Mitochondrial targeting of growth suppressor ... - Wiley Online Library

FEBS Letters 580 (2006) 191–198

Mitochondrial targeting of growth suppressor protein DLC2 through the START domain David Chi-Heng Nga, Shing-Fai Chana, Kin Hang Koka, Judy Wai Ping Yama,b, Yick-Pang Chinga,b, Irene Oi-lin Ngb, Dong-Yan Jina,* a

Department of Biochemistry, Faculty of Medicine, The University of Hong Kong, Pokfulam, Hong Kong Department of Pathology, Faculty of Medicine, The University of Hong Kong, Pokfulam, Hong Kong

b

Received 15 October 2005; accepted 27 November 2005 Available online 9 December 2005 Edited by Veli-Pekka Lehto

Abstract Deleted in liver cancer 2 (DLC2) is a candidate tumor suppressor frequently found to be deleted in hepatocellular carcinoma. In this study, we determined the subcellular localization of DLC2. Co-localization and biochemical fractionation studies revealed that DLC2 localized to mitochondria. In addition, the DLC2-containing cytoplasmic speckles were in proximity to lipid droplets. A DLC2 mutant containing the steroidogenic acute regulatory protein-related lipid transfer (START) domain only showed a localization pattern identical to that of DLC2. Taken together, we have provided the first evidence for mitochondrial localization of DLC2 through the START domain. These findings might have implications in liver physiology and carcinogenesis. 2005 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. Keywords: Deleted in liver cancer 2; Steroidogenic acute regulatory protein-related lipid transfer domain; Mitochondria; Lipid droplets; Growth suppressor protein; Hepatocellular carcinoma

1. Introduction Hepatocellular carcinoma (HCC) is one leading cause of cancer death in Asia and in the World [1]. Hepatocarcinogenesis is a multistage process, in which chromosomal aberrations frequently occur on chromosome 1p, 8p, 13q, 16p and 17p, leading to alteration of genes that govern cell growth and tumor suppression [2]. Well-known tumor suppressor genes involved in HCC include p53, c-myc, p16I N K 4 and b-catenin [3]. However, HCC is genetically heterogeneous and additional tumor suppressors critical in HCC remain to be characterized. Deleted in liver cancer 2 (DLC2), also known as steroidogenic acute regulatory protein-related lipid transfer (START) domain containing protein 13 (STARD13), is a novel growth suppressor protein we have identified [4]. DLC2 is a paralog of DLC1, a known tumor suppressor gene at chromosome * Corresponding author. Fax: +852 2855 1254. E-mail address: [email protected] (D.-Y. Jin).

Abbreviations: DLC2, deleted in liver cancer 2; GAP, GTPase activating protein; HCC, hepatocellular carcinoma; PBS, phosphate buffered saline; SAM, sterile a-motif; SRE, serum response element; StAR, steroidogenic acute regulatory protein; START, steroidogenic acute regulatory protein-related lipid transfer; TRITC, tetramethylrhodamine isothiocyanate

8p22-p21.3 commonly deleted in HCC [5–7]. DLC1 and DLC2 proteins share 51% identity and 64% similarity at the level of their amino acid sequences. Interestingly, DLC2 localizes to chromosome 13q12.3, which is also frequently found to be deleted in HCC. Existing evidence from analysis of DLC2 DNA and mRNA suggests that DLC2 is underexpressed in a significant number of HCC cases. Sequence analysis indicates that DLC2 is a multidomain protein containing sterile a-motif (SAM), GTPase-activating protein (GAP) and START domains [4]. All three domains are also highly conserved in DLC1, since 76%, 74% and 60%, respectively, of their amino acid residues are identical. We have previously shown that DLC2 protein has GAP activity specific for small GTPases RhoA and Cdc42 [4]. Thus, DLC2 should stimulate the hydrolysis of GTP in those GTPases, turning them into inactive GDP-bound form and shutting down the signal transduction [8,9]. Consistent with this, the introduction of human DLC2 into mouse fibroblasts suppresses Ras signaling and Ras-induced cellular transformation in a GAP-dependent manner. Those findings suggest a role for DLC2 in growth suppression and carcinogenesis [4]. While the RhoGAP activity of DLC2 has been characterized [4], the function of its START domain remains to be understood. The START domain has been found in a large variety of proteins with different functions [10,11]. It is a well-conserved lipid-binding domain widely found among lower prokaryotes, archaea and multicellular eukaryotes [12]. Among known START containing proteins in mammals, steroidogenic acute regulatory protein (StAR), metastatic lymph node-64 (MLN64) and phosphatidylcholine transfer protein (PC-TP) are better characterized members, with their protein structure resolved using X-ray crystallography and their lipid ligands identified [12]. StAR and MLN64 specifically bind cholesterol; for PC-TP, the lipid it binds is phosphatidylcholine [13]. StAR is also known to stimulate the intake of cholesterol from cytosol into mitochondria which initiates the production of sterol in steroidogenesis [14]. In this regard, characterization of the START domain in DLC2 will provide new avenues to functional analysis of DLC2, DLC1 and related proteins. In particular, it will be of great interest to see whether the START domain would have an impact on the subcellular localization of DLC2 through interaction with lipids presented in the biological membranes. In this study, we sought to determine the subcellular localization patterns of DLC2 in cultured hepatoma cells using confocal immunofluorescence microscopy. Because other

0014-5793/$32.00 2005 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2005.11.073

192

well-studied START domain proteins such as StAR play a critical role in lipid transport to mitochondria [14], we asked particularly whether DLC2 might associate with mitochondria. We also examined the role of the START domain in this function. Additionally, we also investigated the localization of DLC2 in relation to lipid droplets.

2. Materials and methods 2.1. Plasmids Reporter plasmid pSRE-Luc, in which the expression of firefly luciferase is under the control of multiple copies of serum response elements (SREs; AGGATGTCCATATTAGGACATCT, the consensus sequences are bold), was purchased from Stratagene. Expression vector for dominant active Ras mutant RasV12 has been described [4]. Plasmids pCMV-DLC2, pCMV-DSAM, pCMV-START, pCMVDSTART and pCMV-dGAP are based on expression vector pCMVtag3C (Stratagene). They contained, respectively, the full-length DLC2, truncated DLC2 mutant DLC2-DSAM (119–1113 amino acid residues) without the SAM domain, truncated mutant DLC2-START carrying only the START domain (906–1113 residues) of DLC2, truncated mutant DLC2-DSTART lacking the START domain (908–1113 residues) only, and R699A point mutant DLC2-dGAP with a defective RhoGAP domain [4]. Notably, a Myc epitope has added to the N-terminal of DLC2 and DLC2-DSAM, while the other mutants contain an N-terminal V5 tag. 2.2. Cell culture and transfection Human hepatoma cell line Huh-7 [15] was obtained from Japanese Collection of Research Bioresources. Huh-7 cells were maintained in Dulbecco’s Modified Eagle’s Medium supplemented with 10% fetal bovine serum, 1.5 g/L sodium bicarbonate and antibiotics. Cultured cells were transfected using GeneJuice reagents (Novagen). 2.3. Luciferase assay Dual-luciferase assay was performed with extracts of transiently transfected Huh-7 cells as previously described [4,16]. For this assay, both firefly and Renilla (sea pansy) luciferase reporter enzymes were expressed simultaneously in the cell. The activity of the co-transfected Renilla reporter gene provides an internal control that can be used for normalization of the firefly reporter activity recovered, thereby eliminating the differences in cell viability and transfection efficiency. 2.4. Western blotting Western blotting was carried out as previously described [17]. Briefly, protein extracts prepared from transfected and untransfected Huh-7 cells were solubilized with SDS gel loading buffer (60 mM Tris, 2% SDS, 10% glycerol, 5% 2-mercaptoethanol, 0.1% bromophenol blue), separated by SDS–PAGE, and then electroblotted onto Immobilon-P PVDF-type membranes (Millipore) using a semi-dry blotting apparatus (Hoefer SemiPhor). Blots were blocked with 5% skim milk, followed by incubation with a monoclonal antibody against Myc tag (Amersham) or against V5 tag (Invitrogen). Blots were then incubated with goat anti-mouse secondary antibody conjugated to horseradish peroxidase (Amersham) and visualized by enhanced chemiluminescence (ECL, Amersham). Mitochondria of Huh-7 hepatoma cells were prepared by using mitochondria isolation kit (Sigma). Rabbit polyclonal antibodies against human peroxiredoxin-I or against human peroxiredoxin-III were purchased from Lab Frontier (Seoul, Korea). Secondary antibody was goat anti-rabbit antibody conjugated to horseradish peroxidase (Amersham). 2.5. Confocal microscopy Laser-scanning confocal immunofluorescence microscopy was performed as previously described [18,19]. Briefly, monolayer Huh-7 cells were grown overnight on coverslips put in six-well plate. Transfected cells were washed with phosphate buffered saline (PBS) and fixed with freshly prepared 4% paraformaldehyde, buffered in PBS, for 10 min at room temperature. Membrane on fixed cells was permeabilized with

D.C.-H. Ng et al. / FEBS Letters 580 (2006) 191–198 0.1% Triton-X100/PBS for 10 min at room temperature. To minimize non-specific staining, a 3% bovine serum albumin in PBS was used to incubate the treated cells for 30 min at room temperature. Incubation with primary antibodies (rabbit polyclonal anti-Myc antibody from Santa Cruz and mouse monoclonal anti-V5 from Invitrogen) was typically for 8 h at 40 C, and with secondary antibodies (fluorescein-conjugated donkey polyclonal anti-rabbit IgG from Chemicon and fluorescein-conjugated rat polyclonal anti-mouse IgG from Zymax), it was typically for 2 h at room temperature. Mitochondria marker Mitotracker Red CMXRos (Molecular Probes) was added to culture medium 10 min prior to cell harvest to maximize staining and minimize background. Lipid stain Nile red (Sigma) was applied and incubated at room temperature for 30 more minutes. The coverslips were washes for several times with PBS and then mounted on slides with Mowiol mounting medium (Mowiol 4-88 from Sigma, prepared in glycerol and Tris–Cl, pH 8.5). Antifade reagent 1,4-diazabicyclo-[2.2.2]octane can be added to the prepared Mowiol solution to prevent photobleaching of the green signal. Double labeling was achieved by using different fluorophores (e.g., fluorescein and tetramethylrhodamine isothiocyanate (TRITC)). Images were mostly captured at 63· magnification with the help of the LaserSharp software. Some images were further enlarged using Adobe Photoshop.

3. Results 3.1. Expression of DLC2 in cultured hepatoma cells We have previously demonstrated DLC2 to be a novel RhoGAP protein that has growth suppressor activity and is frequently underexpressed in HCC tissues and cells [4]. In that published work, we have not been able to express full-length DLC2 in cultured HepG2 and Hep3B hepatoma cells, probably due to the cytotoxic effects induced by ectopic expression. Further optimization of the conditions for transfection led to successful expression of Myc-tagged DLC2 at low level in human Huh-7 hepatoma cells as detected by Western blotting (Fig. 1A, lane 1 compared to lane 2). A V5-tagged DLC2 mutant containing the START domain only (DLC2-START or START) was also efficiently expressed in Huh-7, Hep3B and other cell lines without inducing cytotoxicity (Fig. 1A, lane 3 compared to lane 4). In order to obtain a quick answer on the functionality of DLC2 and DLC2-START in cultured cells, we compared their abilities to regulate cell signaling. If DLC2 is functional, it should have an impact on Ras signaling, because DLC2 is a GAP protein specific for RhoA and Cdc42 that are activated by Ras [20,21]. Previously, we have shown that a truncated version of DLC2 (i.e., DLC2-GAP) is capable of suppressing Ras-induced activation of SRE and Ras-dependent transformation of NIH3T3 cells [4]. SRE is an important effector of RhoA and Cdc42 [22] and can be activated potently by RasV12, a constitutively active mutant of Ras [23]. In keeping with this, we noted that RasV12 efficiently activated SRE-driven expression of luciferase reporter (Fig. 1B, compare column 2 to column 1). In this experimental setting, if DLC2 functions as a RhoGAP protein intracellularly, it should inhibit the stimulation of SRE by RasV12. Indeed, we observed that DLC2, when expressed in Huh-7 cells, can significantly reduce the activation of SRE-dependent luciferase reporter expression by RasV12 (Fig. 1B, compare column 3 to column 2). In contrast, DLC2-START is unable to inhibit SRE activity (Fig. 1B, compare column 4 to column 3). These results provided the first evidence that DLC2 is functional in suppressing Ras signaling in mammalian cells.

D.C.-H. Ng et al. / FEBS Letters 580 (2006) 191–198

193

Fig. 1. Expression and activity of DLC2 in Huh-7 hepatoma cells. (A) Western blot analysis. Huh-7 cells were mock-transfected (lanes 2 and 4) or transfected with an expression plasmid for Myc-tagged DLC2 (lane 1) or V5-tagged DLC2-START (lane 3). Equal amount (10 lg) of protein was loaded onto each lane. The blots were probed with anti-Myc (lanes 1 and 2) or anti-V5 (lanes 3 and 4) antibody. DLC2 of >120 kDa and DLC2START of 27 kDa in size are indicated. Also shown are migration positions of molecular weight markers. (B) Suppression of Ras-induced activation of SRE by DLC2. Huh-7 cells were transfected with pSRE-Luc alone (column 1), pSRE-Luc + RasV12 (column 2), pSRELuc + RasV12 + DLC2 (column 3) and pSRELuc + RasV12 + DLC2-START (column 4). Results are representative of three independent experiments and the error bars indicate S.E. Luc activity: firefly luciferase activity in arbitrary units normalized to Renilla luciferase activity.

3.2. Subcellular localization of DLC2 Subcellular localization of a protein often provides critical information for its function. In agreement with previous findings on rat DLC1/p122RhoGAP [24], the overexpression of DLC2 by adding a higher concentration of expression plasmid (1 lg/ml) in the transfection mixture caused substantial cell death and detachment. This cytotoxicity is probably due to the high RhoGAP activity of DLC2. In order to achieve better expression of DLC2 in cultured Huh-7 cells, we adjusted the conditions for transient transfection. This optimization, which involved a 10-fold reduction of plasmid concentration to 0.1 lg/ml in the transfection mixture, led to significant reduction of cell death or detachment. Under this condition, about 15% of the cells were normally transfected. All viable transfected cells showed expression of DLC2 in the cytoplasm (Fig. 2, panels A–C). In particular, the DLC2specific signal was punctuate, suggesting that DLC2 was concentrated in cytoplasmic speckles (Fig. 2, panels A–C). Notably, the localization patterns of full-length DLC2 and DLC2 mutant DLC2-DSAM without the N-terminal SAM domain and DLC2-START were very similar (Fig. 2, compare panels D–F to panels A–C). Thus, the N-terminal SAM domain is dispensable for DLC2 localization. In addition to the catalytic GAP domain, DLC2 and DLC2DSAM also share a START domain that might have regula-

tory function. Hence, we next addressed the question as to whether the START domain is essential for the subcellular localization of DLC2. The START domain is located at the very end of DLC2, near the C terminal. Analysis of the amino acid sequence has revealed no noticeable localization signal on this portion of DLC2. However, the START domain is thought to be lipophilic [14]. A mutant of DLC2 containing the START domain alone, named DLC2-START, was constructed and expressed as a V5-tagged protein in Huh-7 cells (Fig. 1A, lane 3). Under the confocal microscope, DLC2START was found to be in dotted form throughout the cytosol, although some cells had DLC2-START protein aggregates in the perinuclear region (Fig. 2, panels G–I). This localization pattern of DLC2-START resembles that observed in cells transfected with DLC2 and DLC2-DSAM (Fig. 2, compare panels G–I to panels A–F). In another word, the START domain can sufficiently target DLC2 to a particular intracellular compartment. In further support of this role of DLC2START, a DLC2 mutant lacking the START domain only (DLC2-DSTART) was found to distribute homogenously in the cytoplasm (Fig. 2, panels J–L). In contrast, the R699A point mutant of DLC2 with a defective RhoGAP domain (DLC2-dGAP) and an intact START domain, which could be expressed abundantly in various cell lines without inducing cytotoxicity, localized to perinuclear speckles. The localization

194


3.3. Mitochondrial localization of DLC2 As the subcellular localization of DLC2 holds the clues to its function, it will be of great interest to define the identity of these DLC2-containing speckles. In light of the facts that mitochondria are important in lipid metabolism [25] and that other START domain proteins such as StAR play a role in lipid transport into mitochondria [14], this organelle is one possible target of DLC2. To study this possibility, a commercially available chemical stain for mitochondria, known as MitoTracker-TRITC [26], was used to co-stain Huh-7 cells transfected with either Myc-tagged DLC2 (Fig. 3) or V5-tagged DLC2-START (data not shown). Interestingly, a significant portion of DLC2 co-localized with mitochondria, as shown in Fig. 3 (see panel C for yellow patches indicating co-localization). Computer-assisted analysis showed that the DLC2 staining overlapped that of mitochondria perfectly. In fact, over 75% of the fields captured showed such co-localization of DLC2 and mitochondria. Noteworthily, almost all DLC2 signals overlapped those of mitochondria, but not all mitochondria were targeted by DLC2. The co-localization of DLC2 with mitochondria (Fig. 3, panels A–C) and the similar localization patterns of DLC2 and DLC2-START (Fig. 2) strongly suggest that DLC2START would also localize to mitochondria. Indeed, concentrated DLC2-START speckles co-stained with MitoTracker-TRITC both in both Huh-7 and HeLa cells (Fig. 3, panels D–I), indicating that the START domain targets DLC2 to mitochondria. To verify the mitochondrial localization of DLC2, biochemical fractionation experiments were carried out. Mitochondria were isolated from the lysate of Huh-7 cells transfected with Myc-DLC2 and probed with an anti-Myc antibody (Fig. 4). The Myc-tagged DLC2 protein was found both in the total cell lysate and in the mitochondrial fraction (Fig. 4A, lanes 1 and 2). As a control, we also examined human peroxiredoxin-I and peroxiredoxin-III, which are known to localize primarily to the cytoplasm and mitochondria, respectively [18,27,28]. While mitochondrial peroxiredoxin-III was found both in the total cell lysate and in the mitochondria (Fig. 4C), cytoplasmic peroxiredoxin I was detected only in the total cell lysate, but not the mitochondrial fraction (Fig. 4B, compare lane 1 to lane 2). That is to say, the mitochondria prepared in our experiment were not contaminated with the cytoplasmic fraction. Thus, our results from biochemical fractionation confirmed the mitochondrial localization of DLC2. Fig. 2. Subcellular localization of DLC2 and its mutants in Huh-7 cells. Huh-7 cells were transfected with 0.1 lg/ml of plasmid expressing Myc- or V5-tagged DLC2 (panels A–C), DLC2-DSAM (D–F), DLC2START (G–I), DLC2-DSTART (J–L) or DLC2-dGAP (M–O). A schematic diagram of the domain structure of DLC2 and its mutants is also shown (P). Cells were stained for DLC2 with mouse monoclonal anti-Myc (panels B and E) or anti-V5 (panels H, K and N). Nuclear morphology was visualized by counterstaining with propidium iodide (PI; panels A, D, G, J and M). The green (representing DLC2) and red (representing PI) fluorescent signals were merged by computer assistance (panels C, F and I). The same fields of cells are shown in panels A–C, D–F, G–I, J–L and M–O.

patterns of DLC2, DLC2-DSAM, DLC2-START and DLC2dGAP were very similar. Collectively, our data demonstrated for the first time an intracellular function of the START domain in DLC2.

3.4. Localization of DLC2 in relation to lipid droplets The START domain is thought to have lipid-binding activity [14]. To study the interaction of DLC2 with intracellular lipids, we asked whether the DLC2-specific fluorescent signals would overlap with lipid-reactive dyes. It is well known that intracellular lipids can be stained with various dyes such as Nile red and Sudan III [29]. Hence, we co-stained lipid-rich Huh-7 hepatoma cells for both DLC2-START and lipids using an anti-Myc antibody and Nile red, respectively (Fig. 5). DLC2-START was used in this experiment because the localization patterns of DLC2 and DLC2-START are very similar (Fig. 2). As shown in Fig. 5, the speckles containing DLC2-START localized around the lipid droplets stained by Nile red. Interestingly, the two signals did not overlap substantially with each


195

Fig. 3. Mitochondrial localization of DLC2 and DLC2-START. Huh-7 cells were transfected with 0.1 lg/mL pCMV-DLC2 plasmid expressing DLC2 (panels A–C). Huh-7 (panels D–F) or HeLa (panels G–I) cells were transfected with 0.5 lg/mL pCMV-START plasmid expressing DLC2START. Cells were then stained for DLC2 or DLC2-START with mouse monoclonal anti-Myc (panel B) or anti-V5 (panels E and H), and for mitochondria with MitoTracker CMXRos conjugated to TRITC (Molecular Probes; panels A, D and G). The green (representing DLC2 or DLC2START) and red (representing mitochondria) fluorescent signals were merged by computer assistance (panels C, F and I). Co-localization is in yellow (highlighted with arrows). The same fields of cells are shown in panels A–C, D–F and G–I. Similar results were also obtained with DLC2-START in NIH3T3 cells (data not shown).

other, but a major portion of DLC2-START was found to be in proximity to the droplets of lipid (Fig. 5, panels C and F). Thus, consistent with its putative lipid-binding or lipid-transfer activity, the START domain of DLC2 likely serves a lipid-related function in the cell and it targets DLC2 to areas proximal to the lipid droplets.

4. Discussion In this study, we determined the subcellular localization of growth suppressor protein DLC2 in human Huh-7 hepatoma cells using confocal immuno-fluorescence microscopy. First we performed Western blotting to verify the transient expression and functionality of full-length DLC2 in Huh-7 hepatoma cells (Fig. 1). Then we defined a novel pattern for DLC2 localization and demonstrated the role of the START domain in intracellular targeting of DLC2 (Fig. 2). We established that DLC2 localized to mitochondria via the START domain (Figs. 3 and 4). Finally, we also documented that the DLC2-containing cytoplasmic speckles were in proximity to lipid droplets (Fig. 5). 4.1. Function of START domain in DLC2 Our findings establish one function of the START domain in targeting DLC2 to subcellular compartments overlapping with mitochondria and proximal to the lipid droplets. This function

is consistent with the predicted lipid-binding or lipid-transfer activity of the START domain [14,30]. Actually the START domain in some other proteins might also play a similar role in protein targeting by tethering to membrane or to other START containing proteins [31]. Further investigation on DLC2-START will provide additional insight into the cellular function of DLC2 and related proteins. In this context, the identification of the lipid ligand of DLC2-START remains an important task for the next stage of our investigation. In addition, we will also investigate the relevance of this lipidbinding activity to the predicted interaction with and regulatory role on phospholipase Cd1, which has been demonstrated for rat DLC1 [32]. Other START domain proteins such as MLN64 are critically involved in carcinogenesis or metastasis [33]. The function of the START domain in protein targeting raises another interesting question as to whether this domain is required for the growth suppressive activity of DLC2. It also remains to be understood whether the START domain of DLC2 might serve as a molecular switch to regulate RhoGAP activity upon binding with lipids. In this regard, RhoGAP protein p190 has previously been shown to be regulated by phospholipids [34]. On the other hand, it is unclear whether the RhoGAP activity of DLC2 might have an impact on the function of the START domain. All these questions concerning the START domain of DLC2 warrant further study.

196

Fig. 4. Detection of DLC2 in the mitochondrial fraction. Huh-7 cells were transfected with an expression plasmid for Myc-tagged DLC2. Biochemical fractionation was performed to isolate mitochondria. Equal amounts (8 lg) of protein from total cell lysate (total; lane 1) or from mitochondrial fraction (mito; lane 2) were loaded. The blots were probed with anti-Myc (A), anti-Prx-I (B) or anti-Prx-III antibody.

In general, our findings on DLC2-START are in keeping with a recent study which has suggested that the START domain in DLC1 is functional [35]. While the START domains in DLC2 and DLC1 are highly conserved, the subcellular localization of DLC1 has not been extensively studied. Thus, it will be of great interest to see whether the START domain might also target DLC1 to mitochondria.


4.2. Mitochondrial localization of DLC2 in relation to lipid droplets Our findings that DLC2 localizes to cytoplasmic speckles overlapping with mitochondria and proximal to lipid droplets are consistent with recent results from proteomic analysis of adipocytes, which reveal a close association of lipid droplets with mitochondria [36]. Lipid droplets are a reservoir of lipids for the synthesis and maintenance of membranes [36]. The mechanisms by which lipids are transported into and out of lipid droplets are poorly understood. Yet, various lipid metabolic enzymes have been found in or around the lipid droplets. The appearance of DLC2 in cytoplasmic speckles surrounding the lipid droplets suggests that DLC2 might serve a lipid-related function. Further characterization of the cellular function of DLC2 in relation to lipid droplets requires the verification of the lipidbinding activity of DLC2 and the identification of its lipid ligand. Prototypic START domain proteins StAR and MLN64 play a pivotal role in lipid transport into mitochondria [14,37]. Particularly, StAR localizes to the mitochondria and promotes the translocation of cholesterol from outer to inner mitochondrial membranes [31]. The localization of DLC2 to mitochondria in tight association with lipid droplets implicates a role of DLC2 in mitochondrial lipid transport. This notion is further strengthened by a recent report on a ‘‘RhoGAP encoded on chromosome 13q12’’, which turns out to be DLC2 [38]. In that study, the entire coding sequence of DLC2 was used as bait in a yeast-2-hybrid screen and several interesting proteins that potentially bind to DLC2 were identified. Among those candidates, HMG-CoA reductase is more interesting than others as it is involved in the energy pathway found in mitochondria. HMG-CoA is the rate limiting enzyme in cholesterol biosynthesis [39]. Since the START domain of DLC2 is actively targeted to the mitochondria, it is reasonable to hypothesize that this START domain will indeed tether with HMG-CoA in vivo and play a pivotal role in the lipid biosynthesis pathway.

Fig. 5. Subcellular localization of DLC2-START in relation to lipid droplets. Hepatoma Huh-7 cells were transfected with expression plasmid for V5-tagged DLC2-START. Cells were then stained for DLC2 with mouse monoclonal anti-V5 (panels B and E) and for lipid droplets with Nile red (panels A and D). The green (representing DLC2) and red (representing lipid droplets) fluorescent signals were merged by computer assistance (panels C and F). Co-localization should be in yellow. The same fields of cells are shown in panels A–C and D–F.


DLC2 is thought to be a tumor suppressor protein in HCC [4]. The mitochondrial targeting of DLC2 raises the interesting possibility that DLC2 might fulfill its growth suppressive function by regulating mitochondrial membrane permeability and the mitochondrial pathway of apoptosis [40]. Thus, it will be of interest to investigate whether DLC2 modulates cell survival and how this modulation contributes to its effects on cell proliferation. In connection to this, the relationship between mitochondrial targeting of DLC2 and the induction of apoptosis merits further investigations. Acknowledgments: D.-Y.J is a Leukemia and Lymphoma Society Scholar. This work was supported in part by a grant to I.O.-l.N. and D.Y.J. from the Hong Kong Research Grants Council (Project HKU 7281/01M).

197

[16] [17] [18] [19]

[20] [21]

References [1] Bosch, F.X., Ribes, J., Dıáz, M. and Cle´ries, R. (2004) Primary liver cancer: worldwide incidence and trends. Gastroenterology 127, S5–S16. [2] Nagai, H., Pineau, P., Tiollais, P., Buendia, M.A. and Dejean, A. (1997) Comprehensive allelotyping of human hepatocellular carcinoma. Oncogene 14, 2927–2933. [3] Thorgeirsson, S.S. and Grisham, J.W. (2002) Molecular pathogenesis of human hepatocellular carcinoma. Nat. Genet. 31, 339– 346. [4] Ching, Y.-P., Wong, C.-M., Chan, S.-F., Leung, T.H.-Y., Ng, D.C.-H., Jin, D.-Y. and Ng, I.O.-L. (2003) Deleted in liver cancer (DLC) 2 encodes a RhoGAP protein with growth suppressor function and is underexpressed in hepatocellular carcinoma. J. Biol. Chem. 278, 10824–10830. [5] Yuan, B.-Z., Miller, M.J., Keck, C.L., Zimonjic, D.B., Thorgeirsson, S.S. and Popescu, N.C. (1998) Cloning, characterization, and chromosomal localization of a gene frequently deleted in human liver cancer (DLC-1) homologous to rat RhoGAP. Cancer Res. 58, 2196–2199. [6] Ng, I.O.L., Liang, Z.-D., Cao, L. and Lee, T.K. (2000) DLC-1 is deleted in primary hepatocellular carcinoma and exerts inhibitory effects on the proliferation of hepatoma cell lines with deleted DLC-1. Cancer Res. 60, 6581–6584. [7] Wong, C.M., Lee, J.M.F., Ching, Y.P., Jin, D.-Y. and Ng, I.O.L. (2003) Genetic and epigenetic alterations of DLC-1 gene in hepatocellular carcinoma. Cancer Res. 63, 7646–7651. [8] Hall, A. (1998) Rho GTPases and the actin cytoskeleton. Science 279, 509–514. [9] Moon, S.Y. and Zheng, Y. (2003) Rho GTPase-activating proteins in cell regulation. Trends Cell Biol. 13, 13–22. [10] Masucci, J.D., Rerie, W.G., Foreman, D.R., Zhang, M., Galway, M.E., Marks, M.D. and Schiefelbein, J.W. (1996) The homeobox gene GLABRA2 is required for position-dependent cell differentiation in the root epidermis of Arabidopsis thaliana. Development 122, 1253–1260. [11] Ponting, C.P., Schultz, J., Milpetz, F. and Bork, P. (1999) SMART: identification and annotation of domains from signalling and extracellular protein sequences. Nucleic Acids Res. 27, 229–232. [12] Iyer, L.M., Koonin, E.V. and Aravind, L. (2001) Adaptations of the helix-grip fold for ligand binding and catalysis in the START domain superfamily. Proteins 43, 134–144. [13] Soccio, R.E., Adams, R.M., Romanowski, M.J., Sehayek, E., Burley, S.K. and Breslow, J.L. (2002) The cholesterol-regulated StarD4 gene encodes a StAR-related lipid transfer protein with two closely related homologues, StarD5 and StarD6. Proc. Natl. Acad. Sci. USA 99, 6943–6948. [14] Strauss III, J.F., Kishida, T., Christenson, L.K., Fujimoto, T. and Hiroi, H. (2003) START domain proteins and the intracellular trafficking of cholesterol in steroidogenic cells. Mol. Cell. Endocrinol. 202, 59–65. [15] Nakabayashi, H., Taketa, T., Miyano, K., Yamane, T. and Sato, J. (1982) Growth of human hepatoma cells lines with differenti-

[22] [23] [24]

[25] [26]

[27]

[28]

[29] [30] [31] [32] [33]

[34]

[35]

[36]

ated functions in chemically defined medium. Cancer Res. 42, 3858–3863. Huang, G.-J., Zhang, Z.-Q. and Jin, D.-Y. (2002) Stimulation of IKK-c oligomerization by the human T-cell leukemia virus oncoprotein Tax. FEBS Lett. 531, 494–498. Chun, A.C.S. and Jin, D.-Y. (2003) Transcriptional regulation of mitotic checkpoint gene MAD1 by p53. J. Biol. Chem. 278, 37439–37450. Jin, D.-Y., Chae, H.Z., Rhee, S.G. and Jeang, K.-T. (1997) Regulatory role for a novel human thioredoxin peroxidase in NFjB activation. J. Biol. Chem. 272, 30952–30961. Chin, K.-T., Zhou, H.-J., Wong, C.-M., Lee, J.M.-F., Chan, C.P., Qiang, B.-Q., Yuan, J.-G., Ng, I.O.-L. and Jin, D.-Y. (2005) The liver-enriched transcription factor CREB-H is a growth suppressor protein underexpressed in hepatocellular carcinoma. Nucleic Acids Res. 33, 1859–1873. Bar-Sagi, D. and Hall, A. (2000) Ras and Rho GTPases: a family reunion. Cell 103, 227–238. Sahai, E. and Marshall, C.J. (2002) RHO-GTPases and cancer. Nat. Rev. Cancer 2, 133–142. Hill, C.S., Wynne, J. and Treisman, R. (1995) The Rho family GTPases RhoA, Rac1, and CDC42Hs regulate transcriptional activation by SRF. Cell 81, 1159–1170. Joneson, T., White, M.A., Wigler, M.H. and Bar-Sagi, D. (1996) Stimulation of membrane ruffling and MAP kinase activation by distinct effectors of RAS. Science 271, 810–812. Sekimata, M., Kabuyama, Y., Emori, Y. and Homma, Y. (1999) Morphological changes and detachment of adherent cells induced by p122, a GTPase-activating protein for Rho. J. Biol. Chem. 274, 17757–17762. Daum, G. (1985) Lipids of mitochondria. Biochim. Biophys. Acta 822, 1–42. Simpson, P.B., Mehotra, S., Lange, G.D. and Russell, J.T. (1997) High density distribution of endoplasmic reticulum proteins and mitochondria at specialized Ca2+ release sites in oligodendrocyte processes. J. Biol. Chem. 272, 22654–22661. Gourlay, L.J., Bhella, D., Kelly, S.M., Price, N.C. and Lindsay, J.G. (2003) Structure–function analysis of recombinant substrate protein 22 kDa (SP-22): a mitochondrial 2-CYS peroxiredoxin organized as a decameric toroid. J. Biol. Chem. 278, 32631–32637. Zhou, Y., Kok, K.H., Chun, A.C.S., Wong, C.M., Wu, H.W., Lin, M.C.M., Fung, P.C.W., Kung, H.-f. and Jin, D.-Y. (2000) Mouse peroxiredoxin V is a thioredoxin peroxidase that inhibits p53-induced apoptosis. Biochem. Biophys. Res. Commun. 268, 921–927. Fukumoto, S. and Fujimoto, T. (2002) Deformation of lipid droplets in fixed samples. Histochem. Cell Biol. 118, 423–428. Alpy, F. and Tomasetto, C. (2005) Giving lipids a START: the StAR-related lipid transfer (START) domain in mammals. J. Cell Sci. 118, 2791–2801. Soccio, R.E. and Breslow, J.L. (2003) StAR-related lipid transfer (START) proteins: mediators of intracellular lipid metabolism. J. Biol. Chem. 278, 22183–22186. Homma, Y. and Emori, Y. (1995) A dual functional signal mediator showing RhoGAP and phospholipase C-delta stimulating activities. EMBO J. 14, 286–291. Moog-Lutz, C., Tomasetto, C., Regnier, C.H., Wendling, C., Lutz, Y., Muller, D., Chenard, M.-P., Basset, P. and Rio, M.-C. (1997) MLN64 exhibits homology with the steroidogenic acute regulatory protein (STAR) and is over-expressed in human breast carcinomas. Int. J. Cancer 71, 183–191. Ligeti, E., Dagher, M.C., Hernandez, S.E., Koleske, A.J. and Settleman, J. (2004) Phospholipids can switch the GTPase substrate preference of a GTPase-activating protein. J. Biol. Chem. 279, 5055–5058. Yamaga, M., Sekimata, M., Fujii, M., Kawai, K., Kamata, H., Hirata, H., Homma, Y. and Yagisawa, H. (2004) A PLCd1binding protein, p122/RhoGAP, is localized in caveolin-enriched membrane domains and regulates caveolin internalization. Genes Cells 9, 25–37. Brasaemle, D.L., Dolios, G., Shapiro, L. and Wang, R. (2004) Proteomic analysis of proteins associated with lipid droplets of basal and lipolytically stimulated 3T3-L1 adipocytes. J. Biol. Chem. 279, 46835–46842.

198 [37] Zhang, M., Liu, P., Dwyer, N.K., Christenson, L.K., Fujimoto, T., Martinez, F., Comly, M., Hanover, J.A., Blanchette-Mackie, E.J. and Strauss III, J.F. (2002) MLN64 mediates mobilization of lysosomal cholesterol to steroidogenic mitochondria. J. Biol. Chem. 277, 33300–33310. [38] Nagaraja, G.M. and Kandpal, R.P. (2004) Chromosome 13q12 encoded Rho GTPase activating protein suppresses growth of breast carcinoma cells, and yeast two-hybrid screen shows its

D.C.-H. Ng et al. / FEBS Letters 580 (2006) 191–198 interaction with several proteins. Biochem. Biophys. Res. Commun. 313, 654–665. [39] Danesh, F.R. and Kanwar, Y.S. (2004) Modulatory effects of HMG-CoA reductase inhibitors in diabetic microangiopathy. FASEB J. 18, 805–815. [40] Breckenridge, D.G. and Xue, D. (2004) Regulation of mitochondrial membrane permeabilization by BCL-2 family proteins and caspases. Curr. Opin. Cell Biol. 16, 647–652.