Modulation of virulence gene expression by cell wall ...

J Antimicrob Chemother 2011; 66: 979 – 984 doi:10.1093/jac/dkr043 Advance Access publication 9 March 2011

Modulation of virulence gene expression by cell wall active antibiotics in Staphylococcus aureus Natalia Subrt , Lili Rosana Mesak and Julian Davies * Department of Microbiology and Immunology, University of British Columbia, Vancouver, BC V6T 1Z3 Canada *Corresponding author. Department of Microbiology and Immunology, Life Science Institute, University of British Columbia, 2350 Health Science Mall, Vancouver, BC V6T 1Z3 Canada. Tel: +1-604-822-9308; Fax: +1-604-822-6041; E-mail: [email protected]

Received 1 November 2010; returned 29 November 2010; revised 23 December 2010; accepted 26 January 2011

Methods: Promoter regions of spa, lukE and agr RNAIII were cloned upstream of a modified luxABCDE reporter. Using disc diffusion assays, the effects of antibiotics were observed on gene expression and quantitative realtime PCR was employed to confirm the results. Assays were performed to measure biofilm formation in wildtype S. aureus and respective spa-deficient and small colony variant mutants in the presence of subinhibitory concentrations of antibiotics. Results: Expression of spa and lukE was stimulated by subinhibitory concentrations of penicillin and cefalotin, while agr RNAIII expression was not affected. Denser biofilms were formed by S. aureus Newman and its small colony variant in the presence of subinhibitory concentrations of cefalotin. Conclusions: Subinhibitory concentrations of certain antibiotics have been shown to stimulate virulence gene expression in S. aureus; this may alter the progression of infection and thus render antimicrobial therapy unreliable. The use of appropriate combinations of antibiotics might be an approach to avoiding this situation. Promoter-lux reporters are sensitive tools for studying the modulation of transcription by antibiotic inhibitors, and could be used to predict novel therapeutic combinations for the treatment of infection. Keywords: transcription modulation, biofilm formation, antibiotics, pathogenesis, promoter-lux reporter

Introduction Staphylococcus aureus is a Gram-positive pathogen that causes community-acquired and nosocomial infections ranging from carbuncles and food poisoning to acute endocarditis and necrotizing pneumonia.1,2 During antimicrobial therapy bacteria may be exposed to sub-MICs of antibiotics.3 Low doses of antimicrobial compounds modulate expression of genes encoding factors essential for housekeeping and metabolic functions, and also those necessary to establish an infection.4 – 6 Some 60 years ago, S. aureus was susceptible to all antibiotics, but in the intervening years strains of this pathogen (like others) have developed resistance to almost every available antimicrobial agent. Repeated chemical modification of active compounds, most particularly the b-lactam class, have provided derivatives effective in the short term, but the pathogen has rapidly evolved new resistance mechanisms with each new introduction. This may be due in part to the mutagenesis-stimulating activity of sub-MIC antibiotics; such exposure also enhances virulence gene expression and concomitant aggravation of disease caused by S. aureus.6

Here, we report studies examining the effects of low concentrations of antimicrobial compounds on virulence gene expression in S. aureus. S. aureus virulence is multifactorial, involving the production of a variety of cell-bound and secreted proteins as well as the formation of biofilms. These processes are under the control of global regulators, especially the accessory gene regulon (Agr).2 Agr is a two-component signal transduction quorum-sensing system that acts, at increased bacterial cell densities, to produce a regulatory RNA molecule (RNAIII), which in turn inhibits expression of cell wall associated proteins and facilitates the production of exotoxins (Figure 1).7 Staphylococcal protein A (Spa), a cell wall anchored protein, prevents opsonophagocytosis and interacts with von Willebrand factor, mediating intravascular infection.8 – 10 Production of Spa is down-regulated by RNAIII through inhibition of SarS, a DNA-binding protein that normally activates transcription of spa.11 RNAIII also up-regulates expression of leukotoxins E and D, two secreted proteins that act in concert to bind to polymorphonucleocytes, open Ca2+

# The Author 2011. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: [email protected]

979

Downloaded from http://jac.oxfordjournals.org/ by guest on December 31, 2015

Objectives: To investigate the effect of subinhibitory concentrations of cell wall active antibiotics on virulence gene expression and biofilm formation in Staphylococcus aureus Newman and in laboratory strains.

Subrt et al.

(a)

(b)

channels and allow influx of Na+ and K+ ions, thus permitting S. aureus to evade the host immune system.12,13 S. aureus has the ability to form small colony variants that produce decreased amounts of exotoxins, thus avoiding detection by the immune system.14 Such variants are deficient in electron transport, a property that makes them resistant to aminoglycosides and allows them to persist inside the cell; they are believed to be one of the sources of recurrent staphylococcal infections.15 Staphylococcal cell wall functions are the major targets for antimicrobial therapy. In this study we investigated transcription modulation of spa, lukE and agr RNAIII in the presence of sub-MICs of a number of cell wall active antibiotics using the promoter –reporter fusions spa-lux, lukE-lux and agrP3-lux, respectively, in S. aureus hosts Newman, 8325-4, RN4220, ALC488 and ALC1927. We examined combinations of antimicrobials that might influence the production of virulence factors during antibiotic therapy and investigated the effects of antibiotics on biofilm formation in S. aureus Newman on its hemB-deficient mutant, which mimics the small colony variant phenotype, and also a spa-deficient mutant.

Table 1. Strains and plasmids used in this study Strain and plasmid S. aureus 8325-4 RN4220 ALC488 ALC1927 Newman Spa knockout III33 Plasmid pAmilux pAmiSpa2 pAmiAgrP3 pAmiLukE

Relevant characteristics

Reference

Prophage cured strain of NCTC 8325 harbouring an 11 bp deletion in rsbU restriction-negative mutant of 8325-4, cloning host sarA::ermC of RN6390 sarS::ermC of RN6390 methicillin-sensitive clinical isolate spa::kan mutant of S. aureus Newman hemB::ermB small colony variant mutant of Newman

26

S. aureus—E. coli shuttle vector luxABCDE (lux) spa-lux agrP3-lux lukE-lux

16

27 26 26 28 T. J. Foster 29

16 this study this study

Materials and methods Strains, plasmids and growth conditions used in this study S. aureus strains and E. coli DH10B were grown at 378C in NYE [1% casein hydrolysate (Sigma), 0.5% yeast extract (Difco) and 0.5% NaCl (Fisher Scientific)] and Luria– Bertani (LB) [1% tryptone (Difco), 0.5% yeast extract (Difco) and 0.5% NaCl (Fisher Scientific)] media, respectively. S. aureus hosts for promoter-lux reporter fusions are listed in Table 1. Antibiotics were obtained from Sigma and antibiotic discs from Becton Dickinson (BD) and Difco.

45 s; and 728C for 5 min. The PCR products were digested with BamHI (New England Biolabs) and ligated into BamHI-digested and phosphatase-treated pAmilux16 using T4 DNA ligase (New England Biolabs). The ligation mix was transformed into E. coli DH10B and transformants selected on LB agar supplemented with 100 mg/L of ampicillin. The insert orientation was confirmed by sequencing using primers as shown in Table 2 and plasmid DNA, isolated from E. coli DH10B and S. aureus RN4220, was transformed into S. aureus RN4220 and other S. aureus strains, respectively, using standard procedures.17 The S. aureus transformants were selected on NYE supplemented with 10 mg/L of chloramphenicol (NYEC).

Construction of plasmids carrying the promoter-lux reporter fusions The nucleotide sequences for agrP3 and lukE were retrieved from the S. aureus NCTC 8325 genome database and oligonucleotide primers were prepared (Integrated DNA Technologies) to amplify selected promoters of interest (Table 2). PCR conditions were as follows: 948C for 5 min (initial denaturation); 35 cycles at 948C for 30 s, 608C for 30 s, 728C for

980

Disc diffusion assay A single colony of S. aureus on NYEC agar was resuspended in 50 mL sterile water and samples were mixed with 7 mL of 0.7% agar and poured as overlays on NYEC agar plates. Paper discs containing antibiotics were placed on the overlay and the plates were incubated at 378C.


Figure 1. Virulence gene regulation. (a) Agr system, transcribed as from agrP2 and agrP3 promoters. Transcription is stimulated by SarA and is also autoactivated by AgrA via quorum-sensing system; (b) Agr RNAIII down-regulates SarS, which results in down-regulation of spa transcription, and Agr RNAIII stimulates expression of lukED. SarS may also activate expression of lukED, which is indicated by the truncated arrow.

JAC

Modulation of virulence gene expression

Table 2. Primers used in this study Primer name

Primer sequences (5′ to 3′ )

Reference

Sequencing 30 this study

Promoter cloning F-spa R-spa F-lukE R-lukE F-agrP3 R-agrP3

CGCGGATCCCCACTTTATTCTTAAAAA CGCGGATCCTGTATGTATTTGTAAAGTC CGCGGATCCCATGTCTGTTCCTGTATGG CGCGGATCCCGGAGATGCTAAAGGTGCAA CGCGGATCCTCTTGTGCCATTGAAATCAC CGCGGATCCGCCTAACTGTAGGAAATAAA

16 16 this study this study this study this study

qRT–PCR L-luxA R-luxA L-agrB R-agrB L-spa R-spa L-pyk R-pyk

AGGTCGCATCTCTGAGGAGT CAATAGCGGCAGTTCCTACA ATGCTCCTGCAGCAACTAAA TTGAATGAATTGGGCAAATG TAAACGAAGCGCAACGTAAC TTATCAGCTTTCGGTGCTTG TGGAGTCACCGCAATAATGT TTCGGTTGCACATACAGCTT

16 16 this study this study this study this study this study this study

The antibiotics used in this study were 10 mg cloxacillin (Sigma), 10 mg bacitracin (BD), 5 mg methicillin (BD), 0.15 mg penicillin G (BD), 0.75 mg nafcillin (Sigma), 0.75 mg oxacillin (Sigma), 0.5 mg imipenem (Sigma), 30 mg vancomycin (BD), 2.5 mg cefoperazone (Sigma), 1.5 mg cefalotin (Sigma) and 30 mg daptomycin (BD). After 20 h, inhibition zones were measured and luminescence responses were detected using a Luminograph LB980 camera (Berthold). Representative results from at least three independent experiments are presented.

Quantification analysis of transcription The effects of sub-MIC antibiotics on transcription modulation were also assessed using quantitative reverse transcriptase PCR (qRT– PCR). S. aureus Newman cells carrying a promoter-lux reporter construct were spread on NYEC and single antibiotic discs placed in the centre of the Petri plates and incubated at 378C for 16 to 18 h. The bacteria immediately outside of the zone of inhibition were carefully removed with a spatula and placed in RNAProtect bacteria reagent solution (Qiagen). For the negative control, cells were taken from the edge of the plate. RNA purification was done using a Qiagen RNeasy mini prep kit. qRT–PCR primers are listed in Table 2. qRT–PCR was carried out in 96-well microtitre PCR plates (Sarstedt) as follows: 30 min at 428C for reverse transcription; denaturation at 948C for 2 min; 40 cycles at 948C for 15 s, 608C for 15 s and 608C for 15 s; to obtain dissociation curves the samples were held at 948C for 1 min, 608C for 30 s and 948C for 30 s. The housekeeping gene encoding pyruvate kinase (pyk) was used for normalization. Expression of luxA was used as a positive control to confirm that light production corresponded to promoter activation, and agrB was used as a negative control. Each experiment was done in duplicate with a minimum of four samples for each target gene. The relative standard curve method was used to quantify transcription.

Biofilm assay The procedure was carried out as previously described.18 Overnight cultures of S. aureus were adjusted to OD600 3.0 and diluted 200-fold into

Results and discussion b-lactam antibiotics are the drugs of choice for treating staphylococcal infections, either alone or in combination with other antimicrobial agents. We investigated the ability of cell wall active compounds to modulate the transcription of spa, lukE and agr RNAIII in S. aureus. A selection of strains carrying promoter-lux reporter constructs was employed to monitor changes in transcription and qRT–PCR was used to confirm the results.

Antibiotics differentially modulate the transcription of S. aureus genes It has been shown previously that sub-MIC antibiotics enhance virulence in staphylococcal infections.6 We found that expression of spa and lukE was strongly stimulated by sub-MICs of penicillin and cefalotin in S. aureus Newman, suggesting that such compounds may enhance bacterial pathogenesis (Figure 2a). Induction levels varied between closely related antibiotics of the same class (cloxacillin and oxacillin; cefalotin and cefoperazone) (Figure 2a). Cloxacillin and oxacillin differ only in a chlorine substitution on the aromatic ring, while cefalotin and cefoperazone are group I and II cephalosporins, respectively. The variations in stimulatory effects within these b-lactams suggest that the transcriptional differences we observed may reflect subtle alterations in the interaction of the inhibitors with their cellular targets, such as altering binding efficiency. qRT– PCR was used to confirm that modulation of gene expression in S. aureus Newman took place at the transcription level in cultures exposed to sub-MICs of active antibiotics. Expression of spa was examined when cells were exposed to sub-MICs of nafcillin, cefalotin or vancomycin (see Table S1 available as Supplementary data at JAC Online). It was found that nafcillin and cefalotin stimulated spa expression 2- and 3-fold, respectively; however, vancomycin had no effect, a result consistent with diffusion assays. On the other hand, qRT –PCR analyses (as expected) showed no increase in expression of agrB by antibiotics and disc diffusion assays showed that agr RNAIII expression was only weakly affected by sub-MIC antibiotics (Figure 2a).

Antibiotic interactions We investigated the effects of combinations of gentamicin plus penicillin G as well as gentamicin plus ciprofloxacin, alone and in combination (Figure 2b) on transcription of the virulence genes. Antagonistic interactions were observed in the cases of

981


TTGGGGAGGTTGGTATGTAAGC GGAGGGTGGCGGGCAGGACG

fresh Tryptic Soy Broth (BD) medium supplemented with 0.25% glucose. Antibiotic solution (10 mL) or sterile water (10 mL) was added into wells of a 96-well round-bottom polystyrene plate (Sarstedt) and diluted culture (190 mL) was dispensed into each well and incubated for 24 h at 378C. Planktonic cells were decanted and the biofilm remaining in each well was washed three times with 300 mL of water and stained with 200 mL of 0.1% safranin for 30 s (Fisher Scientific). The safranin was washed out and the plates were allowed to dry at room temperature for several hours. The density of the biofilm in each well was determined by dissolving the stain in 300 mL of 100% ethanol for 30 min and the absorbance was measured at 490 nm using a SpectraMax 190 microplate spectrophotometer (Molecular Devices).

Subrt et al.

(a)

(c)

(d)


(b)

Figure 2. (a) Transcription modulation of virulence genes by sub-MIC cell wall active antibiotics in S. aureus Newman. (b) Antibiotic interactions between gentamicin (GEN) and penicillin (PEN) or ciprofloxacin (CIP) using S. aureus Newman constructs. The level of induction of PEN and CIP is decreased in the presence of GEN and arrows indicate antagonism observed between the two antibiotics. (c) Antibiotic interactions among rifampicin, novobiocin and ciprofloxacin using promoter-lux reporter constructs in S. aureus RN4220. Filled arrows point to synergy and unfilled arrows point to antagonism. (d) Transcription modulation of virulence genes by sub-MIC cell wall active antibiotics in S. aureus ALC 488 (SarA2) and ALC 1927 (SarS2). CLO, cloxacillin; BAC, bacitracin; MET, methicillin; PEN, penicillin G; NAF, nafcillin; OXA, oxacillin; IPM, imipenem; VAN, vancomycin; CFP, cefoperazone; CEF, cefalothin.

spa, lukE, and agr RNAIII between gentamicin and penicillin G or ciprofloxacin in S. aureus Newman (Figure 2b). Decreased induction of virulence genes by penicillin G in the presence of gentamicin was observed (Figure 2b). Combinations of antibiotics are frequently used to treat severe staphylococcal infections.19 However, because of differences in antibiotic diffusion rates and distribution, not all bacteria are exposed to the required lethal concentrations of bactericidal agents and therefore are likely subjected to sub-MIC antibiotic effects.3,6 We employed promoter-lux reporter constructs to analyse antibiotic interactions that might occur under treatment

982

conditions. Three representative S. aureus promoter-lux reporter constructs20 were studied for their responses to antibiotic combinations. Discs containing antibiotics were placed at specific distances to ensure the inhibition zones were not overlapping, and synergies and antagonisms of antibiotics in the transcription level (light production) were observed. We tested 26 different antibiotic combinations (see Table S2 available as Supplementary data at JAC Online). Representative results of antibiotic interactions are shown in Figure 2c. These findings illustrate an advantage of using lux reporters for studying antibiotic interactions at the transcription level.

JAC

Modulation of virulence gene expression

Fold change (treatment/no treatment)

7

Methicillin

Nafcillin

Cefalotin

Cefoperazone

6 5 4 3 2 1 0

1/3 MIC

1/4 MIC

1/8 MIC

Newman

1/3 MIC

1/4 MIC

Newman spa::kan

1/8 MIC

1/3 MIC

1/4 MIC

1/8 MIC

III33

Effects of cell wall active antibiotics on virulence gene expression in S. aureus SarA and SarS mutants SarA controls transcription of a variety of functions by either modulating expression of agr 21 by binding to the intergenic region between agrP2 and agrP3 promoter or by binding directly to the promoter regions of sar-dependent genes22 (Figure 1). RNAIII down-regulates expression of SarS, a DNA-binding protein that stimulates expression of spa.11 Furthermore, plasmids carrying spa-lux, lukE-lux and agrP3-lux were transformed into S. aureus RN6390 mutants deficient in SarA (ALC488) or SarS (ALC1927) regulators and antibiotic-induced transcription responses examined. Subsequent analysis showed that expression of spa and lukE was strongly stimulated by certain b-lactam antibiotics in S. aureus ALC488, but were unaffected in ALC1927 (Figure 2d). The greater sensitivity of the lux assays could explain the discrepancy with the earlier results of Doss et al.,23 who found that methicillin did not affect protein A production. The expression of agr RNAIII was stimulated by sub-MIC b-lactam antibiotics in both S. aureus ALC488 and ALC1927 (Figure 2d); however, the light response profiles in ALC488 differed from those in S. aureus ALC1927. The different genetic backgrounds of S. aureus (pathogenic strain Newman and laboratory strain RN6390) and the virulence regulators (SarA and SarS) clearly influence the expression of the spa, lukE and agr RNAIII genes in the presence of sub-MIC b-lactam antibiotics (Figure 2a and d). The reasons for these differences are not apparent.

Acknowledgements We thank C. von Eiff, T. J. Foster and A. L. Cheung for the generous gifts of S. aureus strains.

Funding This work was supported by CIHR (Canadian Institutes of Health Research).

Transparency declarations None to declare.

Effects of b-lactam antibiotics on biofilm formation

Supplementary data

S. aureus is one of the leading causes of implant-associated infections in hospitals. Numerous exogenous and endogenous factors, including the charge and hydrophobicity of the target matrix, adhesins, host proteins, and production of a-toxin facilitate biofilm formation by the pathogen.24 We tested several b-lactam antibiotics (methicillin, nafcillin, cefalotin and cefoperazone) on S. aureus Newman and its spa and hemB mutants for their effects on biofilm formation. S. aureus Newman and its hemB mutant formed up to 4- and 3-fold denser biofilms, respectively, at 1/3 MIC and 1/4 MIC of cefalotin, while the

Tables S1 and S2 are available as Supplementary data at JAC Online (http:// jac.oxfordjournals.org/).

References 1 Saginur R, St Denis M, Ferris W et al. Multiple combination bactericidal testing of staphylococcal biofilms from implant-associated infections. Antimicrob Agents Chemother 2006; 50: 55–61. 2 Lowy FD. Staphylococcus aureus infections. N Engl J Med 1998; 339: 520–32.

983


Figure 3. Biofilm formation by S. aureus Newman. The bar graph is an average of at least three independent experiments, each done in triplicate. Error bars represent standard deviation.

S. aureus spa knockout mutant formed up to 3-fold denser biofilms at 1/4 MIC of cefalotin (P,0.05). Other antibiotics (methicillin, nafcillin and cefoperazone) had no effect on biofilm formation in the S. aureus strains listed (Figure 3). Biofilm formation is one phenotypic measure of virulence expression. Biofilm assay results were different from those of the disc diffusion assays with respect to the effect of sub-MIC cell wall active antibiotics. However, both methods portray strong modulatory effects of sub-MIC cefalotin, which induced virulence genes (spa, lukE and agr RNAIII) in S. aureus Newman (Figure 2a) and induced biofilm formation in the wild-type, spa mutant and hemB mutant (Figure 3). These results are in agreement with earlier findings by Haddadin et al.,25 showing that cefalexin, a first-generation cephalosporin similar to cefalotin, stimulates denser biofilm formation over a wide range of antibiotic concentrations. The hemB mutant is a small colony variant known to be resistant to aminoglycosides and b-lactam antibiotics and to produce decreased amounts of exotoxins.14 The demonstrated stimulation of S. aureus virulence gene expression by sub-MICs of antibiotics could influence the course of disease and compromise antimicrobial therapy. Promoter-lux reporters provide simple and practical tools to study the activities of sub-MICs of antibiotics and their combinations on the expression of different virulence genes. These tools are now available for both Gram-positive and Gramnegative organisms;16 their use provides novel insights into antibiotic modes of action and they can be employed to reveal favourable therapeutic combinations for the treatment of bacterial infections.

Subrt et al.

3 Cars O. Pharmacokinetics of antibiotics in tissues and tissue fluids: a review. Scand J Infect Dis Suppl 1990; 74: 23–33.

17 Schenk S, Laddaga RA. Improved method for electroporation of Staphylococcus aureus. FEMS Microbiol Lett 1992; 73: 133–8.

4 Davies J, Spiegelman GB, Yim G. The world of subinhibitory antibiotic concentrations. Curr Opin Microbiol 2006; 9: 445–53.

18 Yasuda H, Koga T, Fukuoka T. In vitro and in vivo models of bacterial biofilms. Methods Enzymol 1999; 310: 577–95.

5 Yim G, de la Cruz F, Spiegelman GB et al. Transcription modulation of Salmonella enterica serovar Typhimurium promoters by sub-MIC levels of rifampin. J Bacteriol 2006; 188: 7988– 91.

19 Nguyen HM, Graber CJ. Limitations of antibiotic options for invasive infections caused by methicillin-resistant Staphylococcus aureus: is combination therapy the answer? J Antimicrob Chemother 2010; 65: 24–36.

6 Dancer SJ. The effect of antibiotics on methicillin-resistant Staphylococcus aureus. J Antimicrob Chemother 2008; 61: 246– 53.

20 Mesak LR, Qi S, Villanueva I et al. Staphylococcus aureus promoter-lux reporters for drug discovery. J Antibiotics 2010; 63: 492–8.

7 Novick RP, Ross HF, Projan SJ et al. Synthesis of staphylococcal virulence factors is controlled by a regulatory RNA molecule. EMBO J 1993; 12: 3967– 75.

21 Cheung AL, Koomey JM, Butler CA et al. Regulation of exoprotein expression in Staphylococcus aureus by a locus (sar) distinct from agr. Proc Natl Acad Sci USA 1992; 89: 6462 –6.

8 Foster TJ, Hook M. Surface protein adhesins of Staphylococcus aureus. Trends Microbiol 1998; 6: 484–8.

22 Chien Y, Manna AC, Projan SJ et al. SarA, a global regulator of virulence determinants in Staphylococcus aureus, binds to a conserved motif essential for sar-dependent gene regulation. J Biol Chem 1999; 274: 37169–76.

10 Hartleib J, Kohler N, Dickinson RB et al. Protein A is the von Willebrand factor binding protein on Staphylococcus aureus. Blood 2000; 96: 2149– 56. 11 Tegmark K, Karlsson A, Arvidson S. Identification and characterization of SarH1, a new global regulator of virulence gene expression in Staphylococcus aureus. Mol Microbiol 2000; 37: 398– 409. 12 Prevost G, Cribier B, Couppie P et al. Panton-Valentine leucocidin and gamma-hemolysin from Staphylococcus aureus ATCC 49775 are encoded by distinct genetic loci and have different biological activities. Infect Immun 1995; 63: 4121– 9.

23 Doss SA, Tillotson TS, Amyes SGB. Effect of sub-inhibitory concentrations of antibiotics on the virulence of Staphylococcus aureus. J Appl Microbiol 1993; 75: 123–8. 24 Cramton SE, Gerke C, Schnell NF et al. The intercellular adhesion (ica) locus is present in Staphylococcus aureus and is required for biofilm formation. Infect Immun 1999; 67: 5427– 33. 25 Haddadin RN, Saleh S, Al-Adham IS et al. The effect of subminimal inhibitory concentrations of antibiotics on virulence factors expressed by Staphylococcus aureus biofilms. J Appl Microbiol 2010; 108: 1281 –91. 26 Novick RP. The Staphylococcus as a Molecular Genetics System. New York: VCH Publishers, 1990.

13 Staali L, Monteil H, Colin DA. The staphylococcal pore-forming leukotoxins open Ca2+ channels in the membrane of human polymorphonuclear neutrophils. J Membr Biol 1998; 162: 209– 16.

27 Peng HL, Novick RP, Kreiswirth B et al. Cloning, characterization, and sequencing of an accessory gene regulator (agr) in Staphylococcus aureus. J Bacteriol 1988; 170: 4365– 72.

14 Proctor RA, von Eiff C, Kahl BC et al. Small colony variants: a pathogenic form of bacteria that facilitates persistent and recurrent infections. Nat Rev Microbiol 2006; 4: 295– 305.

28 Duthie ES, Lorenz LL. Staphylococcal coagulase; mode of action and antigenicity. J Gen Microbiol 1952; 6: 95– 107.

15 von Eiff C, Peters G, Becker K. The small colony variant (SCV) concept—the role of staphylococcal SCVs in persistent infections. Injury 2006; 37 Suppl 2: S26– 33. 16 Mesak LR, Yim G, Davies J. Improved lux reporters for use in Staphylococcus aureus. Plasmid 2009; 61: 182–7.

984

29 Jonsson IM, von Eiff C, Proctor RA et al. Virulence of a hemB mutant displaying the phenotype of a Staphylococcus aureus small colony variant in a murine model of septic arthritis. Microb Pathog 2003; 34: 73– 9. 30 Mesak LR, Miao V, Davies J. Effects of subinhibitory concentrations of antibiotics on SOS and DNA repair gene expression in Staphylococcus aureus. Antimicrob Agents Chemother 2008; 52: 3394 –7.


9 Jansson B, Uhlen M, Nygren PA. All individual domains of staphylococcal protein A show Fab binding. FEMS Immunol Med Microbiol 1998; 20: 69–78.