Minimal residual disease is common after allogeneic stem cell ...

Leukemia (2000) 14, 247–254  2000 Macmillan Publishers Ltd All rights reserved 0887-6924/00 $15.00 www.nature.com/leu

Minimal residual disease is common after allogeneic stem cell transplantation in patients with B cell chronic lymphocytic leukemia and may be controlled by graftversus-host disease J Mattsson1,2, M Uzunel1,2, M Remberger1,2, P Ljungman3, E Kimby3, O Ringde´n1,2 and H Zetterquist4 1

Centre for Allogeneic Stemcell Transplantation and Departments of 2Clinical Immunology, 3Hematology, and 4Surgery, Karolinska Institute at Huddinge Hospital, Huddinge, Sweden

Following allogeneic stem cell transplantation (SCT), we studied the presence of donor and recipient derived cells within the CD19ⴙ B cell fraction, in patients with B cell chronic lymphocytic leukemia (CLL). The chimeric status of the six patients studied was further investigated with minimal residual disease (MRD) detection, by sequencing and using patient-specific primers derived from junctional regions of clonally rearranged immunoglobulin heavy-chain (IgH) receptor genes. To date, five of six patients are alive with a median follow-up time of 24 months (range 15–60) post-SCT. All patients experienced acute and chronic graft-versus-host disease and responded clinically to SCT. All patients were MRD positive after SCT, which correlated to mixed chimerism within the CD19ⴙ cell fraction in all samples except one (25/26). High levels of tumor necrosis factor-␣ (TNF-␣) and soluble interleukin-2 receptor (sIL-2R) indicated advanced disease, and patients with increased levels pre- and post-SCT were also those with the most long-lasting PCR-detectable MRD post-SCT. Hence, a high tumor burden pre-SCT may reflect the long duration of detectable MRD in patients with B-CLL after SCT. A durable anti-leukemic effect was probably important in these patients. Leukemia (2000) 14, 247–254. Keywords: chronic lymphocytic leukemia; chimerism; minimal residual disease; relapse; allogeneic hematopoietic stem cell transplantation

Introduction Chronic lymphocytic leukemia (CLL), the most frequent form of leukemia in the western hemisphere, is a clonal hematopoietic disorder characterized by the accumulation of matureappearing, immunologically incompetent, usually B cell lineage lymphocytes, with a long life-span.1–3 The disease occurs mainly at an older age, but up to 40% of patients with B-CLL are younger than 60 years of age at diagnosis and 10% are less than 50 years of age.4,5 Whereas many patients at older ages will ultimately die of unrelated causes due to their age, most younger patients will die of progressive B-CLL and its complications. The younger subgroup of patients have a significantly shorter survival rate than their normal age-matched counterparts, since conventional treatment is not able to cure CLL.5 This patient group might therefore benefit from more aggressive treatment, for example, allogeneic stem cell transplantation (SCT). Around 100 patients with CLL have been reported after SCT.6 Several reports have shown that SCT may eradicate the disease and induce long-lasting remission.6–8 Clonal rearrangement of the immunoglobulin heavy-chain locus (IgH) by use of the polymerase chain reaction (PCR) provides a useful marker for detecting minimal residual disease (MRD) in B-CLL.8–10 Some authors have reported a correlation Correspondence: J Mattsson, Center for Allogeneic Stemcell Transplantation, Huddinge University Hospital, SE-141 86 Huddinge, Sweden; Fax: +46-8-746 68 69 Received 17 May 1999; accepted 12 October 1999

between persistence of PCR-detectable MRD and subsequent relapse in patients with CLL after SCT.8 PCR amplification of variable number tandem repeat regions (VNTRs) has been used to evaluate various degrees of donor and recipient mixed chimerism (MC), post-SCT.11,12 Whether MC is related to relapse post-SCT has been a matter of debate.13 We studied both MC and MRD after SCT in patients with B-CLL. MC within the B cell fraction was compared to MRD in peripheral blood (PB) and bone marrow (BM). A quantitative cytokine assay for tumor necrosis factor-␣ (TNF-␣) and soluble interleukin-2 receptor (sIL-2R) was also performed, to monitor the tumor burden pre- and post-SCT.14,15 Materials and methods

Patients Six patients with a diagnosis of B-CLL, as defined by the National Cancer Institute, were included.16 The patient characteristics before SCT are summarized in Table 1. The median time from diagnosis to SCT was 4.5 years (0.7–5 years). Before SCT, all patients had a response to last therapy. However, UPN 474 showed signs of progressive disease just prior to SCT. This was also the only patient showing a verified Richter’s transformation pre-SCT. At SCT, three patients were classified as Binet stage C, because of treatment-related anemia or thrombocytopenia, and three patients as Binet stage A. All patients, except one, had morphological and phenotypical signs of remaining disease. SCT was performed between January 1994 and December 1997 at the Centre for Allogeneic Stemcell Transplantation, Huddinge Hospital. All donors were HLA-identical siblings. The preparative regimen consisted of cyclophosphamide (CTX) 60 mg/kg on 2 consecutive days followed by 10 Gy of total body irradiation (Table 2), as previously described.17 In addition, one patient (UPN 581) received fludarabine 35 mg/m2 on 2 consecutive days before CTX. As prophylaxis against GVHD, cyclosporine A (CsA) was combined with a short course of methotrexate (MTX) in all patients.18 Details regarding the transplantation procedure and supportive care have been published elsewhere.17,19

Definition of response Complete response (CR) and partial response (PR) was defined according to Working Group Guidelines for CLL.16 In summary, absence of lymphadenopathy, no hepatomegaly or splenomegaly, absence of constitutional symptoms, normal blood counts and normal BM aspirate and biopsy for a period of at least 2 months after therapy was required for CR. Partial response required ⬎50% decrease in peripheral lymphocyte

MRD in patients with B-CLL after SCT J Mattsson et al

248

Table 1

UPN

428 474 554 581 609 621

Patient characteristics pre-SCT

DX 1st treatment (years)

Disease stage, 1st treatment

1 0 0 0 0 3.5

Rai

Binet

I II II II I I

B B A B B A

WBC at 1st treatment

38 14 115 235 18 179

Total treatment regimens

4 5 3 4 3 3

Hypogamma Splenomegaly Response to last treatment before SCT

− − + + − −

− + + + − −

PR PR PR PR CR PR

Disease stage pre-SCT

WBC preBMT

Rai

Binet

IV IV I I 0 IV

C C A A A C

16 36 4 15 6 46

PR, partial response; CR, complete response; RD, remaining disease; Dx, diagnosis; WBC, white blood cell count.

Table 2

UPN

428 474 554 581 609 621

Patient characteristics during and after SCT

Sex (P/D)

F/M M/M M/M F/F F/M M/M

Age P (years)

48 41 49 52 24 49

TNF␣-levelsa before SCT (pg/ml)

sIL-2R levelsb before SCT (pg/ml)

Conditioning regimen

9.2 25.5 4.6 — 6.9 9.8

5684 23614 1265 3958 3280 10645

CTX/TBI CTX/TBI CTX/TBI Flud./CTX/TBI CTX/TBI CTX/TBI

Marrow cell dose (× 108/kg)

GVHD grade Acute

Chronic

2.2 1.5 0.7 2.0 1.6 7.0

I II II I I II

m Mo m m m m

Follow-up time (months)

60 †23 31 24 17 15

P, patient; D, donor; F, female; M, male; m, mild; Mo, moderate; CTX, cyclophosphamide 120 mg/kg; TBI, total body irradiation 10 Gy in one setting; Flud., Fludarabine 35 mg/m2 × 2. a Normal controls: ⬍4.4 pg/ml. b Normal controls: 1346 (676–2132) pg/ml.

count from pre-treatment value, ⬎50% reduction in lymphadenopathy, and/or ⬎50% reduction in hepatomegaly/ splenomegaly for a period of at least 2 months after therapy and one out of three additional defined criteria.

estimated by a semiquantitative dotMETRIC assay (NMI, San Diego, CA, USA).

VNTR analysis PCR amplification template preparations DNA from donor and recipient pretransplantation samples was extracted, using standard protocols (Qiagen, Hilden, Germany). To evaluate lineage-specific chimerism, separation of CD3-, CD19-, CD45-positive cells from 4 ml of EDTA PB or BM was done using immunomagnetic beads, according to the manufacturer’s instructions (Dynal, Oslo, Norway). To each cell pellet, 30 ␮l 10 mm Tris buffer was added before freezing. After thawing, 60 ␮l lysis buffer (18 ␮l 5× red cell lysis buffer (1.6 m sucrose, 0.05 m Tris-HCl, 25 mm MgCl26H2O, 5% Triton-X-100, 0.01 m Tris-Base), 8 ␮l proteinase K (10 mg/ml), 34 ␮l dH2O) was added to each bead-separated sample. Samples were then digested at 37°C overnight on a shaker. CD19-positive samples were diluted in 100–300 ␮l 10 mm Tris buffer, pH 6.6. CD3-positive and CD45-positive samples were diluted in 1000 ␮l 10 mm Tris buffer, pH 6.6. Prior to PCR, diluted cell lysate samples were heated to 70°C for 10 min and then spun for 1 min at 6150 g in a microcentrifuge, and cooled on ice. For chimerism analysis, PCR amplification was performed using 10 ng of genomic DNA or 2 ␮l (10–20 ng) of cell lysate DNA. Genomic DNA concentrations were measured in a Gene Quant II spectrophotometer (Pharmacia, Uppsala, Sweden), whereas cell lysate DNA was Leukemia

PCR amplification of six different minisatellite loci was used for analysis of MC.20–25 All oligonucleotide primers were synthesized commercially (Cybergene, Huddinge, Sweden). Each final PCR reaction (10 ␮l) contained 0.5 ␮m of each primer, 200 ␮m of each dNTP (Perkin Elmer, Branchburg, CA, USA), 1× PCR buffer (50 mm Mg, 10 mm KCl, 0.001% gelatin), 5% glycerol, 1 ng cresol red, 10–20 ng genomic DNA, 0.3 U AmpliTaq polymerase (Perkin Elmer). After an initial 3 min hot-start/denaturation step at 94°C, 32 PCR amplification cycles were carried out in a PTC-200 thermal cycler (MJ Research, Watertown, CA, USA). The first 10 amplification cycles were done in a two-segment step at 94°C for 15 s and at 65°C for 1 min. The following 22 cycles were done in a three-segment step at 94°C for 15 s, 61°C for 50 s and 72°C for 30 s. PCR amplified products were run on a ready-to-use PAGE system (Pharmacia Biotech). 12.5% non-denaturing polyacrylamide gels were run for 1.5 h under standard buffer conditions at 10°C in a Genephor peltier-cooled gel apparatus (Pharmacia Biotech). PCR amplified band patterns were analyzed in visible light after a 90-min automated silver staining procedure (Pharmacia Biotech). We used a semiquantitative estimation of MC, where recipient-band intensity was compared to donor-band intensity on a four-degree scale. MC +3 indicated equal recipient–donor band intensity, whereas MC


Figure 1 Sensitivity of mixed chimerism (MC) analysis. Recipient B cells were immunomagnetically separated and the antibodies were detached. B cells were counted and diluted in donor whole blood with a known total white cell concentration. The CD19-positive cells were immunomagnetically immobilized, lysed and PCR was performed directly on cell lysate DNA.

+1, +2 indicated less and MC +4 indicated more recipientband intensity. After digital photodocumentation, PAGE gels were sealed in hybridization bags and stored at +4°C, for future reference.

PCR amplification of IgH genes used a degenerate primer complementary to framework three (FR3) of the variable (VH) gene segments, together with a consensus joining (JH)1–6 gene segment primer (Table 3).26,27 PCR amplification conditions were identical with VNTR amplification conditions, except that 200 ng DNA was used in each PCR amplification reaction and that 35 amplification cycles were carried out. DNA was extracted from leukemia cells obtained at diagnosis. PCR products were electrophoresed, and single bands were excised from preparative 2% GTG agarose gels. Excised bands were purified using the QIAquick Gel Extraction Kit (Qiagen), according to the guidelines of the manufacturer. Purified PCR products were ligated into TA vectors and subsequently transformed into competent cells, as described in the pGEM-T Easy Vector System 1 protocol (Promega, Madison, WI, USA). Plasmids from 10 independent clones were purified, using the Plasmid Mini Kit (Qiagen), and unidirectionally sequenced with a T7 vector-specific primer, using the ABI prism Big Dye

UPN

249

Cytokine assay

Analysis of IgH gene rearrangement

Table 3

Terminator Cycle Sequencing Ready Reaction Kit (Perkin Elmer). Sequences were analyzed on a 373A DNA sequencer (Applied Biosystems, Foster City, CA, USA). The predominant nucleotide sequence derived from the various plasmid clones of each patient was studied. The sequence from the N1 regions (Table 3) of rearranged IgH genes was used to accommodate the 3⬘-end of the 5⬘-patient-specific primer used for each patient. After an initial 3-min hot-start/denaturation step, 35 PCR amplification cycles were carried out in a PTC-200 thermal cycler (MJ Research). The first 10 amplification cycles in a two-segment step were done at 94°C for 20 s and at 65°C for 1 min. The following 25 cycles in a three-segment step were done at 94°C for 20 s, 61°C for 50 s and 72°C for 20 s. PCR amplified specific products of 80–120 bp size were analyzed on the same PAGE system, as described for VNTR analysis. To prove that a PCR product from a post-SCT sample was identical to the original leukemic clone, sequencing (as described above) was performed on most of the positive postSCT samples. The retrieval of a correct N2 sequence was considered evidence of clonal identity.

Samples from PB were immediately centrifuged and the sera were frozen at −86°C, pending analysis. TNF-␣ and sIL-2R were analyzed using the Quantikine ELISA kit from R&D (Minneapolis, MN, USA). Assays were performed according to the manufacturer’s instructions. In brief, samples and standards were incubated in cytokine-antibody precoated wells. After washing, a polyclonal antibody conjugated to horseradish peroxidase was added. After incubation and washing, a cromogen-peroxide substrate solution was added. The color development was stopped with sulfuric acid and the intensity of the color was measured. Intra-assay c.v. were 5.6% and 4.7% for soluble IL2R and TNF-␣, respectively; intra-assay c.v.: 6.7% and 5.8%, respectively. Sensitivities were 24 pg/␮l and 4:4 pg/␮l, respectively. Mean levels of sIL-2R in 37 serum samples from healthy normal controls were 1346 pg/ml (range 676–2132 pg/ml). Levels of TNF-␣ were not detected in any of 40 serum samples from healthy normal controls.

Sequence analysis of clonal IgH gene rearrangements V(FR3)

N1

428

ACACGGCTGTGTATTACTGTGTGAGA TCCCGGAC

474

ACACGGCTGTGTATTACTGT GCGAAAGA

TCGTA

554

ACACGGCTGTGTATTACTGTGCGA

AACACAT

581

ACACGGCTGTGTATTACTGTGCGAGA TAGTTGGGTAGGGAACTTCACC

609

ACACGGCTGTGTATTACTGT GCAAGAGA

621

ACACGGCTGTGTATTACTGTGCGAGA AGACCTCAGGACATGAT

TTCACTTA

D(family) GGGGGAG (D6) GTGGGAGCTACT (?) GTGGATACAGTGCCTACGA (Dk5) TATTACTATGATAGTAGTGGTTATTAC (D21-9) ATTACGATTTTTGGAGTGGTTATTATA (Dxp4) TTACGATTTTTGGAG (Dxp4)

N2

GGATCG

CTCAT GCCCGA TAA

GTATAC

J(family) TATTGGTATTTCG . . . (Jh2) ACTACTACTACT . . . (Jh6b) CTGTTTCGACCC . . . (Jh5b) GACTACTGGGGC . . . (Jh4b) ACTACTACTACT . . . (Jh6b) CTTTGACTACTG . . . (Jh4b)

V, D and J refer to variable, diversity and joining gene segments of the IgH gene. Primers used for PCR amplification of the IgH gene segments were FR3: 5⬘-ACACGGC(C/T)(G/C)TGTATTACTGT-3⬘ and Jpst: 5⬘-AACTGCAGAGGAGACGGTGACC-3⬘. Nucleotide sequences used as patient-specific primers are underlined. The sequence of the N2 region was used for specificity control of patient-specific primers. Leukemia


250

Figure 2 Results of chimerism analysis and minimal residual disease (MRD) over time in six patients with B-CLL after allogeneic SCT. The first three samples from UPN 554 and all samples from UPN 428 and 474 were analyzed with DNA extracted from peripheral blood slides. In all other samples, cell-lysate DNA from CD19-positive cells was used for chimerism detection. DC, donor chimerism; MC, mixed chimerism; RD, remaining disease; CR, complete remission.

Results

Patients All patients showed a response to SCT. Five patients are alive, four of them in complete remission (CR), with a median follow-up time of 24 months (15–60). One patient died due to pneumonia 23 months after SCT, without clinical progression. UPN 474 and 621 had remaining lymphocytosis, which normalized 7 and 10 months after SCT, respectively. Three patients were classified as being in CR by morphology and also by immunophenotype analysis on all BM aspirations taken post-SCT, whereas UPN 428 and 474 had signs of persistent disease 6 months post-SCT, but showed CR at 12 months and thereafter. In UPN 621, persistent disease was found on all BM examinations after SCT. All patients developed acute and chronic GVHD (Table 2). UPN 428 developed a hemolytic uremic syndrome 1 year post-SCT, which responded well to treatment. UPN 621 has developed an aseptic necrosis of the hip.

Sensitivity of PCR amplification When tested on DNA dilution series, all six VNTRs had a sensitivity at the 2% level. In a cell dilution series, B cells of individual ‘A’ were diluted in whole EDTA blood with a known total WBC of individual ‘B’. CD19-positive cells were then immunomagnetically collected in an ‘affected celllineage’-specific manner and a sensitivity down to 2 × 10−4 Leukemia

was obtained, probably due to reduction of the irrelevant background (Figure 1). Using IgH patient-specific primers and a DNA template concentration of 200 ng in each PCR reaction, a sensitivity of 1 × 10−4 was routinely achieved (data not shown).

Chimerism analysis UPN 428 and 474 were retrospectively analyzed using BM and PB slides. Therefore, immunomagnetic cell separation could not be performed. MC was detected in all patients, except UPN 554, who was donor chimeric in all samples analyzed. In UPN 581, 609 and 621 who had MC in the CD19− cell fraction, MC corresponded to detection of MRD in 25 out of 26 samples (Figure 2). In UPN 621, the chimerism pattern changed during the first year and the patient became a complete donor chimera in the CD3+ (T cells) and CD45+ cell fractions (mainly granulocytes). However, the CD19+ cells continued to be of recipient origin (Figure 3). UPN 581 and 609 also showed MC in the CD3+ and CD19+ cells up to 9 and 3 months post-SCT, respectively (Figure 4). In these latter two patients, a comparison between immunomagnetic cell separation and extraction of DNA from whole blood was performed in seven and six corresponding samples, respectively. In both patients, MC was detected in the cell separated samples, but not in the DNA-extracted samples (Figure 4). A comparison of MC and MRD in PB and BM was also made in all patients on 15 simultaneous occasions post-SCT. The results were concordant for both PB and BM, with five of 15 positive MC and MRD samples.


251

MRD detection A monoclonal IgH-sequence was retrieved from the diagnostic samples of all patients, and patient-specific primers could be readily designed. All six patients were MRD positive before SCT. The median time from diagnosis to the last positive MRD sample, with retrieval of the correct sequence, was 3 years (1–7 years). Despite morphological and immunophenotype remission, UPN 428 and 474 proved to be MRD-positive up to 37 and 23 months post-SCT, respectively. In UPN 581 and 609, with MC in the CD19+ cell fraction, the retrieval of the leukemic clone-specific sequence was detected in the same samples (Figure 2). UPN 621 was found to be highly MRD positive in all analyzed samples (Figures 2 and 3), whereas in UPN 554, MRD was only detected on day +21 post-SCT.

Cytokine levels

Figure 3 Comparison of chimerism and MRD analysis in UPN 621 on three different occasions post-SCT. Chimerism analysis was performed on immunomagnetically separated cells while MRD was analyzed with DNA extracted from whole blood and cell lysate DNA from CD19 separated cells.

Figure 4 Chimerism analysis in UPN 581. The figure compares chimerism analysis performed on cell-lysate DNA from immunomagnetically separated cells with DNA extracted from whole blood.

Before starting the conditioning, the levels of sIL-2R and TNF-␣ were higher in all patients than in normal controls. The levels were particularly high in the three patients with most advanced disease prior to SCT (Table 1, Figure 5). After SCT, the levels of sIL-2R in the latter three patients slowly fell. Short high-peak levels were seen during acute GVHD in these three patients. Patient 474 also showed an increase in sIL-2R during chronic GVHD at 200 days post-SCT (Figure 5). One year after SCT, levels of sIL-2R were normal in all patients, except UPN 474 and 621 (Figure 5). In patients with less advanced disease, levels of sIL-2R returned to normal within 3 to 6 months (data

Figure 5 Serum cytokine levels in after SCT. The upper part of the figure 2 receptors in the three patients with shows the levels of TNF-␣ in the four

patients with CLL before and shows the levels of soluble ILBinet stage C. The lower part patients with persistent MRD. Leukemia


252

not shown). During the first 6 months after SCT, TNF-␣ showed spikes in the levels of patients with Binet stage C (UPN 428, UPN 474 and UPN 621) pre-SCT and in UPN 581. In the remaining two patients with Binet stage A, the levels were undetectable. One year post-SCT, TNF-␣ levels could be detected only in the two patients with most advanced disease, ie UPN 474 and UPN 621. Discussion Although only a few patients with CLL have received SCT over the last decade, its feasibility has been substantiated.7,28,29 One aim of the present study was to determine whether SCT could eradicate PCR-detectable MRD in patients with CLL, and if there was any correlation between the degree of tumor burden pre-SCT and MRD positivity post-SCT. Hardly any studies have addressed these questions before, but it has been proposed that MRD detection post-SCT is related to an increased risk of relapse in patients with B-CLL.8 In the study by Provan et al8 two patients out of 10 were MRD positive after SCT, and both had a relapse 2 years after SCT. This is in contrast to our results, where all patients were MRD positive early post-BMT. UPN 428, in whom MRD was detected more than 3 years post-SCT, without evident relapse, illustrates that detectable MRD does not necessarily cause hematological relapse. The three patients with the most advanced disease prior to SCT, as assessed by the stage of the disease and cytokine analysis, also had the most persistent MRD after SCT. Detectable MRD post-SCT may therefore reflect the tumor burden pre-SCT, in combination with a slow proliferative rate of the malignant cells per se and resistance to high-dose chemotherapy. Consequently, CLL patients may need more time to eradicate residual disease.30,31 MRD and MC disappeared shortly after SCT in patient 554, which may be due to the myeloablative therapy. In patient 609 MRD and MC disappeared after 4 months and in patient 428 after more than 3 years. This may be due to a GVL effect by acute and chronic GVHD in these two patients. The GVL effect is most prominent after chronic GVHD.32 All our patients experienced acute as well as chronic GVHD. Cyclosporine may have an antiproliferative effect on B-CLL.33 However, all patients in this study received cyclosporine in equivalent doses and for a prolonged, but limited, period of time post-SCT. Still, the patients showed different molecular MRD patterns post-SCT. There are earlier reports of a GVL effect in patients with CLL, in whom it has also been suggested that the GVL effect may contribute to control of the disease after transplant.30,34,35 These results may also indicate a potential role for additional immunotherapy by donor T cell infusions post-SCT, especially in patients with persistent MRD. Chimerism analysis after SCT has been reported in only a few patients with CLL. Martino et al36 studied three in whom they observed various patterns of chimerism with no evidence of residual disease (using DNA extraction from whole blood). In the present study, we showed with immunomagnetic cell separation that we increased not only the informative value of chimerism analysis, as shown in UPN 621, but also the sensitivity of the technique. An important question is whether BM should be used or if PB is just as good for detecting MRD. Gribben et al37 demonstrated that BM was a better source than PB in patients with non-Hodgkin’s lymphoma, using PCR amplification of the t(14;18). In CML patients, Lin et al38 analyzed for evidence of BCR-ABL mRNA by using RT-PCR in BM and PB, and showed

Leukemia

that the results from the two sources were similar in all cases. Although few samples from BM and PB were compared in this study, all with concordant results, we suggest that PB can be used in this patient group as well as BM. It has been suggested that sIL-2R and TNF-␣ might represent a reliable marker of tumor burden in CLL.14,15,39 In keeping with this, the highest levels were detected in the patients with most advanced disease, especially in UPN 474 who had signs of progressive disease at SCT. After transplant, the levels fell in all patients and showed a definite relationship to the response of the disease, except in UPN 474 who, at 200 days post-SCT, had peak values which were probably due to an exacerbation of chronic GVHD. Moreover, only patients with persistent molecular disease showed peaks in the levels of TNFa during the first 6 months post-SCT. TNF-␣ has been proposed as an autocrine growth factor for B-CLL cells and has also been shown to enhance the expression of the survival protein BCL-2, which is known to inhibit apoptosis.40–45 UPN 474 and 621, who showed the highest level of residual disease, were the only patients with detectable TNF-␣ more than 1 year post-SCT. In summary, MRD is common in patients with CLL after SCT and prolonged persistence of residual disease may be correlated to the severity of tumor burden pre-SCT. Therefore, we conclude that successful allogeneic stem cell transplantation in patients with CLL requires a durable anti-leukemic effect. Further immunotherapy may play a role in controlling this disease.

Acknowledgements We thank the nursing stuff at the Center for Allogeneic stem cell transplantation and Depts of Hematology and Pediatrics, for excellent patient care. We also thank Lotta Tammik and Giti Bayat for excellent technical assistance and Sussanne ¨ hman for collecting blood samples. This study was supO ported by grants from the Swedish Cancer Foundation (0070B96-10XAC), the Children’s Cancer Foundation (1994-060) and the Swedish Medical Research Council (K97-06X05971-17A).

References 1 Binet JL, Auquier A, Dighiero G, Chastang C, Piguet H, Goasguen J, Vaugier G, Potron G, Colona P, Oberling F, Thomas M, Tchernia G, Jacquillat C, Boivin P, Lesty C, Duault MT, Monconduit M, Belabbes S, Gremy F. A new prognostic classification of chronic lymphocytic leukemia derived from a multivariate survival analysis. Cancer 1981; 48: 198–206. 2 Freedman AS, Boyd AW, Bieber FR, Daley J, Rosen K, Horowitz JC, Levy DN, Nadler LM. Normal cellular counterparts of B cell chronic lymphocytic leukemia. Blood 1987; 70: 418–427. 3 Hoffbrand AV, Panayiotidis P, Reittie J, Ganeshaguru K. Autocrine and paracrine growth loops in chronic lymphocytic leukemia. Semin Hematol 1993; 30: 306–317. 4 Lee JS, Dixon DO, Kantarjian HM, Keating MJ, Talpaz M. Prognosis of chronic lymphocytic leukemia: a multivariate regression analysis of 325 untreated patients. Blood 1987; 69: 929–936. 5 Montserrat E, Gomis F, Vallespi T, Rios A, Romero A, Soler J, Alcala A, Morey M, Ferran C, Diaz-Mediavilla J, Flores A, Woessner S, Batlle J, Gonzalez-Aza C, Rovira M, Reverter JC, Rozman C. Presenting features and prognosis of chronic lymphocytic leukemia in younger adults (see comments). Blood 1991; 78: 1545–1551. 6 Michallet M, Archimbaud E, Bandini G, Rowlings PA, Deeg HJ, Gahrton G, Montserrat E, Rozman C, Gratwohl A, Gale RP. HLA-


7

8

9 10

11

12

13

14

15

16

17

18

19

20 21

identical sibling bone marrow transplantation in younger patients with chronic lymphocytic leukemia. European Group for Blood and Marrow Transplantation and the International Bone Marrow Transplant Registry (see comments). Ann Intern Med 1996; 124: 311–315. Khouri IF, Keating MJ, Vriesendorp HM, Reading CL, Przepiorka D, Huh YO, Andersson BS, van Besien KW, Mehra RC, Giralt SA, Ippoliti C, Marshall M, Thomas MW, O’Brien S, Robertson LE, Deisseroth AB, Champlin RE. Autologous and allogeneic bone marrow transplantation for chronic lymphocytic leukemia: preliminary results. J Clin Oncol 1994; 12: 748–758. Provan D, Bartlett-Pandite L, Zwicky C, Neuberg D, Maddocks A, Corradini P, Soiffer R, Ritz J, Nadler LM, Gribben JG. Eradication of polymerase chain reaction-detectable chronic lymphocytic leukemia cells is associated with improved outcome after bone marrow transplantation. Blood 1996; 88: 2228–2235. Maloum K, Pritsch O, Dighiero G. Minimal residual disease detection in B-cell malignancies by assessing IgH rearrangement. Hematol Cell Ther 1997; 39: 119–124. Esteve J, Villamor N, Colomer D, Bosch F, Lopez-Guillermo A, Rovira M, Urbano-Ispizua A, Sierra J, Carreras E, Montserrat E. Hematopoietic stem cell transplantation in chronic lymphocytic leukemia: a report of 12 patients from a single institution (see comments). Ann Oncol 1998; 9: 167–172. Ugozzoli L, Yam P, Petz LD, Ferrara GB, Champlin RE, Forman SJ, Koyal D, Wallace RB. Amplification by the polymerase chain reaction of hypervariable regions of the human genome for evaluation of chimerism after bone marrow transplantation. Blood 1991; 77: 1607–1615. Mackinnon S, Barnett L, Bourhis JH, Black P, Heller G, O’Reilly RJ. Myeloid and lymphoid chimerism after T-cell-depleted bone marrow transplantation: evaluation of conditioning regimens using the polymerase chain reaction to amplify human minisatellite regions of genomic DNA. Blood 1992; 80: 3235–3241. Socie G, Lawler M, Gluckman E, McCann SR, Brison O. Studies on hemopoietic chimerism following allogeneic bone marrow transplantation in the molecular biology era. Leukemia Res 1995; 19: 497–504. Semenzato G, Foa R, Agostini C, Zambello R, Trentin L, Vinante F, Benedetti F, Chilosi M, Pizzolo G. High serum levels of soluble interleukin 2 receptor in patients with B chronic lymphocytic leukemia. Blood 1987; 70: 396–400. Adami F, Guarini A, Pini M, Siviero F, Sancetta R, Massaia M, Trentin L, Foa R, Semenzato G. Serum levels of tumour necrosis factor-alpha in patients with B-cell chronic lymphocytic leukaemia. Eur J Cancer 1994; 30A: 1259–1263. Cheson BD, Bennett JM, Grever M, Kay N, Keating MJ, O’Brien S, Rai KR. National Cancer Institute-sponsored Working Group guidelines for chronic lymphocytic leukemia: revised guidelines for diagnosis and treatment. Blood 1996; 87: 4990–4997. Ringden O, Remberger M, Persson U, Ljungman P, Aldener A, Andstrom E, Aschan J, Bolme P, Dahllof G, Dalianis T, Gahrton G, Ha¨gglund H, Lo¨nnqvist B, Ollerup O, Shanwell A, Sparrelid E, ¨ berg M, Mo¨ller E. Similar incidence of graft-versusWiniarski J, O host disease using HLA-A, -B and -DR identical unrelated bone marrow donors as with HLA-identical siblings. Bone Marrow Transplant 1995; 15: 619–625. Storb R, Deeg HJ, Whitehead J, Appelbaum F, Beatty P, Bensinger W, Buckner CD, Clift R, Doney K, Farewell V, Hansen J, Hill R, Lum L, Martin P, McGuffin R, Sanders J, Stewart P, Sullivan K, Witherspoon R, Yee G, Thomas ED. Methotrexate and cyclosporine compared with cyclosporine alone for prophylaxis of acute graft versus host disease after marrow transplantation for leukemia. New Engl J Med 1986; 314: 729–735. Ringden O, Pihlstedt P, Markling L, Aschan J, Baryd I, Ljungman P, Lonnqvist B, Tollemar J, Janossy G, Sundberg B. Prevention of graft-versus-host disease with T cell depletion or cyclosporin and methotrexate. A randomized trial in adult leukemic marrow recipients. Bone Marrow Transplant 1991; 7: 221–226. Budowle B, Chakraborty R, Giusti AM, Eisenberg AJ, Allen RC. Analysis of the VNTR locus D1S80 by the PCR followed by highresolution PAGE. Am J Hum Genet 1991; 48: 137–144. Horn GT, Richards B, Klinger KW. Amplification of a highly polymorphic VNTR segment by the polymerase chain reaction. Nucleic Acids Res 1989; 17: 2140.

22 Eubanks JH, Selleri L, Hart R, Rosette C, Evans GA. Isolation, localization, and physical mapping of a highly polymorphic locus on human chromosome 11q13. Genomics 1991; 11: 720–729. 23 Decorte R, Cuppens H, Marynen P, Cassiman JJ. Rapid detection of hypervariable regions by the polymerase chain reaction technique. DNA Cell Biol 1990; 9: 461–469. 24 Buchmayer H, Rumpold H, Mannhalter C. Identification of a variable number tandem repeat region in the human T cell receptor alpha-delta (TCRAD) locus. Hum Genet 1996; 98: 333–335. 25 Jeffreys AJ, Wilson V, Neumann R, Keyte J. Amplification of human minisatellites by the polymerase chain reaction: towards DNA fingerprinting of single cells. Nucleic Acids Res 1988; 16: 10953–10971. 26 Yamada M, Hudson S, Tournay O, Bittenbender S, Shane SS, Lange B, Tsujimoto Y, Caton AJ, Rovera G. Detection of minimal disease in hematopoietic malignancies of the B-cell lineage by using third-complementarity-determining region (CDR-III)-specific probes. Proc Natl Acad Sci USA 1989; 86: 5123–5127. 27 Steward CG, Goulden NJ, Potter MN, Oakhill A. The use of the polymerase chain reaction to detect minimal residual disease in childhood acute lymphoblastic leukaemia. Eur J Cancer 1993; 29A: 1192–1198. 28 Flinn IW, Vogelsang G. Bone marrow transplantation for chronic lymphocytic leukemia. Semin Oncol 1998; 25: 60–64. 29 Rabinowe SN, Soiffer RJ, Gribben JG, Daley H, Freedman AS, Daley J, Pesek K, Neuberg D, Pinkus G, Leavitt PR, Spector NA, Grossbard ML, Anderson K, Robertson MJ, Mauch P, ChaytMarcus K, Ritz J, Nadler LM. Autologous and allogeneic bone marrow transplantation for poor prognosis patients with B-cell chronic lymphocytic leukemia. Blood 1993; 82: 1366–1376. 30 Rondon G, Giralt S, Huh Y, Khouri I, Andersson B, Andreeff M, Champlin R. Graft-versus-leukemia effect after allogeneic bone marrow transplantation for chronic lymphocytic leukemia. Bone Marrow Transplant 1996; 18: 669–672. 31 Jarque I, Palau J, Sanz GF, Guinot M, Gomis F, Martin G, Martinez J, Sanz MA. Delayed complete response after allogeneic bone marrow transplantation in chronic lymphocytic leukemia (letter). Blood 1993; 82: 1036–1038. 32 Weiden PL, Sullivan KM, Flournoy N, Storb R, Thomas ED. Antileukemic effect of chronic graft-versus-host disease: contribution to improved survival after allogeneic marrow transplantation. New Engl J Med 1981; 304: 1529–1533. 33 Wright SJ, Keating MJ. Cyclosporine A in chronic lymphocytic leukemia: dual anti-leukemic and immunosuppressive role? Leuk Lymphoma 1995; 20: 131–136. 34 Khouri IF, Keating M, Korbling M, Przepiorka D, Anderlini P, O’Brien S, Giralt S, Ippoliti C, von Wolff B, Gajewski J, Donato M, Claxton D, Ueno N, Andersson B, Gee A, Champlin R. Transplant-lite: induction of graft-versus-malignancy using fludarabinebased nonablative chemotherapy and allogeneic blood progenitor-cell transplantation as treatment for lymphoid malignancies. J Clin Oncol 1998; 16: 2817–2824. 35 Mehta J, Powles R, Kulkarni S, Treleaven J, Singhal S. Induction of graft-versus-host disease as immunotherapy of leukemia relapsing after allogeneic transplantation: single-center experience of 32 adult patients. Bone Marrow Transplant 1997; 20: 129–135. 36 Martino R, Brunet S, Garcia A, Sureda A, Soler J, Martinez C, Domingo-Albos A, Baiget M. Various patterns of chimerism after allogeneic bone marrow transplantation for advanced chronic lymphocytic leukemia. Bone Marrow Transplant 1995; 16: 783– 786. 37 Gribben JG, Neuberg D, Barber M, Moore J, Pesek KW, Freedman AS, Nadler LM. Detection of residual lymphoma cells by polymerase chain reaction in peripheral blood is significantly less predictive for relapse than detection in bone marrow. Blood 1994; 83: 3800–3807. 38 Lin F, Goldman JM, Cross NC. A comparison of the sensitivity of blood and bone marrow for the detection of minimal residual disease in chronic myeloid leukemia (see comments). Br J Haematol 1994; 86: 683–685. 39 Barak V, Ginzburg M, Kalickman I, Polliack A. Serum soluble interleukin-2 receptor levels are associated with clinical disease status and histopathological grade in non-Hodgkin’s lymphoma and chronic lymphocytic leukemia. Leuk Lymphoma 1992; 7: 431–438.

253

Leukemia


254

Leukemia

40 Cordingley FT, Bianchi A, Hoffbrand AV, Reittie JE, Heslop HE, Vyakarnam A, Turner M, Meager A, Brenner MK. Tumour necrosis factor as an autocrine tumour growth factor for chronic B-cell malignancies. Lancet 1988; 1: 969–971. 41 van Kooten C, Rensink I, Aarden L, van Oers R. Interleukin-4 inhibits both paracrine and autocrine tumor necrosis factor-alphainduced proliferation of B chronic lymphocytic leukemia cells. Blood 1992; 80: 1299–1306. 42 van Kooten C, Rensink I, Aarden L, van Oers R. Cytokines and intracellular signals involved in the regulation of B-CLL proliferation. Leuk Lymphoma 1993; 12: 27–33.

43 Bartik MM, Welker D, Kay NE. Impairments in immune cell function in B cell chronic lymphocytic leukemia. Semin Oncol 1998; 25: 27–33. 44 Miyashita T, Reed JC. Bcl-2 oncoprotein blocks chemotherapyinduced apoptosis in a human leukemia cell line. Blood 1993; 81: 151–157. 45 Sentman CL, Shutter JR, Hockenbery D, Kanagawa O, Korsmeyer SJ. bcl-2 inhibits multiple forms of apoptosis but not negative selection in thymocytes. Cell 1991; 67: 879–888.