fluorescenceactivated cell sorter analysis results are shown. The number above each histogram represents the geometric mean fluorescence intensity of the entire population. (C) Survival of intracellular FAM20 or ⌬NhhA bacteria in mouse macrophages. Bacteria were incubated with macrophages for 1 h, extracellular bacteria were killed with gentamicin, and viable bacteria were enumerated by viable count. Error bars represent standard deviations. Statistically significant lower count compared with count of wild-type bacteria is indicated with an asterisk (P ⬍ 0.05; Student’s t test). (D) Production of IL-6 and TNF-␣ by mouse macrophages following exposure to strain FAM20 or ⌬NhhA mutant (MOI ⫽ 10) for 4 h, 8 h, and 24 h, as quantified by ELISA. There were no significant differences in IL-6 and TNF-␣ levels between cells exposed to wild-type and mutant bacteria as analyzed by Student’s t test.

tenuated virulence. We compared the resistance of each strain to complement-mediated killing. As shown in the results in Fig. 7A, the rate of survival of the mutant in normal human serum was almost 10 times less than that of the wild type (4% versus 35%), whereas no survival differences could be detected when heat-inactivated serum was applied. A complemented mutant regained a level of resistance to normal human serum similar to that of the wild-type strain (data not shown). Similar results

FIG. 6. Host inflammatory responses induced by the wild-type strain and the ⌬NhhA mutant. CD46 transgenic mice (n ⫽ 8 per group) were infected i.p. with strain FAM20 or ⌬NhhA mutant (108 CFU/mouse). Sera were collected at 1 h, 6 h, and 24 h postchallenge. Sera from noninfected mice were collected as control (0 h). Levels of induction of IL-6 (A), TNF (B), KC (C), and C5a (D) in sera were quantified by ELISA. Error bars show standard deviations. Statistically significant lower levels compared with levels in sera of mice infected with the wild type at each time point are indicated with an asterisk (P ⬍ 0.05; Student’s t test).

5418


FIG. 7. NhhA is required for bacterial resistance to complementmediated killing. (A) Sensitivity of the wild-type strain and the ⌬NhhA mutant to complement-mediated killing in heat-inactivated serum (HIS), normal human serum (NHS), and complement factor C3-deficient human serum (C3⫺/⫺). Bacterial survival is expressed as percentage of bacteria recovered from the initial inoculation dose (T ⫽ 0), which was set as 100%. (B) Deposition of MAC onto FAM20 and ⌬NhhA mutant bacteria was determined by flow cytometry with a rabbit anti-C5-9 pAb. The number beside each histogram represents the geometric mean fluorescence intensity of the entire population. (C) Proportion of FAM20 or ⌬NhhA mutant bacteria with positive MAC binding determined by flow cytometry. Data are shown as percentages of total bacterial populations. Statistically significant difference compared to the MAC binding of wild type FAM20 bacteria is indicated with an asterisk (P ⬍ 0.05; Student’s t test).

killing. Thus, during systemic infection NhhA influences the progression of disease through its capacity to prevent complement-mediated killing and phagocytosis. Complement activation leads to cleavage of C3 to C3b, which is followed by opsonophagocytosis and bacteriolysis induced by MAC assembled on the bacterial surface. To address the mechanisms that make the ⌬NhhA mutant more sensitive to complement-mediated killing, we examined the surface deposition of MAC on wild-type and mutant bacteria by flow cytometry. The ⌬NhhA mutant was more accessible to MAC binding (Fig. 7B). Furthermore, deposition of MAC was detected in a significantly larger proportion of the mutant bacteria (56%) than of the wild-type bacteria (44%) (Fig. 7C). Thus, increased complement deposition on the mutant strain is consistent with enhanced serum sensitivity. DISCUSSION NhhA is a surface-exposed outer membrane protein which exists among all tested pathogenic Neisseria strains (26, 27). The high conservation of NhhA among a broad range of meningococcal strains implies a critical role in the bacterial pathophysiology. Although NhhA has been proposed as an adhesin, little is known about the involvement of this protein in meningococcal disease. By generating an isogenic NhhA-deficient strain and using a mouse model of meningococcal disease, we investigated the impact of this protein on bacterial pathogen-

INFECT. IMMUN.

esis in vivo and demonstrated a determining role of NhhA in bacterial colonization and systemic disease development. Colonization of the human nasopharyngeal mucosa is the first step of the host-meningococcal interaction and eventually leads to invasive disease. We observed that NhhA mediates bacterial attachment to cells in vitro, which supports the results of previous studies (31). However, the bacterium-cell interaction mediated by NhhA seems to be cell-type dependent, indicating that other bacterial factors contribute to attachment or that the availability of the NhhA receptors, such as heparan sulfate, differs among cell lines. The adhesive character of NhhA in disease pathogenesis was further investigated in a mouse experimental model. Bacteria lacking NhhA showed reduced capability to colonize the nasal mucosa. Thus, the results of both in vitro and in vivo analysis demonstrated that NhhA contributes to mucosal colonization, the critical initial step in meningococcal pathogenesis. Meningococcal surface components induce excessive host inflammatory response, the level of which correlates with the severity of disease (11). An unexpected finding was that both the wild-type and the ⌬NhhA mutant induced similar local inflammatory responses at the nasal mucosa, including the recruitment of neutrophils to the mucosal surface and the production of cytokines and chemokines. This synergistic response of the respiratory epithelium led us to address whether phagocyte-mediated killing could be involved in the clearance of colonizing bacteria from the mucosal surface. The results of the analysis of phagocytosis showed that the uptake and intracellular killing by murine macrophages of the NhhA mutant were more efficient than the macrophage uptake and killing of wild-type bacteria (Fig. 4), which could explain the lower colonization levels of the mutant. Also, in systemic infection, the mutant was attenuated in disease manifestations. NhhA did not contribute to IL-6 and TNF inflammatory responses in blood at early time points and did not activate C5a of the complement cascade. The difference in inflammatory response observed at 24 h postinfection is likely a result of different levels of bacteremia, since the wild-type strain showed higher bacterial counts in the blood, as well as stronger induction of IL-6 and TNF at 24 h postinfection. These data taken together support the conclusion that NhhA is not a determinant factor in stimulating the host inflammatory response. Both the wild type and the mutant were detected in the CSF of infected mice, indicating that NhhA is most likely not essential for bacterial invasion through the blood brain barrier. However, we cannot exclude the possibility that the entry of the ⌬NhhA mutant into the CSF is a result of sepsis-induced cell damage of the blood brain barrier. Survival of the bacteria when exposed to host defenses within the circulation is a prerequisite for meningococcal disease. Complement-mediated opsonophagocytosis and bacteriolysis is a major host defense against N. meningitidis. Patients deficient in complement components, especially C5 to C9, are susceptible to meningococcal disease (28). Several mechanisms are used by N. meningitidis to evade killing by human complement, including the prevention of MAC insertion into the bacterial membrane and the recruitment of negative complement regulators (17, 32). Infection with an N. meningitidis mutant lacking NhhA resulted in lower bacteremia levels than infection with the wild type. Reduced bacterial loads in the

VOL. 76, 2008


circulation correlated with lighter host inflammatory response that led to increased rates of survival of mice. The ⌬NhhA mutant and the wild-type strain showed similar growth rates in vitro, suggesting that NhhA is not a critical factor for optimal bacterial proliferation. This led us to examine if NhhA conferred resistance to innate immune defenses, such as complement attack. Indeed, the deposition of MAC onto the surface of the ⌬NhhA mutant was enhanced, as detected by flow cytometry. Since the survival of the mutant was restored to wildtype levels in a complement-deficient system (Fig. 7A), we conclude that sensitivity to innate immune killing, rather than reduced growth, is responsible for the attenuated virulence of the mutant. Further, the transcription of the nhhA gene was upregulated and the protein level was increased upon bacterial interaction with the cells, which could further help to enhance resistance to complement-mediated killing. The finding that NhhA is a surface component that mediates serum resistance suggests a dual protective mechanism by a possible vaccine developed from this conserved outer membrane protein. In conclusion, this study reveals important pathological roles of NhhA in meningococcal disease. The data demonstrate a multifaceted function of NhhA in the protection of meningococci against host innate immune defense, including complement-mediated killing and phagocytosis.

12.

13.

14. 15.

16.

17.

18.

19.

20.

21.

ACKNOWLEDGMENTS This work was supported by grants from The Swedish Research Council (Dnr 2007-3369, 2004-4831, 2002-6240, 2006-4112, 2006-5073, 2006-2911, and 2006-6304), Swedish Cancer Society, Magnus Bergvalls Foundation, Åke Wibergs Stiftelse, Swedish Society for Medicine, Torsten och Ragnar So ¨derbergs Stiftelse, Knut och Alice Wallenbergs Stiftelse, Petrus och Augusta Hedlunds Stiftelse, Tore Nilsons Stiftelse, Stiftelsen Goljes Minne, Stiftelsen Lars Hiertas Minne, Seda och Signe Hermanssons Stiftelse, Stiftelsen Sigurd och Elsa Goljes minne, Laerdal Foundation for Acute Medicine, and Uppsala University.

22.

REFERENCES

26.

1. Albiger, B., L. Johansson, and A. B. Jonsson. 2003. Lipooligosaccharidedeficient Neisseria meningitidis shows altered pilus-associated characteristics. Infect. Immun. 71:155–162. 2. Barnes, M. G., and A. A. Weiss. 2001. BrkA protein of Bordetella pertussis inhibits the classical pathway of complement after C1 deposition. Infect. Immun. 69:3067–3072. 3. Capecchi, B., J. Adu-Bobie, F. Di Marcello, L. Ciucchi, V. Masignani, A. Taddei, R. Rappuoli, M. Pizza, and B. Arico. 2005. Neisseria meningitidis NadA is a new invasin which promotes bacterial adhesion to and penetration into human epithelial cells. Mol. Microbiol. 55:687–698. 4. Cattaneo, R. 2004. Four viruses, two bacteria, and one receptor: membrane cofactor protein (CD46) as pathogens’ magnet. J. Virol. 78:4385–4388. 5. Comanducci, M., S. Bambini, B. Brunelli, J. Adu-Bobie, B. Arico, B. Capecchi, M. M. Giuliani, V. Masignani, L. Santini, S. Savino, D. M. Granoff, D. A. Caugant, M. Pizza, R. Rappuoli, and M. Mora. 2002. NadA, a novel vaccine candidate of Neisseria meningitidis. J. Exp. Med. 195:1445–1454. 6. Deghmane, A. E., D. Giorgini, M. Larribe, J. M. Alonso, and M. K. Taha. 2002. Down-regulation of pili and capsule of Neisseria meningitidis upon contact with epithelial cells is mediated by CrgA regulatory protein. Mol. Microbiol. 43:1555–1564. 7. Dietrich, G., S. Kurz, C. Hubner, C. Aepinus, S. Theiss, M. Guckenberger, U. Panzner, J. Weber, and M. Frosch. 2003. Transcriptome analysis of Neisseria meningitidis during infection. J. Bacteriol. 185:155–164. 8. Edwards, J. L., and M. A. Apicella. 2005. I-domain-containing integrins serve as pilus receptors for Neisseria gonorrhoeae adherence to human epithelial cells. Cell. Microbiol. 7:1197–1211. 9. Edwards, J. L., E. J. Brown, K. A. Ault, and M. A. Apicella. 2001. The role of complement receptor 3 (CR3) in Neisseria gonorrhoeae infection of human cervical epithelia. Cell. Microbiol. 3:611–622. 10. Estabrook, M. M., J. M. Griffiss, and G. A. Jarvis. 1997. Sialylation of Neisseria meningitidis lipooligosaccharide inhibits serum bactericidal activity by masking lacto-N-neotetraose. Infect. Immun. 65:4436–4444. 11. Faber, J., C. U. Meyer, C. Gemmer, A. Russo, A. Finn, C. Murdoch, W. Zenz,

23.

24. 25.

27.

28.

29.

30.

31.

32.

33.

34.

5419

C. Mannhalter, B. U. Zabel, H. J. Schmitt, P. Habermehl, F. Zepp, and M. Knuf. 2006. Human toll-like receptor 4 mutations are associated with susceptibility to invasive meningococcal disease in infancy. Pediatr. Infect. Dis. J. 25:80–81. Fink, D. L., A. Z. Buscher, B. Green, P. Fernsten, and J. W. St. Geme III. 2003. The Haemophilus influenzae Hap autotransporter mediates microcolony formation and adherence to epithelial cells and extracellular matrix via binding regions in the C-terminal end of the passenger domain. Cell. Microbiol. 5:175–186. Geoffroy, M. C., S. Floquet, A. Metais, X. Nassif, and V. Pelicic. 2003. Large-scale analysis of the meningococcus genome by gene disruption: resistance to complement-mediated lysis. Genome Res. 13:391–398. Henderson, I. R., and J. P. Nataro. 2001. Virulence functions of autotransporter proteins. Infect. Immun. 69:1231–1243. Hendrixson, D. R., and J. W. St. Geme III. 1998. The Haemophilus influenzae Hap serine protease promotes adherence and microcolony formation, potentiated by a soluble host protein. Mol. Cell 2:841–850. Hopper, S., B. Vasquez, A. Merz, S. Clary, J. S. Wilbur, and M. So. 2000. Effects of the immunoglobulin A1 protease on Neisseria gonorrhoeae trafficking across polarized T84 epithelial monolayers. Infect. Immun. 68:906– 911. Jarva, H., S. Ram, U. Vogel, A. M. Blom, and S. Meri. 2005. Binding of the complement inhibitor C4bp to serogroup B Neisseria meningitidis. J. Immunol. 174:6299–6307. Johansson, L., A. Rytkonen, P. Bergman, B. Albiger, H. Kallstrom, T. Hokfelt, B. Agerberth, R. Cattaneo, and A. B. Jonsson. 2003. CD46 in meningococcal disease. Science 301:373–375. Johansson, L., A. Rytkonen, H. Wan, P. Bergman, L. Plant, B. Agerberth, T. Hokfelt, and A. B. Jonsson. 2005. Human-like immune responses in CD46 transgenic mice. J. Immunol. 175:433–440. Kallstrom, H., M. S. Islam, P. O. Berggren, and A. B. Jonsson. 1998. Cell signaling by the type IV pili of pathogenic Neisseria. J. Biol. Chem. 273: 21777–21782. Kallstrom, H., M. K. Liszewski, J. P. Atkinson, and A. B. Jonsson. 1997. Membrane cofactor protein (MCP or CD46) is a cellular pilus receptor for pathogenic Neisseria. Mol. Microbiol. 25:639–647. Kellogg, D. S., Jr., I. R. Cohen, L. C. Norins, A. L. Schroeter, and G. Reising. 1968. Neisseria gonorrhoeae. II. Colonial variation and pathogenicity during 35 months in vitro. J. Bacteriol. 96:596–605. Lipsitch, M., J. K. Dykes, S. E. Johnson, E. W. Ades, J. King, D. E. Briles, and G. M. Carlone. 2000. Competition among Streptococcus pneumoniae for intranasal colonization in a mouse model. Vaccine 18:2895–2901. Merz, A. J., and M. So. 2000. Interactions of pathogenic neisseriae with epithelial cell membranes. Annu. Rev. Cell Dev. Biol. 16:423–457. Morgan, B. P., K. J. Marchbank, M. P. Longhi, C. L. Harris, and A. M. Gallimore. 2005. Complement: central to innate immunity and bridging to adaptive responses. Immunol. Lett. 97:171–179. Peak, I. R., Y. Srikhanta, M. Dieckelmann, E. R. Moxon, and M. P. Jennings. 2000. Identification and characterisation of a novel conserved outer membrane protein from Neisseria meningitidis. FEMS Immunol. Med. Microbiol. 28:329–334. Pizza, M., V. Scarlato, V. Masignani, M. M. Giuliani, B. Arico, M. Comanducci, G. T. Jennings, L. Baldi, E. Bartolini, B. Capecchi, C. L. Galeotti, E. Luzzi, R. Manetti, E. Marchetti, M. Mora, S. Nuti, G. Ratti, L. Santini, S. Savino, M. Scarselli, E. Storni, P. Zuo, M. Broeker, E. Hundt, B. Knapp, E. Blair, T. Mason, H. Tettelin, D. W. Hood, A. C. Jeffries, N. J. Saunders, D. M. Granoff, J. C. Venter, E. R. Moxon, G. Grandi, and R. Rappuoli. 2000. Identification of vaccine candidates against serogroup B meningococcus by whole-genome sequencing. Science 287:1816–1820. Rosa, D. D., A. C. Pasqualotto, M. de Quadros, and S. H. Prezzi. 2004. Deficiency of the eighth component of complement associated with recurrent meningococcal meningitis: case report and literature review. Braz. J. Infect. Dis. 8:328–330. Rytkonen, A., B. Albiger, P. Hansson-Palo, H. Kallstrom, P. Olcen, H. Fredlund, and A. B. Jonsson. 2004. Neisseria meningitidis undergoes PilC phase variation and PilE sequence variation during invasive disease. J. Infect. Dis. 189:402–409. Sahlin, S., J. Hed, and I. Rundquist. 1983. Differentiation between attached and ingested immune complexes by a fluorescence quenching cytofluorometric assay. J. Immunol. Methods 60:115–124. Scarselli, M., D. Serruto, P. Montanari, B. Capecchi, J. Adu-Bobie, D. Veggi, R. Rappuoli, M. Pizza, and B. Arico. 2006. Neisseria meningitidis NhhA is a multifunctional trimeric autotransporter adhesin. Mol. Microbiol. 61:631– 644. Schneider, M. C., R. M. Exley, H. Chan, I. Feavers, Y. H. Kang, R. B. Sim, and C. M. Tang. 2006. Functional significance of factor H binding to Neisseria meningitidis. J. Immunol. 176:7566–7575. Schubert-Unkmeir, A., O. Sokolova, U. Panzner, M. Eigenthaler, and M. Frosch. 2007. Gene expression pattern in human brain endothelial cells in response to Neisseria meningitidis. Infect. Immun. 75:899–914. Serruto, D., J. Adu-Bobie, M. Scarselli, D. Veggi, M. Pizza, R. Rappuoli, and

5420

35. 36. 37. 38. 39.


B. Arico. 2003. Neisseria meningitidis App, a new adhesin with autocatalytic serine protease activity. Mol. Microbiol. 48:323–334. Sjolinder, H., and A. B. Jonsson. 2007. Imaging of disease dynamics during meningococcal sepsis. PLoS ONE 2:e241. Tzeng, Y. L., and D. S. Stephens. 2000. Epidemiology and pathogenesis of Neisseria meningitidis. Microbes Infect. 2:687–700. Van Amersfoort, E. S., and J. A. Van Strijp. 1994. Evaluation of a flow cytometric fluorescence quenching assay of phagocytosis of sensitized sheep erythrocytes by polymorphonuclear leukocytes. Cytometry 17:294–301. van Deuren, M., P. Brandtzaeg, and J. W. van der Meer. 2000. Update on meningococcal disease with emphasis on pathogenesis and clinical management. Clin. Microbiol. Rev. 13:144–166. Virji, M., H. Kayhty, D. J. Ferguson, C. Alexandrescu, J. E. Heckels, and

Editor: J. N. Weiser

INFECT. IMMUN. E. R. Moxon. 1991. The role of pili in the interactions of pathogenic Neisseria with cultured human endothelial cells. Mol. Microbiol. 5:1831–1841. 40. Virji, M., K. Makepeace, D. J. Ferguson, M. Achtman, and E. R. Moxon. 1993. Meningococcal Opa and Opc proteins: their role in colonization and invasion of human epithelial and endothelial cells. Mol. Microbiol. 10:499– 510. 41. Virji, M., K. Makepeace, D. J. Ferguson, M. Achtman, J. Sarkari, and E. R. Moxon. 1992. Expression of the Opc protein correlates with invasion of epithelial and endothelial cells by Neisseria meningitidis. Mol. Microbiol. 6:2785–2795. 42. Yazdankhah, S. P., and D. A. Caugant. 2004. Neisseria meningitidis: an overview of the carriage state. J. Med. Microbiol. 53:821–832.