Mesenchymal stem cells regulate epithelial– mesenchymal transition and tumor progression of pancreatic cancer cells Ayano Kabashima-Niibe,1,8 Hajime Higuchi,1,7 Hiromasa Takaishi,1 Yohei Masugi,2 Yumi Matsuzaki,3 Yo Mabuchi,3 Shinsuke Funakoshi,1 Masayuki Adachi,1 Yasuo Hamamoto,1 Shigeyuki Kawachi,4 Koichi Aiura,5 Yuko Kitagawa,6 Michiie Sakamoto2 and Toshifumi Hibi1 1
Division of Gastroenterology, Department of Internal Medicine; Departments of 2Pathology, 3Physiology, Keio University School of Medicine, Tokyo; Department of Digestive Surgery and Transplantation Surgery, Tokyo Medical University Hachioji Medical Center, Tokyo; 5Department of Surgery, Kawasaki Municipal Hospital, Kanagawa; 6Department of Surgery, Keio University School of Medicine, Tokyo, Japan 4
(Received July 2, 2012 ⁄ Revised October 16, 2012 ⁄ Accepted October 23, 2012 ⁄ Accepted manuscript online November 2, 2013 ⁄ Article first published online January 11, 2013)
Cancer-associated fibroblasts contribute to cancer progression that is caused by epithelial–mesenchymal transition (EMT). Recently, mesenchymal stem cells (MSCs) were found to be the major candidate involved in the development of tumor-promoting cancer stroma. Here we report that a-smooth muscle actin-positive myofibroblast-like cells originating from MSCs contribute to inducing EMT in side population cells of pancreatic cancer. More importantly, MSC-derived myofibroblasts function to maintain tumorinitiating stem cell-like characteristics, including augmenting expression levels of various stemness-associated genes, enhancing sphere- forming activity, promoting tumor formation in a mouse xenograft model, and showing resistance to anticancer drugs. Furthermore, both c-secretase inhibitor and siRNA directed against Jagged-1 attenuated MSC-associated E-cadherin suppression and sphere formation in pancreatic cancer side population cells. Thus, our results suggest that MSC-derived myofibroblasts play important roles in regulating EMT and tumor-initiating stem cell-like properties of pancreatic cancer cells through an intermediating Notch signal. (Cancer Sci 2013; 104: 157–164)
D
uring tumor progression, epithelial–mesenchymal transition (EMT) contributes considerably to the malignant characteristics of tumors such as local invasion and distant metastasis.(1,2) Epithelial–mesenchymal transition has recently been reported as the key phenomenon that tightly regulates the stem cell-like characteristics of both normal and malignant cells.(3,4) Side population (SP) technology has been widely used to isolate the stem cell-enriched fraction in a variety of tissue. Side population cells are detected by their own ability to efflux Hoechst33342 dye through an ATP-binding cassette membrane transporter. We recently found that SP cells from pancreatic cancer cells are highly responsive to transforming growth factor-b (TGF-b)-mediated EMT, invasion, and metastasis.(5) Our results suggest that SP cells are enriched with cells that undergo mesenchymal–epithelial transition (MET) after TGF-b-associated EMT. Thus, our results indicated that an EMT ⁄ MET conversion is tightly linked to malignant potential in pancreatic cancer, such as invasion ⁄ metastasis. However, the mechanisms by which the EMT ⁄ MET status is regulated within a tumor in vivo remains undetermined. The tumor microenvironment consists of various stromal cells, including tumor-associated fibroblasts, endothelial cells, pericytes, adipocytes, and immune cells.(6) Among these cell types, cancer-associated fibroblasts (CAFs) and/or myofibroblasts have been recently implicated in regulating tumor progression, invasion, and metastasis.(7,8) Cancer-associated fibroblasts and myofibroblasts secrete a number of important inflammatory doi: 10.1111/cas.12059 © 2012 Japanese Cancer Association
mediators, including MMP-2, -3, and -9, that can alter the stromal ECM and potentiate invasion, cell motility, and metastasis.(9,10) Recently, bone marrow-derived a-smooth muscle actin (a-SMA)-positive myofibroblast-like cells have been reported to contribute to cancer progression within tumor tissue.(11) Using a mouse model of inflammation-induced gastric cancer, Quante et al.(11) showed that at least 20% of CAFs originate from bone marrow and are derived from mesenchymal stem cells (MSCs). Thus, although the origin of CAFs and ⁄ or myofibroblasts remains unknown, these recent studies suggest that MSCs derived from either bone marrow or local tissues may partly contribute to the origin of CAFs or tumor-associated myofibroblasts. In this study, we investigated whether MSCs enhance tumor formation using pancreatic cancer cell–MSC co-implantation models. We hypothesized that MSCs and ⁄ or MSC-derived myofibroblast-like cells regulate both EMT ⁄ MET and tumorinitiating stem cell-like characteristics of pancreatic cancer. We performed both in vitro co-culturing experiments and in vivo co-injection experiments to identify the roles of MSCs in pancreatic cancer progression. We found that MSCs contributed to the regulation of both EMT status and maintenance of so-called tumor-initiating stem cell (TISC)-like characteristics among pancreatic cancer cells. We focused on pancreatic cancer cells because pancreatic cancer is one of the aggressive cancers characterized by relatively large amounts of stroma within tumor tissue. Although some mechanisms and mediators are known to contribute to cancer cell–stromal cell interactions, we found that the Notch-associated signal appeared to contribute to the regulation of EMT ⁄ stemness by MSCs. The interactions between cancer cells and MSCs and ⁄ or MSC-derived myofibroblast-like cells could be an important target to prevent tumor progression, invasion, and metastasis in pancreatic cancer. Materials and Methods Cells and cell culturing. Pancreatic cancer PANC-1 cells were obtained from ATCC (Manassas, VA, USA). The MIAPaCa2 cell lines were obtained from the Health Science Research Resources Bank (Osaka, Japan). These cell lines are tested and authenticated by short tandem repeat profiling analysis. The MSCs were isolated from human bone marrow (Lonza, Walkersville, MD, USA). The PANC-1 and MIAPaCa2 cells were grown in DMEM (Sigma, St. Louis, MO, USA). All media were supplemented with 10% FBS and penicillin. Isolated 7 To whom all correspondence should be addressed. E-mail:
[email protected] 8 Research Fellow of the Japan Society for the Promotion of Science.
Cancer Sci | February 2013 | vol. 104 | no. 2 | 157–164
MSCs were cultured in prime DMEM (Invitrogen, Carlsbad, CA, USA) supplemented with 20% FBS, penicillin, and 10 ng ⁄ mL basic fibroblast growth factor. Surgically resected pancreatic tissues (pancreatic cancer tissues or adjacent non-tumor tissues) were chopped into fragments and disrupted with 2 mg ⁄ mL collagenase L (Nitta Gelatin, Osaka, Japan) for 2 h at 37°C. Subsequently, cells were washed three times with Hanks’ balanced salt solution containing 2% FBS. To exclude epithelial cells, cultured cells were labeled with anti-Ber-EP4 (Dako, Glostrup, Denmark) and anti-mouse IgG MicroBeads (Miltenyi Biotec, Auburn, CA, USA). Non-epithelial cells were collected as stromal cells using MACS technology (Miltenyi Biotec) according to instructions. Purified stromal cells were cultured in DMEM. This study was carried out with the approval of the Ethics Committee of the Keio University School of Medicine (No. 20040034; Tokyo, Japan). Flow cytometry. Isolation methods for SP cells and main population (MP) cells that include high Hoechst33342 fluorescence have been described previously.(5) In brief, after the Hoechst3342 staining procedure, the cell fraction with high fluorescent intensity was identified as a majority of total cells, or MP cells. Side population cells were also identified as the cells that exclude Hoechst33342 dye by their enhanced ATPbinding cassette transporter activities.(5) To isolate MSCs, mononuclear cells from bone marrow were labeled with CD271 and CD90 antibodies. Labeled cells were analyzed using a Moflo flow cytometer (Beckman, Brea, CA, USA), and double-positive cells were sorted. Xenograft experiments. Stromal cells and cancer cells were mixed, resuspended in 100 lL saline, and injected s.c. into 6-weekold male NOD ⁄ SCID mice (Charles River Laboratories International, Kanagawa, Japan) under anesthesia. Tumor diameters were measured weekly using a caliper. Tumor volumes were determined by the following formula: volume = 0.52 9 length 9 width2. Coculturing with MSCs. Indirect coculture. Prior to coculturing, MSCs were pre-treated with TGF-b for 3 days. We used Transwell chambers (Corning, Tewksbury, MA, USA). Transforming growth factor-b-treated stromal cells were plated into the upper chamber, and cancer cells were plated into the lower chamber. Direct coculture. To allow re-isolation of cancer cells and stromal cells, PANC-1 cells were labeled with GFP by retroviral infection. Then, 1 9 105 TGF-b-treated cells (stromal cells) and 5 9 104 cells (cancer cells) per well in a 6-well plate were cultured for an appropriate time period. Subsequently, cocultured cells were resorted into GFP-positive cancer cells and GFP-negative stromal cells. Notch reporter gene analysis. A Notch reporter system was constructed as described previously.(12) The constructs with tandem repeat of RBJ-binding sequences were followed by the dVenus gene. The constructed reporter vector was transfected to PANC-1 cells using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s instructions. Forty-eight hours after transfection, Geneticin (100 lg ⁄ mL; Roche, Mannheim, Germany) was added. Transfected PANC-1 (Notch-PANC-1) cells were grown in the presence of Geneticin. To distinguish cancer cells and MSCs, TGF-b-treated MSCs (Tb-MSCs) were labeled with PKH26 dye (Sigma) according to instructions. Notch-PANC-1 SP cells or MP cells and PKH26 dye-labeled Tb-MSCs were cocultured directly for 3 days. The Notch-associated dVenus fluorescence was observed by flow cytometry. Statistical analysis. Results are given as the mean SD from at least three experiments. Statistical comparisons were by Student’s t-test. Significant P-values are denoted by asterisks. Results Transforming growth factor-b treated MSCs enhance pancreatic cancer cell tumor progression. We first evaluated the effects of
158
co-incubation with MSCs on the tumor-forming activity of pancreatic cancer cell lines. The MSCs were isolated from human bone marrow using CD90 and CD271 surface markers (Mabuchi et al., submitted).(13,14) We compared the in vivo tumor volumes in the dorsal regions of mice after injecting either cancer cells alone or cancer cells that had been cocultured with MSCs. Unexpectedly, although coculturing with na€ıve MSCs (untreated) modestly enhanced tumor formation of pancreatic cancer cells, there were no dramatic differences between cancer cells alone and cancer cells plus na€ıve MSCs (data not shown). However, pretreatment of MSCs with TGF-b dramatically enhanced tumor volumes after co-injecting these cells into mice as compared with injecting either cancer cells alone or na€ıve MSCs plus cancer cells. Na€ıve MSCs or Tb-MSCs (1 9 105cells) and cancer cells (5 9 104 cells) were implanted into NOD ⁄ SCID mice, after which tumor volumes were measured weekly. After 8 weeks, s.c. tumors injected with Tb-MSCs showed a high rate of tumor growth compared with those injected with na€ıve MSCs (Fig. 1a). These results suggested that MSCs or MSC-derived cells enhanced tumor formation in pancreatic cancer cells. Transforming growth factor-b may alter the phenotypes of MSCs, and may make them suitable as cancer-associated stromal cells. Indeed, when MSCs were treated with TGF-b for 3 days, they showed morphological changes and became spatulate in appearance (Fig. 1b). To test whether Tb-MSCs attained a phenotype of cancer-associated stromal cells, we examined the expressions of cancerassociated stromal cells markers such as a-SMA, tenascin C, and podoplanin (PDPN) by immunoblotting (Fig. 1c). The Tb-MSCs expressed a-SMA, tenascin C, and PDPN proteins, whereas na€ıve control cells did not. Interestingly, the expression profiles of these stromal cell-associated proteins were similar to those of cancer-associated stromal cells isolated from surgically resected pancreatic cancer tissue samples (Fig. 1c). We next evaluated the expression and localization of a-SMA-positive cells in clinical pancreatic cancer specimens. Positive staining of stromal cells for a-SMA was primarily localized in the area where cancer ducts lost well-defined glandular structures. Interestingly, the intensity of a-SMA staining showed a heterogeneous pattern, which we identified as a-SMA-low expression areas and a-SMA-high expression areas, as shown in Figure 1(d). In the a-SMA-high expression areas, cancer cells with liner membranous E-cadherin expression were rarely observed, whereas these areas were rich in vimentin-positive cells (Fig. 1d). The E-cadherin-negative ⁄ vimentin-positive cancer cells, which were solitary infiltrating cancer cells that had undergone EMT, were predominantly localized in the a-SMA-high expression areas (Fig. 1d, black arrows). Based on these results, we hypothesized that a-SMApositive myofibroblast-like cells are associated with solitary infiltrating cancer cells that have undergone EMT. Mesenchymal stem cells and/or MSC-derived myofibroblast-like cells induce EMT predominantly in pancreatic cancer SP cells.
There is an increasing body of evidence that cancer-associated stromal cells have the potential for inducing EMT and are involved in micro-invasion and metastasis. Thus, we hypothesized that Tb-MSC-mediated tumor progression is associated with inducing EMT. We previously reported that SP cells, a fraction that is enriched with so-called TISCs, predominantly undergo EMT ⁄ MET in association with invasion ⁄ metastasis.(5) Thus, we investigated whether MSCs and ⁄ or MSC-derived myofibroblastlike cells could induce EMT in pancreatic cancer SP cells. We first used an indirect coculturing system with Transwell culture chambers. A total of 1 9 105 Tb-MSCs were placed in the upper chamber and 1 9 104 PANC-1 SP or MP cells were placed in the lower chamber. After 5 days of culturing, the shape of SP cells changed to spindle-like and their cell–cell contacts became very loose. These changes were not observed in MP cells doi: 10.1111/cas.12059 © 2012 Japanese Cancer Association
PANC-1 + MSCs 120
MIAPaCa + MSCs
PANC+ MSC(ctrl)
100
Tumor volume (mm3)
Tumor volume (mm3)
(A)
PANC+ MSC(TGF)
80 60 40 20 0 1
2
3
4
6
120
MIA+MSC(ctrl)
100
MIA+MSC(TGF)
80 60 40 20 0 1
8
Time (weeks)
(B)
Naïve MSCs
2
3
4
6
8
Time (weeks)
TGF-β treated MSCs
(C)
Naïve TGF-β Normal Tumor
α-SMA Tenascin C PDPN Actin MSCs
H&E
α-SMA
E-cadherin
Vimentin
αSMA low αSMA high expression area (x20) expression area (x10)
Low magnification (x4)
(D)
Clinical specimen
Fig. 1. (a) Pancreatic cell lines were injected into NOD ⁄ SCID mice along with na€ıve (untreated) mesenchymal stem cells (MSCs) or MSCs pretreated with 7.5 ng ⁄ mL transforming growth factor (TGF)-b (Tb-MSCs) (n = 3). (b) Morphological appearance of na€ıve MSCs and Tb-MSCs. Scale bar = 200 lm. (c) Markers of tumor-associated stromal cells were detected by immunoblotting. Stromal cells isolated from tumor tissues were labeled as “Tumor”. Stromal cells isolated from non-tumor regions of surgical specimens were labeled as “Normal”. (d) Immunohistochemistry results for a-smooth muscle actin (a-SMA) and epithelial–mesenchymal transition-associated proteins in pancreatic cancer tissues from clinical specimens. Alpha-SMA high expression areas or low expression areas were marked by white squares. Left squares are a-SMA-low expression areas and right squares are a-SMA high expression areas (94). PDPN, podoplanin.
(Fig. 2a). In addition, real-time PCR showed that coculturing with Tb-MSCs resulted in a significant reduction in E-cadherin expression and other EMT-associated gene alterations, including increased expressions of Slug and MMP-9 (primer sequences are shown in Table 1). Interestingly, these EMT-associated alterations were greater in SP cells than in MP cells (Fig. 2b). These results suggested that factors released from MSCs and ⁄ or MSCderived myofibroblasts might contribute to inducing EMT in pancreatic cancer cells. As expected, the potential to undergo EMT was greater in SP cells. We further evaluated the cell–cell interactions between cancer cells and Tb-MSCs using a direct coculturing system, with 1 9 105 Tb-MSCs and 5 9 104 GFP-labeled PANC-1 (GFPKabashima-Niibe et al.
PANC-1) cells cultured in 6-well plates. Cancer cells were located between or alongside Tb-MSCs (Fig. 2c). During the coculturing period, the cancer cells appeared to grow toward the inner cavity surrounded by Tb-MSCs. Interestingly, the cancer cells located close to the Tb-MSCs possibly adopted spindle shapes (Fig. 2c, black arrow), whereas those cancer cells located away from the Tb-MSCs appeared to be epithelial. Thus, we carried out immunostaining for E-cadherin as described in Data S1. As expected, GFP-labeled cancer cells that directly contacted Tb-MSCs lost E-cadherin expression (Fig. 2d, white arrow), whereas E-cadherin-positive staining was detected for only those cancer cells that were located away from the Tb-MSCs. Interestingly, these findings were Cancer Sci | February 2013 | vol. 104 | no. 2 | 159 © 2012 Japanese Cancer Association
(A)
MP
SP Coculture (Transwell)
Ctrl
Relative mRNA levels
(B)
E-cadherin 6 5 4 3 2 1 0 MSC – + SP
Snail
*
8 6
*
* –
+ MP
6
4
5 4
3
4
*
2 0 MSC – + SP
α-SMA/DAPI
–
MMP-9
5
2
*
* *
3 2
1
0 + MSC – + MP SP
–
+ MP
GFP
(C)
1 0 MSC – + SP
–
+ MP
E-cadherin
Merged
Tb- MSCs
Naïve MSCs
(D)
Slug 10
Coculture (Transwell)
Ctrl
Fig. 2. (a) Pancreatic cancer PANC-1 cells were cocultured with transforming growth factor-b treated mesenchymal stem cells (Tb-MSCs) for 5 days using Transwell chambers. Representative images are shown for the morphologies of cocultured cancer cells. (b) Epithelial–mesenchymal transition-associated mRNA expression changes were evaluated by quantitative real-time PCR analysis. All results are the mean SD from at least three independent experiments. *P < 0.05. (c) Side population (SP) and main population (MP) cells were isolated from GFP-labeled PANC-1 cells. Cancer cell cohesion with Tb-MSCs showed a mesenchymal cell-like appearance (black arrow), and it grew toward the inner space surrounded by Tb-MSCs with an epithelial appearance. (d) E-cadherin (Alexa555, red) and a-smooth muscle actin (a-SMA) (Alexa350, blue) expression were assessed by immunofluorescent staining. Cancer cells are stained green (GFP).
Table 1. Primer sequences used in this study Primer E-cadherin Slug Snail MMP-9
Forward Sequence 5´–3´
Reverse Sequence 5´–3´
TGCCCAGAAAATGAAAAAGG TTCGGACCCACACATTACCT GCTCCTTCGTCCTTCTCCTC CCTGGAGACCTGAGAACCAA
GGATGACACAGCGTGAGAGA CTGGAGAAGGTTTTGGAGCA TGACATCTGAGTGGGTCTGG GACACCAAACTGGATGACGA
more obvious in GFP-PANC-1 cells cocultured with Tb-MSCs compared to GFP-PANC-1 cells cocultured with na€ıve MSCs. Coculturing with Tb-MSCs enhances so-called TISC-like properties in pancreatic cancer SP cells. It is believed that there is an
association between inducing EMT and acquiring stemness phenotypes. To evaluate the expressions of stemness-associated 160
genes by coculturing with Tb-MSCs, we isolated SP cells or MP cells from GFP-PANC-1 cells directly cocultured with Tb-MSCs. After 3 days of culturing, GFP-positive SP or MP cells were resorted and collected (Fig. 3a). The SP cells showed twofold higher levels of CD133 mRNA expression compared with untreated MP cells. Coculturing with Tb-MSCs enhanced CD133 mRNA levels predominantly in SP cells, as the CD133 mRNA level was threefold greater in SP cells compared with that in MP cells. Similarly, mRNA expressions of other stemness genes including LGR5, Oct4, Nanog, and KLF4 were also enhanced by coculturing with Tb-MSCs (Fig. 3b). To further evaluate the stem-like characteristics of PANC-1 SP cells, we carried out sphere formation assays as described in Data S1. When SP cells and MP cells were plated without Tb-MSCs, they showed only modest sphere-forming activity (approximately 50 spheres from 1 9 104 cells). When either SP cells or MP cells were cocultured with Tb-MSCs, spheredoi: 10.1111/cas.12059 © 2012 Japanese Cancer Association
(A)
(B)
Cancer cells
103 FL2-H: PE
Relative mRNA levels
104
MSCs 102 101 100 100
101
102
103
LGR5
CD133 10
*
5
*
0 MSC –
+ SP
–
6
*
100 0 MSC –
+ MP
+ SP
*
*
*
150 100 50 0 MSC
–
+ SP
–
+ MP
100 80 60
–
+ SP
–
+ MP
0 MSC –
*
+ MP
+ SP
–
+ MP
(E) 1 cm
SP+ctrl MSCs SP+Tb-MSCs SP+Tb-MSCs SP+Tb-MSCs SP+Tb-MSCs MP+ctrl MSCs MP+Tb-MSCs MP+Tb-MSCs MP+Tb-MSCs MP+Tb-MSCs
120
0 MSC –
*
10
TRAIL sensitivity (%)
200
140
Tumor volume (mm3)
Number of spheres
*
250
+ SP
SP+ Tb-MSCs MP+ Tb-MSCs
Sphere formation
2
5
0 MSC –
(D)
+ MP
*
KLF4
FL1-H: FITC
(C)
–
*
15
5
*
4
Nanog 10
104
Oct4
200
100 80
Apop
40 20
0 MSCs – TRAIL –
40
Dead
60
Live + – SP
–
+
–
+
+
–
+ –
–
+
+
+
MP
20 0
0
2
4
6
8
Time (weeks)
Fig. 3. (a) GFP-positive cancer cells and negative transforming growth factor (TGF)-b treated mesenchymal stem cells (Tb-MSCs) were resorted and isolated for the following experiments. (b) mRNA expression changes of stemness-associated genes were evaluated by quantitative real-time PCR analysis. Results are the mean SD. *P < 0.05. (c) Sphere-forming activity was evaluated. Results are the mean SD. *P < 0.01, cocultured main population (MP) cells versus cocultured side population (SP) cells. (d) The SP cells or MP cells were injected into NOD ⁄ SCID mice (n = 4) along with na€ıve (untreated) MSCs or MSCs pretreated with 7.5 ng ⁄ mL TGF-b. Xenograft growth was evaluated by calculating tumor volumes (mm3). Data from each mouse (numbered 1–4) were expressed for the SP cells plus Tb-MSC group and the MP cells plus Tb-MSCs group. (e) Susceptibility to antitumor agent TNF-related apoptosis-inducing ligand (TRAIL) was evaluated by annexin V staining.
forming activity was dramatically enhanced in both. Interestingly, the extent of sphere formation was significantly greater in SP cells than MP cells (Fig. 3c). No spheres were observed when Tb-MSCs were cultured alone, suggesting that Tb-MSCs do not show sphere-forming activity. Thus, all spheres observed in this coculturing system were considered to be cancer cell-associated spheres. In addition, we investigated whether Tb-MSCs enhance tumor formation predominantly in SP cells. Either SP cells or MP cells (5 9 104 cells) were mixed with Tb-MSCs (1 9 105 cells) and injected into NOD ⁄ SCID mice. Notably, only Tb-MSCs dramatically enhanced the tumor-forming activity of SP cells isolated from PANC-1 cells; Tb-MSCs had negligible effects on tumor formation by PANC-1 MP cells (Fig. 3d). Finally, we tested if sensitivity to an antitumor drug was regulated by coculturing with Tb-MSCs. The protocol is described in Data S1. Both PANC-1 SP cells and MP cells were sensitive to TNF-related apoptosis-inducing ligand (TRAIL) at 75 ng ⁄ mL, as approximately 80% of the cells died either by apoptosis or necrosis. After coculturing with TbMSCs, SP cells became relatively resistant, as 68.6% of SP cells remained alive after incubation with TRAIL. This effect was also observed in MP cells, although only 47.1% of MP cells survived after coculturing with Tb-MSCs (Fig. 3e). Thus, these results suggested that Tb-MSCs protected SP cells from TRAIL-associated cytotoxicity. Kabashima-Niibe et al.
Transforming growth factor-b-treated MSCs regulate EMT and sphere formation in pancreatic cancer cells through a Notchdependent mechanism. We next focused on the mechanisms by
which Tb-MSCs might regulate cancer cell EMT or stemness properties. There are some MSC-derived molecules that could regulate EMT or stemness within the niche, including Notchassociated molecules, interleukin-6 and hepatocyte growth factor. Thus, we evaluated the expression profiles of these molecules before and after coculturing with cancer cells. Among the genes tested, Notch ligand Jagged-1 was most significantly upregulated within the MSCs after coculturing with pancreatic cancer SP cells. Jagged-1 mRNA levels were upregulated approximately sixfold after direct coculturing with cancer cells (Fig. 4a). We next evaluated if the Notch-associated signal is transduced within PANC-1 cells. Side population or MP cells obtained from the Notch-PANC-1 cells were cocultured with Tb-MSCs labeled by PKH26 dye. Coculturing was carried out under direct coculturing conditions for 3 days. The percentage of Notch signal-associated dVenus fluorescence-positive cells was 7.11% in MP cells and 14.9% in SP cells before coculturing with Tb-MSCs. Interestingly, coculturing with Tb-MSCs increased dVenus-positive cells to 19.2% in SP cells, whereas Tb-MSCs did not increase dVenus-positive cells in MP cells (8.35%) (Fig. 4b). To test if the EMT of Tb-MSC-mediated cancer cells was Notch signal-dependent, we evaluated the effects of c-secretase Cancer Sci | February 2013 | vol. 104 | no. 2 | 161 © 2012 Japanese Cancer Association
Jagged-1
*
8 7 6 5 4 3 2 1 0
SC
SC P
M
M
M SC
SP
TG F
N
aï
ve
M
SC
*
M
Relative mRNA level
(A)
Single culture
Coculture
d4v SP...FSC-H, FL3-H subset 104 14.9
co SP...FSC-H, FL3-H subset 104
14.9%
102
102 FL2-H
103
100 100
104
103
103
1
SP
+ +
– + – – MP
101
102 FL2-H
103
+ +
*
3 2 1
0 MSCs – si Jagged-1 –
104
8.35% 8.35
+ – SP
+ +
– –
+ – MP
100 100
101
(D)
5 4
104
Number of spheres
2
103
101
E-cadherin
*
102 FL2-H
103
MSCs
102
100 100
104
E-cadherin
+ –
39.7
Cancer cells
101
co MP...FL2-H, FL1-H subset-1 104
FL1-H
FL1-H
102 FL2-H
Relative mRNA level
Relative mRNA level
101
5
– –
100 100
104
101
100 100
0 MSCs DAPT
103
102
101
3
102 FL2-H
59.5
103
102
4
101
co MP...FSC-H, FL3-H subset 104
7.11%
19.2
101
FL1-H
101
d4v MP...FSC-H, FL3-H subset 104 7.11
(C)
102
101
100 100
19.2%
103
MSCs
102
101
MP
Cancer cells
FL1-H
SP
45.4
54.1
103
FL1-H
103
co SP...FL2-H, FL1-H subset-1 104
FL1-H
(B)
+ +
102 FL2-H
103
104
Sphere formation 200 150
*
100 50 0 MSCs DAPT
– –
+ – SP
+ +
– –
+ –
+ +
MP
Fig. 4. (a) Expression levels of Jagged-1 mRNA were assessed by real-time PCR. Results are the mean SD from three independent experiments. *P < 0.01 for transforming growth factor (TGF)-b treated mesenchymal stem cells (Tb-MSCs) versus MSCs cocultured with either side population (SP) or main population (MP) cells. (b) Notch signal-associated dVenus fluorescence was observed by flow cytometry. The percentage of dVenus positive cells was increased in SP cells by coculturing with Tb-MSCs. (c) Tb-MSC-mediated E-cadherin suppression was attenuated by inhibiting Notch signals either by a c-secretase inhibitor (DAPT) (left) or by Jagged-1-specific siRNA (right). Results are the mean SD from three independent experiments. *P < 0.01 for SP cells plus Tb-MSCs versus SP cells plus Tb-MSCs plus either DAPT or siRNA directed against Jagged-1. (d) SP cells or MP cells were cocultured with Tb-MSCs in the presence or absence of DAPT and sphere-forming activity was evaluated. Results are mean SD from three independent experiments. *P < 0.01 for SP cells plus Tb-MSCs versus SP cells plus Tb-MSCs plus DAPT.
inhibitor IX (DAPT). Interestingly, Tb-MSC-mediated downregulation of E-cadherin was suppressed by DAPT only in SP cells. In contrast, only a minimal effect was found in MP cells (Fig. 4c). In addition, we used siRNA to suppress MSCderived Jagged-1 (Fig. 4c). These results were similar to those using DAPT, as siRNA directed against Jagged-1 abrogated Tb-MSC-mediated E-cadherin suppression in SP cells, but only a minimal effect was detected in MP cells. These results suggest that Tb-MSC-associated EMT induction is Notch signal-dependent. 162
To determine whether Tb-MSC-mediated enhancement of SP cell sphere formation was Notch-dependent, we used DAPT and carried out the sphere formation assay (Fig. 4d). As expected, DAPT significantly suppressed sphere formation in SP cells cocultured Tb-MSCs. Our results suggest that Notch-associated EMT and ⁄ or sphere formation is predominantly observed in SP cells. Because SP cells have been reported to be enriched with cells that have so-called TISC-like properties,(15–17) our results may suggest that SP cells are enriched with cells that are more responsive to the so-called stemness signal Notch.(18,19) doi: 10.1111/cas.12059 © 2012 Japanese Cancer Association
Discussion
Epithelial–mesenchymal transition mediated by Tb-MSCs was clearly identified in SP cells isolated from pancreatic cancer cell lines, whereas EMT induction in the MP cell fraction was modest. We have reported that SP cells isolated from pancreatic cancer cells were highly responsive to TGF-b-mediated EMT.(5) Side population cells show better capability than MP cells for not only undergoing EMT but also returning to epithelial phenotype from a mesenchymal phenotype, the so-called MET, after removing TGF-b. The present study demonstrated that SP cells were more responsive to Tb-MSCmediated EMT compared with MP cells (Fig. 2). In addition, taking our previous findings into account, controlling EMT in SP cells appears to be the key to preventing pancreatic cancer invasion and metastasis. Preventing cell–cell interactions between SP cells and MSC-derived stromal cells appears to be important for inhibiting SP cells from undergoing EMT. Recently, EMT was reported to be linked with the expression of the so-called TISC properties.(3,4) In the present study, we hypothesized that coculturing with MSCs and ⁄ or MSCderived myofibroblast-like cells regulated the so-called TISClike phenotypes of pancreatic cancer SP cells. As expected, Tb-MSCs dramatically enhanced TISC-like properties, based on the following observations: (i) the expression of certain TISC markers, including CD133, LGR5, Oct4, Nanog and KLF4; (ii) sphere formation within the context of an anchorage-independent ultra-low attachment culture system; (iii) in vivo tumor-forming activity; and (iv) resistance to an apoptosis-inducing stimulus, TRAIL. These results suggest that Tb-MSCs regulate TISC-like properties in pancreatic cancer cells. The MSCs and ⁄ or MSC-derived myofibroblast-like cells might provide an appropriate microenvironment. In this study, we focused on the roles of a-SMA-positive myofibroblast-like cells in cancer cell EMT regulation and cancer progression. Our results indicated that a-SMA-positive myofibroblast-like cells were enriched in those areas in which cancer cells had undergone EMT, and were frequently identified in human pancreatic cancer specimens (Fig. 1d). AlphaSMA-positive cells originating from bone marrow showed superior activity to enhance tumor formation in pancreatic cancer cell lines (Fig. 1a). In addition, we found that pretreatment with TGF-b induced MSCs to express certain molecules, including a-SMA, tenascin C, and PDPN, which are enriched within cancer stroma.(9) Thus, taken together with previous studies showing the roles of myofibroblasts in tumor progression,(8,11,20) a-SMA-positive myofibroblast-like cells play important roles in cancer progression in pancreatic cancer, especially in regulating EMT status and TISC-like characteristics. Because MSCs are well known to migrate from the bone marrow into tumor tissue,(21–23) it is reasonable that bone marrow-derived MSCs are potential sources of a-SMA-positive cells within the tumor stroma. There is an increasing body of evidence that Notch-associated signal transduction contributes to the carcinogenic processes in pancreatic cancer.(19,24,25) Notch appears to enhance pancreatic cancer progression, as Wang et al.(26,27) reported that inhibiting Notch signaling with either siRNA or c-secretase inhibitors reduced pancreatic cancer cell growth and invasion ⁄ metastasis. Mullendore et al.(28) reported that Notch ligands as well as their target genes, (i.e., HES, HEY, and VEGF) were upregulated within pancreatic cancer tissues. De La O JP et al. reported that Notch signals cooperated with a K-Ras-dependent pathway to mediate pancreatic carcinogenesis.(29,30) Furthermore, Notch signals may contribute to pancreatic TISC regulation as forced activation of Notch signals accelerates self-renewal in pancreatic TISCs.(18,19) In this study, we detected that Jagged-1, one of the major Notch ligands, was upregulated after coculture Kabashima-Niibe et al.
with pancreatic cancer cells in Tb-MSCs (Fig. 4a). In addition, both the c-secretase inhibitor DAPT and siRNA directed against Jagged-1 could effectively suppress Tb-MSC-mediated PANC-1 cell EMT and sphere formation. These results are consistent with previously reported findings suggesting the importance of Notch signaling in pancreatic cancer progression. Our results suggest that Notch ligands, such as Jagged-1, are provided by MSCs and ⁄ or MSC-derived myofibroblast-like cells during the interaction between pancreatic cancer cells and MSCs. Our results also suggest that pancreatic cancer cells undergo EMT through Notch-dependent mechanisms during the interactions between cancer cells and MSCs. Another finding suggested by the present study was that coculturing with Tb-MSCs mediated apoptosis resistance, one of the important characteristics of socalled TISCs, in pancreatic cancer cells. Although detailed mechanisms by which Tb-MSCs mediate cell death resistance is unknown, possible cross-talk between the Notch signaling pathway and cell death cascade has been suggested by previous studies. Notch signals may affect the expression profile of apoptosis-regulating molecules, that is, upregulation of antiapoptotic molecules including Bcl-2, Mcl-1, and XIAP.(31–33) Furthermore, the Notch-associated signal also suggested enhancing so-called cell survival signals including nuclear factor-jB and the PI3K ⁄ Akt pathway.(34,35) The contribution of Notch-associated mechanisms on EMT induction under Transwell culture conditions (Fig. 2a,b) remains unclear. Although we identified that Tb-MSCs expressed certain Notch ligands, such as Jagged-1 or DLL4, we did not determine if soluble forms of such ligands were released into the culture medium through the Transwell chamber. However, in another series of experiments, we identified that SP cells upregulated Notch ligands after culturing with Tb-MSC under Transwell conditions (data not shown). Therefore, we could hypothesize that other soluble factors released from Tb-MSCs may affect SP cells, resulting in Notch signal transduction and ⁄ or induce EMT directly within the SP cells. In conclusion, our results suggest that MSCs and ⁄ or myofibroblast-like cells originating from MSCs have the capability to regulate cancer cell EMT status. Mesenchymal stem cells also regulate TISC-like characteristics, such as the expression of so-called TISC markers, the ability to form spheres in anchorage-independent culturing conditions, and the potential to form tumors in vivo. Mesenchymal stem cells cocultured with pancreatic cancer cells express certain Notch ligands, such as Jagged-1, to mediate EMT or sphere formation in pancreatic cancer cells through Notch-dependent mechanisms. These results are consistent with a scenario in which MSCderived myofibroblast-like cells may function as a TISC niche by providing a microenvironment for regulating TISC maintenance and EMT status. Targeting the MSC-associated microenvironment may be an attractive strategy to prevent cancer progression and invasion ⁄ metastasis. The signal transduction processes of the Notch pathway are a potential target for preventing MSC–cancer cell interactions. Acknowledgments This work was supported by a grant-in-aid for scientific research from the Japanese ministry of education, scientific and culture of Japan (A.K.-N. is supported by grant 23-5599; H.H. is supported by grant 24591017). The authors acknowledge Dr Minoru Kitago for his management to obtain surgical specimens, Mr Sadafumi Suzuki for his technical support with flow cytometry and Mr Toru Igarashi for his technical assistance.
Disclosure Statement The authors have no conflict of interest.
Cancer Sci | February 2013 | vol. 104 | no. 2 | 163 © 2012 Japanese Cancer Association
References 1 Thiery JP. Epithelial-mesenchymal transitions in tumour progression. Nat Rev Cancer 2002; 2: 442–54. 2 Kalluri R, Weinberg RA. The basics of epithelial-mesenchymal transition. J Clin Invest. 2009; 119: 1420–8. 3 Morel AP, Lievre M, Thomas C, Hinkal G, Ansieau S, Puisieux A. Generation of breast cancer stem cells through epithelial-mesenchymal transition. PLoS ONE 2008; 3: e2888. 4 Mani SA, Guo W, Liao MJ et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell 2008; 133: 704–15. 5 Kabashima A, Higuchi H, Takaishi H et al. Side population of pancreatic cancer cells predominates in TGF-beta-mediated epithelial to mesenchymal transition and invasion. Int J Cancer 2009; 124: 2771–9. 6 Albini A, Sporn MB. The tumour microenvironment as a target for chemoprevention. Nat Rev Cancer 2007; 7: 139–47. 7 Hwang RF, Moore T, Arumugam T et al. Cancer-associated stromal fibroblasts promote pancreatic tumor progression. Cancer Res 2008; 68: 918 –26. 8 Giannoni E, Bianchini F, Masieri L et al. Reciprocal activation of prostate cancer cells and cancer-associated fibroblasts stimulates epithelial-mesenchymal transition and cancer stemness. Cancer Res 2010; 70: 6945–56. 9 Kalluri R, Zeisberg M. Fibroblasts in cancer. Nat Rev Cancer 2006; 6: 392–401. 10 Simian M, Hirai Y, Navre M, Werb Z, Lochter A, Bissell MJ. The interplay of matrix metalloproteinases, morphogens and growth factors is necessary for branching of mammary epithelial cells. Development. 2001; 128: 3117–31. 11 Quante M, Tu SP, Tomita H et al. Bone marrow-derived myofibroblasts contribute to the mesenchymal stem cell niche and promote tumor growth. Cancer Cell 2011; 19: 257–72. 12 Kohyama J, Tokunaga A, Fujita Y et al. Visualization of spatiotemporal activation of Notch signaling: live monitoring and significance in neural development. Dev Biol. 2005; 286: 311–25. 13 Quirici N, Soligo D, Bossolasco P, Servida F, Lumini C, Deliliers GL. Isolation of bone marrow mesenchymal stem cells by anti-nerve growth factor receptor antibodies. Exp Hematol 2002; 30: 783–91. 14 Battula VL, Treml S, Bareiss PM et al. Isolation of functionally distinct mesenchymal stem cell subsets using antibodies against CD56, CD271, and mesenchymal stem cell antigen-1. Haematologica 2009; 94: 173–84. 15 Kondo T, Setoguchi T, Taga T. Persistence of a small subpopulation of cancer stem-like cells in the C6 glioma cell line. Proc Natl Acad Sci U S A. 2004; 101: 781–6. 16 Ho MM, Ng AV, Lam S, Hung JY. Side population in human lung cancer cell lines and tumors is enriched with stem-like cancer cells. Cancer Res 2007; 67: 4827–33. 17 Chiba T, Kita K, Zheng YW et al. Side population purified from hepatocellular carcinoma cells harbors cancer stem cell-like properties. Hepatology 2006; 44: 240–51. 18 Wang YH, Li F, Luo B et al. A side population of cells from a human pancreatic carcinoma cell line harbors cancer stem cell characteristics. Neoplasma. 2009; 56: 371–8.
19 Ji Q, Hao X, Zhang M et al. MicroRNA miR-34 inhibits human pancreatic cancer tumor-initiating cells. PLoS ONE 2009; 4: e6816. 20 Mishra PJ, Humeniuk R, Medina DJ et al. Carcinoma-associated fibroblastlike differentiation of human mesenchymal stem cells. Cancer Res 2008; 68: 4331–9. 21 Houghton J, Stoicov C, Nomura S et al. Gastric cancer originating from bone marrow-derived cells. Science 2004; 306: 1568–71. 22 Worthley DL, Ruszkiewicz A, Davies R et al. Human gastrointestinal neoplasia-associated myofibroblasts can develop from bone marrow-derived cells following allogeneic stem cell transplantation. Stem Cells. 2009; 27: 1463–8. 23 Tu S, Bhagat G, Cui G et al. Overexpression of interleukin-1beta induces gastric inflammation and cancer and mobilizes myeloid-derived suppressor cells in mice. Cancer Cell 2008; 14: 408–19. 24 Brabletz S, Bajdak K, Meidhof S et al. The ZEB1 ⁄ miR-200 feedback loop controls Notch signalling in cancer cells. EMBO J 2011; 30: 770–82. 25 Ristorcelli E, Lombardo D. Targeting Notch signaling in pancreatic cancer. Expert Opin Ther Targets. 2010; 14: 541–52. 26 Wang Z, Banerjee S, Li Y, Rahman KM, Zhang Y, Sarkar FH. Down-regulation of notch-1 inhibits invasion by inactivation of nuclear factor-kappaB, vascular endothelial growth factor, and matrix metalloproteinase-9 in pancreatic cancer cells. Cancer Res 2006; 66: 2778–84. 27 Wang Z, Zhang Y, Li Y, Banerjee S, Liao J, Sarkar FH. Down-regulation of Notch-1 contributes to cell growth inhibition and apoptosis in pancreatic cancer cells. Mol Cancer Ther 2006; 5: 483–93. 28 Mullendore ME, Koorstra JB, Li YM et al. Ligand-dependent Notch signaling is involved in tumor initiation and tumor maintenance in pancreatic cancer. Clin Cancer Res 2009; 15: 2291–301. 29 De La O JP, Emerson LL, Goodman JL et al. Notch and Kras reprogram pancreatic acinar cells to ductal intraepithelial neoplasia. Proc Natl Acad Sci U S A. 2008; 105: 18907–12. 30 De La O JP, Murtaugh LC. Notch and Kras in pancreatic cancer: at the crossroads of mutation, differentiation and signaling. Cell Cycle 2009; 8: 1860–4. 31 MacKenzie F, Duriez P, Wong F, Noseda M, Karsan A. Notch4 inhibits endothelial apoptosis via RBP-Jkappa-dependent and -independent pathways. J Biol Chem 2004; 279: 11657–63. 32 Oishi K, Kamakura S, Isazawa Y et al. Notch promotes survival of neural precursor cells via mechanisms distinct from those regulating neurogenesis. Dev Biol. 2004; 276: 172–84. 33 Liu WH, Hsiao HW, Tsou WI, Lai MZ. Notch inhibits apoptosis by direct interference with XIAP ubiquitination and degradation. EMBO J 2007; 26: 1660–9. 34 Oswald F, Liptay S, Adler G, Schmid RM. NF-kappaB2 is a putative target gene of activated Notch-1 via RBP-Jkappa. Mol Cell Biol 1998; 18: 2077–88. 35 Sade H, Krishna S, Sarin A. The anti-apoptotic effect of Notch-1 requires p56lck-dependent, Akt ⁄ PKB-mediated signaling in T cells. J Biol Chem 2004; 279: 2937–44. 36 Masugi Y, Yamazaki K, Hibi T et al. Solitary cell infiltration is a novel indicator of poor prognosis and epithelial-mesenchymal transition in pancreatic cancer. Hum Pathol 2010; 41: 1061–68.
Supporting Information Additional Supporting Information may be found in the online version of this article: Data S1. Supporting materials and methods.
164
doi: 10.1111/cas.12059 © 2012 Japanese Cancer Association
