Molecular characterization of Saccharomyces ... - Wiley Online Library

1 downloads 18 Views 201KB Size Report
Sco2p reveals a high degree of redundancy with Sco1p. Anja Lode, Claudia Paret and Gerhard Rödel*. Institut für Genetik, Technische Universität Dresden, ...

Yeast Yeast 2002; 19: 909–922. Published online in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/yea.883

Research Article

Molecular characterization of Saccharomyces cerevisiae Sco2p reveals a high degree of redundancy with Sco1p ¨ Anja Lode, Claudia Paret and Gerhard Rodel* Institut f¨ur Genetik, Technische Universit¨at Dresden, Mommsenstrasse 13, 01062 Dresden, Germany

*Correspondence to: Gerhard R¨odel, Institut f¨ur Genetik, Technische Universit¨at Dresden, Mommsenstrasse 13, 01062 Dresden, Germany. E-mail: Gerhard. [email protected]

Received: 24 January 2002 Accepted: 14 April 2002

Abstract The Saccharomyces cerevisiae gene SCO1 has been shown to play an essential role in the transfer of copper to the CuA -centre of the mitochondrial cytochrome c oxidase subunit Cox2p. By contrast, the function of Sco2p, the gene product of the highly homologous SCO2 gene, remains to be elucidated. Deletion of the SCO2 gene does not affect growth on a variety of carbon sources, including glycerol, lactate and ethanol. We report here, that Sco2p is anchored in the mitochondrial membrane by a single transmembrane segment and displays a similar tripartite structure as Sco1p. Most parts of Sco1p can be replaced by the homologous parts of Sco2p without loss of function. A short stretch of 13 amino acids, immediately adjacent to the transmembrane region, is crucial for Sco1p function and cannot be replaced by its Sco2p counterpart. We propose that this region is relevant for the correct spatial orientation of the C-terminal part of the protein. Immunoprecipitation and in vitro binding assays show that Sco2p interacts with the C-terminal portion of Cox2p. This interaction is neither dependent on bound copper ions nor on the presence of Sco1p. Furthermore we report on in vitro binding assays which show that Sco2p can form homomeric complexes, but also heteromeric complexes with Sco1p. Our data suggest that Sco2p is involved in the transfer of copper to Cox2p, but that this activity is insufficient for oxidative growth and not able to substitute for Sco1p activity. Copyright  2002 John Wiley & Sons, Ltd. Keywords: visiae

mitochondria; copper metabolism; Sco1p; Sco2p; Saccharomyces cere-

Introduction Cytochrome c oxidase (COX), the terminal enzyme of the respiratory chain, is a multi-subunit complex localized in the inner membrane of mitochondria and in the plasma membrane of aerobic bacteria. In eukaryotes the three largest subunits (Cox1p, Cox2p, Cox3p), which are encoded by mitochondrial (mt) genes, constitute the catalytic core of the complex. Two subunits carry prosthetic groups: Cox1p the CuB -centre and two heme groups (heme a and a3 ) and Cox2p the binuclear CuA -centre. The residual subunits are encoded by nuclear genes and have to be imported into mitochondria after their synthesis on cytosolic ribosomes (Ostermeier et al., 1996). Analysis of respiratory deficient Saccharomyces cerevisiae mutants revealed that Copyright  2002 John Wiley & Sons, Ltd.

the process of COX assembly requires additional nuclear gene products which are not structural subunits of the functional complex (McEwen et al., 1986; Tzagoloff and Dieckmann, 1990). One of these assembly factors, Sco1p, is thought to be involved in the attachment of copper into COX. Yeast cells lacking Sco1p are COX-deficient and characterized by a rapid proteolytic degradation of newly synthesized subunits Cox1p and Cox2p (Krummeck and R¨odel, 1990). Immunological examination of the sco1 null mutant showed that residual levels of Cox2p are present, while Cox1p is not detectable (Paret et al., 2000). Sco1p is a 30 kDa protein of the inner mt membrane, anchored by a single transmembrane (TM) segment in its N-terminal third (Schulze and

910

R¨odel, 1989; Buchwald et al., 1991). The major C-terminal portion of Sco1p including a CXXXCmotif, which resembles the copper binding site of Cox2p, and H239 protrudes into the mt intermembrane space (Krummeck, 1992; Beers et al., 1997). Both cysteine residues of the CXXXC-motif, C148 and C152 , as well as H239 have been shown to be essential for Sco1p function (Rentzsch et al., 1999; Lode et al., 2000). The first hint at a role of Sco1p in mt copper metabolism came from the observation that the respiratory deficiency of yeast cells lacking the mt copper carrier Cox17p can be suppressed by overexpression of Sco1p (Glerum et al., 1996). Sco1p possesses characteristic features of a copper chaperon: recent data show that one Sco1p molecule binds one Cu1+ ion via the essential amino acids C148 , C152 and H239 (Nittis et al., 2001). Moreover, a physical interaction between Sco1p and Cox2p, one of the copper recipients in the COX complex, was observed (Lode et al., 2000). Sco1p is evolutionary conserved: members of the Sco-protein family were found in a number of organisms from bacteria to man. Especially their major C-terminal portions including the CXXXC-motif and H239 show a high degree of identity. Interestingly, some organisms possess only a single Sco-homologue, while in others two Sco-homologues are present. The reason for this difference is unclear. In the human genome two genes have been identified, hSCO1 located on chromosome 17p12-13 and hSCO2 on chromosome 22q13. Both encode mt proteins (Petruzzella et al., 1998; Paret et al., 1999), which are essential for mt function as shown by the recent detection of mutations associated with fatal COX deficiencies. Mutations in hSCO2 were reported in infants who suffered from a fatal disorder with hypertrophic cardiomyopathy as the predominant symptom (Papadopoulou et al., 1999; Jaksch et al., 2000, 2001a) whereas the key symptoms of the infant patients carrying mutations in the hSCO1 gene were hepatic failure and ketoacidotic coma (Valnot et al., 2000). In the yeast S. cerevisiae, also two SCO-homologues are present: SCO2 with an identity to SCO1 of about 50% was detected in the course of the yeast genome sequencing project (Smits et al., 1994). Sco2p shares a number of common features with Sco1p: it is a mt membrane protein of about 30 kDa. Its N-terminal sequence of about 4 kDa, Copyright  2002 John Wiley & Sons, Ltd.

A. Lode et al.

reminiscent of mt targeting sequences, is probably cleaved off during import by processing of the precursor protein (Glerum et al., 1996). Anchoring in the membrane is likely to be mediated by a single hydrophobic stretch, which is predicted as a TM segment. The position of this potential membrane anchor and the distribution of charged flanking amino acids (aa) are almost identical to Sco1p, suggesting a similar topology of both Sco proteins. Contrary to the human counterparts which are both essential for mt function, the role of Sco2p in yeast is enigmatic: like in the case of Sco1p, overexpression of Sco2p can suppress the lack of the mt copper shuttle protein Cox17p, albeit only in the presence of elevated copper concentrations (Glerum et al., 1996). This observation suggests that Sco2p, too, might be involved in mt copper metabolism. Interestingly, however, the disruption of SCO2 does not result in a respiratory deficient phenotype (Glerum et al., 1996). Overexpression of SCO2 is not capable to suppress the respiratory deficiency of sco1 null mutants (Glerum et al., 1996). However, as we have demonstrated previously, the C-terminal half of Sco1p can be replaced by the corresponding part of Sco2p, suggesting a partially overlapping function of Sco1p and Sco2p in yeast (Rentzsch et al., 1999). The present study aimed at gaining a more detailed insight into the role of Sco2p in yeast. We show that Sco2p is anchored by a single hydrophobic stretch of 17 aa in the mt membrane. Systematic analysis of a number of chimeric proteins shows that this TM segment can replace the homologous part of Sco1p without loss of function and that the complete N-terminal portion (aa 1–75) and almost the whole C-terminal portion (aa 106–295) of Sco1p can be substituted by the respective Sco2p parts. However, a short segment of 13 aa, immediately adjacent to the TM region and differing in only three positions from the Sco2p counterpart, is critical for Sco1p function and cannot be replaced by the homologous aa stretch of Sco2p. Finally, we analysed protein interactions of Sco2p. We show, that Sco2p can form homomeric complexes as well as heteromeric complexes with Sco1p. In addition we were able to show that — as described recently for Sco1p — Sco2p interacts with the C-terminal portion of Cox2p. Yeast 2002; 19: 909–922.

Saccharomyces cerevisiae Sco2p

911

Materials and methods

Cloning of SCO2

Strains and media

The SCO2 gene with the authentic promoter was amplified by PCR with primers #3 and #4 from genomic DNA of strain DBY747 and cloned into the multicopy vector YEp351 (Hill et al., 1986) and the single copy vector pRS415 (Sikorski and Hieter, 1989).

E. coli strains used in this work were DH5α (BRL) and BL21 (Studier and Moffatt, 1986). E. coli media were as described by Sambrook et al. (1989). S. cerevisiae strains GR20 (MATα, his3-1, his3-15, leu2-3, leu2-112, ura3-228, ura3251, ura3-379, sco1 ::URA3) (Schulze and R¨odel, 1988), MK20 (MATα, ura1, met, sco1-1 ) (Schulze and R¨odel, 1988), AR1 (MATa, his3-1, leu2-3, leu2-112, trp1-289, ura3-52, sco2 ::HIS3 ) (this work), AR2 (MAT α, his3-1, his3-15, leu2-3, leu2112, ura3-228, ura3-251, ura3-379, sco1 ::URA3, sco2 ::Sphis5+ ) (Lode et al., 2000), DBY747 (MATa, his3-1, leu2-3, leu2-112, trp1-289, ura352) (ATCC 44774), W303 (MATa, ade2-1, his3-1, his3-15, leu2-3, leu2-112, trp1-1, ura3-1 ) (Muroff and Tzagoloff, 1990), and CEN.PK2 (MATa/α, his3-1, leu2-3, leu2-112, trp1-289, ura3-52 ) (kindly provided by R.J. Schweyen, Vienna) were used. Yeast media were as described by Kaiser et al. (1994). Non-fermentable growth was tested on glycerol medium (YPGly). For culturing yeast cells in the presence of elevated copper concentration, CuSO4 was added at a concentration of 0.01% to liquid culture medium and 0.2% to YPGly plates. Reduction of the copper concentration in liquid culture medium was achieved by incubation of the respective medium with Chelex 100 resin (BioRad) and subsequent addition of the other trace elements as given by Johnston (1994).

Construction of a triple HA-tagged version of Sco2p In order to express under control of the SCO2 promoter a Sco2p version, which is C-terminally fused to three copies of the HA epitope (3HA), PCR with primers #3 and #5 was performed and the product was ligated into the XbaI–PstI sites of the vector YEp351-3HA (kind gift of R.J. Schweyen, Vienna). The resulting plasmid, SCO2–3HA–YEp351, was cut with SacI–HindIII and the 1.2 kb fragment containing the SCO2–3HA fusion was cloned into pRS415 to yield plasmid SCO2–3HA–pRS415.

Construction of a HA-tagged version of Sco2p(82–98) Overlap extension PCR (OEP) (Pogulis et al., 1996) using overlapping primers #6 and #7 and flanking primers #3 and #5 was performed to delete aa 82–98 of Sco2p. The resulting fragment was cut with XbaI–PstI and cloned into the XbaI–PstIdigested plasmid SCO2–3HA–pRS415 yielding plasmid SCO2(82–98)–3HA–pRS415, in which SCO2 is replaced by sco2(82–98).

Construction of the S. cerevisiae sco2 null mutant strain AR1 Genomic DNA of S. cerevisiae strain MK20 was used as template for amplification of the HIS3 gene with primers #1 and #2 (oligonucleotides are summarized in Table 1) by short-flanking homology (SFH)–PCR (Wach et al., 1997). The resulting deletion cassette, consisting of the HIS3 gene flanked by 40 bp long DNA sequences identical to the 5 - and 3 -flanking regions of SCO2, was used to replace SCO2 in the genome of strain DBY747 by a one-step gene disruption (Rothstein, 1983). The replacement was verified by Southern blot hybridization (data not shown). Copyright  2002 John Wiley & Sons, Ltd.

Construction of Sco1p/Sco2p chimeric proteins Chimeras under control of the SCO1 promoter were created by OEP. The final PCR products were cloned into SacI–HindIII-digested YEp351 or into the SalI–HindIII sites of YEp351(1P), which contains the SCO1 promoter (Rentzsch et al., 1999). Templates, overlapping and flanking primers, as well as the vector used for construction of each chimera, are listed in Table 2. For expression of the chimeras from a single copy vector the resulting plasmids were cut with SacI–HindIII and the fragments were cloned into pRS415. Yeast 2002; 19: 909–922.

912

A. Lode et al.

Table 1. Oligonucleotides. Recognition sequences of the respective restriction endonucleases are underlined. SFH-regions and overhangs of OEP-primers are given in bold No.

Sequence (5 → 3 )

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37

CGCCCCAAGTTATAGAAGACTGCCCTTCATCCCGGGGTAGCGCTAGGAGTCACTGCCAGG ACGAAAGGAAAAAAGCAATCTCGAGTGGATGGCATCGGAGCGCGCCTCGTTCAGAATG GTAGCTATTCTAGAATCTGTCG CCCATAAGCTTGGTATCCTAGC TATATACTGCAGGATTGAAGATAAAAGAGTA TCTTTTTCTCTTCCATCTGGAAAATTG AGATGGAAGAGAAAAAGACGCTTGCTA TATATAGTCGACGAGTAAAATGTTGAATAGTTCAAGA CTTCCAAGCTTCACATAGCCTC GTCCTCGAGCTCCCAATTGAAACTAAATTG AGCAATGGCCTTCCATCTGGAAAATTG AGATGGAAGGCCATTGCTCTATTCCTA AATGGTGGCCTTTCCCGTGGAAAACTC ACGGGAAAGGCCACCATTGCTCTATTG TTTCTCCCTTGATAAATAGGCATACGT TATTTATCAAGGGAGAAACGCAGATTG ATTGAAAGGTCCCCCAAGTGAAGGTTTACC CTTGGGGGACCTTTCAATTTAACAGATTTT TCTGTTAGCTTCAGCCTCCTTCTGTGTTTC GAGGCTGAAGCTAACAGAGCTTACGGTTCA CAAGCGTCTTTTCTCCCTGTTGAAGAAATA AGGGAGAAAAGACGCTTGCTAGAAACTGAA TTCAGCCTCCTTCTCTGTTTCCAATCT AGATTGGAAACAGAGAAGGAGGCTGAA CTGTGTTTCCAACAATCTGCGTTTCTC CGCAGATTGTTGGAAACACAGAAGGAG TCCTCTGTTTGCGTCAGCCTCCTTCTG CAGAAGGAGGCTGACGCAAACAGAGGA ATCTGCTTCCTTTTGAGTTTCTAGCAA TTGCTAGAAACTCAAAAGGAAGCAGAT TTCAGTTTCCAAGCGTCTTTTCTC AGACGCTTGGAAACTGAAAAGGAA AGCTCTGTTAGCTTCTGCTTCCTTTTC GAAAAGGAAGCAGAAGCTAACAGAGCT TATATAGTCGACATGGCCATTGCTCTATTCCTA TATATAGGATCCAGAAAAAGACGCTTGCTAGAA TATATAGTCGACTCAATTGAAGATAAAAGAGTA

Site-directed mutagenesis of the region flanking the TM segment C-terminally in Sco1p and ch 5, respectively Point mutations in SCO1 and ch 5 were introduced by OEP. Templates, overlapping and flanking primers are summarized in Table 2. The final PCR products were ligated into SacI–HindIII sites of YEp351.

Construction of Sco1p(2–75) For generation of a Sco1p derivative lacking aa 2–75, PCR with primers #35 and #9 was performed. The PCR product was cut with SalI–HindIII and cloned into YEp351(1P) yielding plasmid SCO1(2–75)–YEp351. For single copy Copyright  2002 John Wiley & Sons, Ltd.

Direction For Rev For Rev Rev Rev For For Rev For Rev For Rev For Rev For Rev For Rev For Rev For Rev For Rev For Rev For Rev For Rev For Rev For For For Rev

Restriction site

XbaI HindIII PstI

SalI HindIII SacI

SalI BamHI SalI

expression SCO1(2–75)–YEp351 was cut with SacI–HindIII and the 1.2 kb fragment containing the SCO1 promoter and the coding region for Sco1p(2–75) was ligated into pRS415 to yield plasmid SCO1(2–75)–pRS415.

Isolation of mitochondria Wild-type and mutant yeast cells were grown to early stationary phase in the respective media and mitochondria were prepared as described (Nijtmans et al., 2000).

Alkaline extraction of mitochondrial proteins (Fujiki et al., 1982) 300 µg mitochondria were resuspended in 500 µl 0.1 M Na2 CO3 (pH 11.5) and incubated for 60 min Yeast 2002; 19: 909–922.

Saccharomyces cerevisiae Sco2p

913

Table 2. Sco1p/Sco2p chimeras and site-directed mutagenesis of Sco1p and chimera ch 5: templates, overlapping and flanking primers and vectors used for construction Chimera/ mutant allele

Templates

ch 1 ch 2

SCO1–YEp351 + SCO2–YEp351 SCO1–YEp351 + SCO2–YEp351

ch 3 ch 4 ch 5 SCO1(Q101E) SCO1(99 + L) SCO1(E105D) ch 5(E102Q) ch 5(99-L) ch 5(D106E)

SCO1–YEp351 + SCO2–YEp351 SCO1–YEp351 + SCO2–YEp351 SCO1–YEp351 + SCO2–YEp351 SCO1–YEp351 SCO1–YEp351 SCO1–YEp351 ch 5–YEp351 ch 5–YEp351 ch 5–YEp351

on ice. Soluble and membrane fractions were separated by ultracentrifugation (rotor MLS-50, Optima Max, Beckman Coulter) at 45 000 rpm and 4 ◦ C for 1 h. The pellet was resuspended in SDS-sample buffer, the proteins in the supernatant were precipitated by addition of TCA to a final concentration of 10% and also resuspended in SDS-sample buffer. Both fractions were run on a 12% SDS–polyacrylamide gel for Western blot analysis.

Co-immunoprecipitation 500 µg isolated mitochondria from strain AR1 transformed with plasmid SCO2–3HA–pRS415 or from wild-type W303 were lysed as described by Lode et al. (2000). After centrifugation at 20 000 × g and 4 ◦ C for 15 min the supernatant was added to 50 µl of a mix of protein A- and protein Gagarose (Santa Cruz Biotechnology), which was preincubated with 10 µg Cox2p antibody (Molecular Probes). Incubation was carried out with gentle rotation at 4 ◦ C for 7 h followed by two washing steps as described previously (Lode et al., 2000). Bound proteins were eluted and separated on a 12% SDS–polyacrylamide gel.

Overlapping primers

Flanking primers

Vector

#11 + #12 #13 + #14+ #15 + #16 #17 + #18 #19 + #20 #21 + #22 #23 + #24 #25 + #26 #27 + #28 #29 + #30 #31 + #32 #33 + #34

#8 + #9 #10 + #9

YEp351(1P) YEp351

#10 + #4 #10 + #4 #10 + #4 #10 + #9 #10 + #9 #10 + #9 #10 + #4 #10 + #4 #10 + #4

YEp351 YEp351 YEp351 YEp351 YEp351 YEp351 YEp351 YEp351 YEp351

(aa 108–251) was constructed, expressed in E. coli strain BL21 and purified as described (Lode et al., 2000). For expression of the C-terminal portion of Sco2p N-terminally fused to GST the coding region for aa 99–301 was amplified by PCR using primers #36 and #37 and cloned into the BamHI–SalI sites of the GST expression vector pGEX-4T-3 (Amersham Pharmacia Biotech). The resulting plasmid SCO2(C)–pGEX was transformed into E. coli strain BL21 and protein expression was induced by addition of 0.1 mM IPTG for 2 h. Purification of GST–Sco2p(C) was done as described for GST–Cox2p(C) (Lode et al., 2000).

In vitro binding assay Mitochondria from S. cerevisiae strains containing the respective test protein were lysed and incubated with the GST-fusion protein bound to glutathione (GSH)-sepharose beads as described previously (Lode et al., 2000). After washing the bound proteins were eluted and separated on a 12% SDS-polyacrylamide gel for Western blot analysis.

Cloning, expression and purification of GST-fusion proteins

Western blot analysis

The C-terminal portion of Sco1p (aa 93–295) was N-terminally fused to the reading frame of glutathione S-transferase (GST), expressed in yeast strain CEN.PK2 and purified as described previously (Lode et al., 2000). The fusion protein consisting of GST and the C-terminal portion of Cox2p

Protein electrophoresis in the presence of SDS was carried out according to Laemmli (1970). Proteins were transferred onto a PVDF membrane (Millipore) and probed with antibodies directed against the HA epitope (Boehringer Mannheim), Cox1p (Molecular Probes), Cox2p (Molecular Probes),

Copyright  2002 John Wiley & Sons, Ltd.

Yeast 2002; 19: 909–922.

914

A. Lode et al.

porin (Molecular Probes) or aconitase (kindly provided by R. Lill, Marburg). Detection of bound antibodies was performed with horseradish peroxidase (HRP)-conjugated secondary antibodies and the ECL-Plus Kit (Amersham Pharmacia Biotech).

Miscellaneous procedures Standard DNA techniques were as described (Sambrook et al., 1989). Yeast cells were transformed by the lithium acetate method (Schiestl and Gietz, 1989). GENOMED columns were used for isolation of DNA fragments from agarose gels. The correct sequence of all constructs was confirmed by DNA sequencing with the dideoxy-chain termination method (Sanger et al., 1977) using 5 IRD800 labelled primers (MWG-BIOTECH). A Thermo Sequenase fluorescent labelled primer cycle sequencing kit with 7-deaza-dGTP (Amersham Pharmacia Biotech) was employed for sequencing with the LI-COR DNA sequencer 4000 (MWG-BIOTECH). Protein concentrations were determined by the Lowry method (BioRad).

Results Effect of SCO2 gene deletion on respiratory growth and COX assembly Deletion of the SCO2 reading frame in the genome of strain DBY747 was performed as described in Materials and methods. The resulting strain, AR1, grows on YPGly medium like a wild-type strain. This result confirms the previous report of Glerum et al. (1996) that disruption of the SCO2 gene has no effect on respiratory growth. We addressed the question whether deletion of SCO2 with or without concomitant deletion of SCO1 has any effect on the steady-state concentrations of Cox1p and Cox2p. Mt fractions were isolated from wild-type DBY747, the sco2 mutant AR1, the sco1 mutant GR20 and the double mutant AR2, and analysed in a Western blot with antibodies directed against Cox1p, Cox2p and, as a control, the outer membrane protein porin (Figure 1). Deletion of the SCO2 gene in strain AR1 has no effect on the concentration of Cox1p and Cox2p compared to wild-type cells (lanes 1 and 2). As described by Paret et al. (2000) in the sco1 strain GR20 Cox1p is not detectable Copyright  2002 John Wiley & Sons, Ltd.

Figure 1. Effect of Sco proteins on the steady state concentration of Cox1p and Cox2p. Yeast cells were cultured in YPD medium at 30 ◦ C; 30 µg of the isolated mt fractions were separated by SDS–PAGE. For Western blot analysis antibodies directed against Cox1p, Cox2p and, as a control, the outer mt membrane protein porin were used. Lane 1, DBY747 (wild-type); lane 2, AR1 (sco2); lane 3, GR20 (sco1); and lane 4, AR2 (sco1/sco2)

and Cox2p is strongly reduced (lane 3). Interestingly, in the sco1/sco2 double mutant AR2 both Cox1p and Cox2p are not detectable (lane 4). This observation suggests that the residual level of Cox2p in the sco1 strain is dependent on Sco2p. Although Sco2p is dispensable for respiratory growth it seems to be involved in COX assembly or in stabilizing COX subunits.

SCO2 expression under a variety of growth conditions To test whether Sco2p is specifically required under certain growth conditions, we examined the aerobic growth of strain AR1 with either glucose, raffinose, glycerol, lactate or ethanol as a carbon source as well as the anaerobic growth in the presence of glucose. In no case we noticed any difference in growth compared to wild-type DBY747. Similarly the growth characteristics of strain AR1 and wild-type DBY747 were identical in glucose and glycerol media with elevated or reduced copper concentrations. In line with these observations we detected similar steady-state levels of Sco2p (in its triple HA-tagged form, Sco2p-3HA) under all growth conditions (data not shown).

Most of the Sco1p sequence can be replaced by the homologous Sco2p sequence A Sco1p/Sco2p chimeric protein with the Nterminal 155 aa derived from Sco1p and the Yeast 2002; 19: 909–922.

Saccharomyces cerevisiae Sco2p

915

C-terminal 141 aa from Sco2p is able to substitute for Sco1p. By contrast chimera Sco1p(1–78/ Sco2p(85–301) was not functional (Rentzsch et al., 1999), suggesting that a central part of the protein requires Sco1p-specific sequences for function. To identify the aa sequences of Sco1p, which can be replaced by the respective parts of Sco2p without loss of function, we tested a series of novel chimeras (ch 1–5) for functional complementation of the sco1 strain GR20 (Figure 2). On the basis of the tripartite structure of Sco1p, we first constructed ch 1 [Sco2p(1–81)/Sco1p(76–295)] to examine whether the N-terminal portion up to the membrane anchor including the cleavable mitochondrial targeting sequence can be substituted by the respective Sco2p sequence. The N-terminal portion is essential for functioning of Sco1p, because a mutant Sco1p lacking this region [Sco1p(2–75)] fails to complement the sco1 deletion strain GR20 (data not shown). GR20 transformants expressing ch 1 were able to grow on glycerol medium. Growth was only slightly reduced compared to wild-type cells. This result shows that the Nterminal portion of Sco1p can be replaced by its Sco2p counterpart without significantly affecting the function of the protein. Next we tested whether the TM region of Sco1p can be substituted by the respective Sco2p

counterpart. Membrane anchoring by the TM region is essential for function of Sco1p (Buchwald et al., 1991). In the chimeric protein ch 2 all aa are derived from Sco1p, except for the 17 aa of the membrane spanning region which were replaced by the respective hydrophobic aa stretch of Sco2p. Ch 2 was able to confer respiratory competence to strain GR20. This result shows that membrane anchoring and activity of Sco1p does not rely on the authentic TM region, but can be mediated by the homologous protein stretch of Sco2p. Chimeras ch 3–5 enabled us to narrow down the C-terminal portion of Sco1p which can be replaced by homologous Sco2p sequences: ch 3, in which the C-terminal 178 aa are derived from Sco2p, proved to be functional. Increase of the Sco2p portion to 190 aa in ch 4 still resulted in a functional protein, albeit growth on glycerol medium of the respective transformants was slightly reduced at 30 ◦ C and 37 ◦ C and severely impaired at 23 ◦ C. Further increase of the portion derived from Sco2p to 201 aa in ch 5 led to a chimeric protein, which was no longer able to substitute for Sco1p at any temperature. We conclude from these data that a small stretch of 13 aa from the C-terminal segment, which is immediately adjacent to the TM region, defines a Growth of Dsco1 strain GR20 on YPGly at:

ch 1

PS ch 2

TM

++

++

++

TM

+++

+++

+++

TM

+++

+++

+++

+/−

++

++







Sco1p (1-105) / Sco2p (112-301): PS

ch 5

37°C

Sco1p (1-117) / Sco2p (124-301): PS

ch 4

30°C

Sco1p (1-75) / Sco2p (82-98) / Sco1p (93-295): PS

ch 3

23°C Sco2p (1-81) / Sco1p (76-295):

TM

Sco1p (1-94) / Sco2p (101-301): PS

TM

Figure 2. Sco1p/Sco2p chimeras: Sequences derived from Sco1p are shown in white, those from Sco2p in grey. PS indicates the mt presequence and TM the TM segment. Growth of sco1 strain GR20 transformed with the respective pRS415 constructs was tested on non-fermentable glycerol medium: +++, wild-type growth; ++, reduced growth; +/−, barely detectable growth; −, no growth Copyright  2002 John Wiley & Sons, Ltd.

Yeast 2002; 19: 909–922.

916

A. Lode et al.

critical region, which cannot be replaced by the Sco2p counterpart. Ch 4 and ch 5 differ in only three aa positions in the immediate vicinity of the TM segment (see Figure 3A). To test the importance of these aa for Sco1p function, we introduced each of these residues at the respective position of Sco1p by in vitro mutagenesis and tested the resulting mutant proteins for complementation of strain GR20 (Figure 3B). Surprisingly, all three mutant proteins Sco1p(Q101E), Sco1p(99 + L), and Sco1p(E105D), showed wild-type activity. Either a combination of the mutations is required

for inactivating Sco1p function, or these aa are refractive to function only in the context of Cterminal sequences derived from Sco2p. In a parallel set of experiments we introduced into ch 5 at each of the three differing positions the Sco1p-specific aa. The resulting mutant chimeras ch 5(E102Q), ch 5(99 − L) and ch 5(D106E) were tested for their ability to substitute for Sco1p in a complementation assay. Transformants expressing ch 5(E102Q) or ch 5(D106E) show a faint growth on glycerol medium at 30 ◦ C and 37 ◦ C and almost no growth at 23 ◦ C. A much stronger effect was observed when GR20 transformants expressed Growth of Dsco1 strain GR20 on YPGly at: 23°C

A. TM ch 4



+ −

+ −+ + +



− + −

37°C



F N R E K R R L -- E T Q K E A E A N TM

ch 5

+ −+ + +

30°C

+/−

++

30°C + Cu:

++

+++



+/–



FNREKRRLLETEKEADAN





B. TM Sco1p (Q101E)



+ −

+− + + +



+ −

+ − + + +



− + −

+ − + + +



+ −

+ − + ++



− + −

+++

+++

+++

+++



+/−

+/−

++

+++

+++

+++

+++

+/−

++

++

+++

+++

+++

+++

+++



+/−

+

++









F N R E K R R L -- E T Q K E A D A N TM

ch 5(D106E)

+ −+ ++

F N R E K R R L -- E T E K E A D A N TM

Sco1p (E105D)



FNREKRRLLETQKEAEAN TM

ch 5(99 - L)

− + −

FNREKRRLLETQKE ADAN TM

Sco1p(99+ L)



F N R E K R R L -- E T E K E A E A N TM

ch 5(E102Q)

+ − + + +



FNREKRRLLETEKEAEAN

Figure 3. Site-directed mutagenesis of the region C-terminally flanking the TM segment in Sco1p and ch 5. Sequences of the region adjacent to the TM segment in the respective mutant proteins are shown. aa derived from Sco1p are given in white and those from Sco2p in grey boxes. TM indicates the last two aa of the TM segment, + and − denote the positively and negatively charged aa, respectively. (A) The three aa positions which differ between the chimeras ch 4 and ch 5 are printed in bold. (B) The aa positions changed by mutagenesis are shown in bold. Growth of the sco1 null mutant GR20 expressing the respective YEp351 constructs was tested on glycerol plates as well as on glycerol plates supplemented with 0.2% CuSO4 (+Cu): +++, wild-type growth; ++, reduced growth; +, strongly reduced growth; +/−, barely detectable growth; −, no growth Copyright  2002 John Wiley & Sons, Ltd.

Yeast 2002; 19: 909–922.

Saccharomyces cerevisiae Sco2p

917

ch 5(99 − L): in this case the growth characteristics was identical with that of ch 4 transformants. These results may hint at the possibility that this critical protein segment is important for the spatial orientation of the C-terminal portion or is involved in protein–protein interactions. Recently, Paret et al. (2000) reported the partial suppression of a specific sco1 allele by addition of copper to the growth medium. A similar result was obtained in the case of human hsco2 mutant alleles (Jaksch et al., 2001b). Therefore we addressed the question whether supplementation of the glycerol medium with copper might be able to restore oxidative growth of transformants bearing ch 5 and the respective ch 5 mutant alleles. As indicated in Figure 3, ch 5 transformants show a very faint growth, whereas in the case of the transformants expressing the mutant ch 5 proteins improved restoration of oxidative growth is observed. These results suggest that the critical protein stretch may somehow affect the binding and/or the transfer of copper (see Discussion).

Sco2p derivative, in which aa 82–98 were deleted (Sco2p(82–98)–3HA). Alkaline extraction of mitochondria isolated from the sco2 null mutant strain AR1 expressing either Sco2p–3HA or the truncated version Sco2p(82–98)–3HA from the single copy vector pRS415 under control of the SCO2 promoter was performed and the resulting fractions were analysed in a Western blot (Figure 4). Whereas wild-type Sco2p is exclusively detected in the insoluble membrane fraction (Figure 4A, lane 1), the Sco2p derivative lacking the potential TM segment is completely recovered from the soluble fraction (Figure 4B, lane 4). Quality of the alkaline extraction was verified by examination of the distribution of two control proteins, the matrix-localized aconitase and the integral membrane protein Cox2p (Figure 4A, B). The results of these experiments demonstrate clearly that membrane association of Sco2p is exclusively mediated by the hydrophobic stretch of aa 82–98.

Membrane association of Sco2p

To test whether Sco2p interacts with Cox2p, we performed a co-immunoprecipitation experiment using mt lysate from the sco2 null mutant strain AR1 expressing Sco2p–3HA. Immunoprecipitation was carried out with a Cox2p-specific antibody, which does not react with HA-tagged proteins (data not shown). The presence of Sco2p–3HA in the precipitate was examined by

The complementation behaviour of ch 2 showed that the hydrophobic segment (aa 82–98) of Sco2p is able to replace the TM segment of Sco1p. To test whether this hydrophobic stretch is the main determinant responsible for anchoring Sco2p in the membrane we constructed a 3HA-tagged

Interaction of Sco2p and Cox2p

Figure 4. Membrane association of Sco2p. Alkaline extraction of mitochondria isolated from strain AR1 expressing either Sco2p–3HA (lanes 1 and 2) or Sco2p(82–98)–3HA (lanes 3 and 4). Pellets (P) and soluble (S) fractions obtained after centrifugation of Na2 CO3 -treated mitochondria were subjected to SDS–PAGE, transferred to PVDF-membrane and Western blot analysis was carried out with antibodies directed against the HA-epitope, the soluble matrix–protein aconitase and the integral membrane protein Cox2p Copyright  2002 John Wiley & Sons, Ltd.

Yeast 2002; 19: 909–922.

918

Figure 5. Protein–protein interactions of Sco2p. (A) Co-immunoprecipitation of Cox2p and Sco2p. Immunoprecipitation with Cox2p antibody was carried out using mt lysates containing either Sco2p–3HA or untagged Sco2p. Mt lysates (ML) as well as immunoprecipitates (IP) were separated by SDS–PAGE, transferred to PVDF membrane and analysed with HA antibody. Lane 1, ML of Sco2p–3HA expressing AR1 transformants; lane 2, ML of wild-type W303; lane 3, IP of Sco2p–3HA expressing AR1 transformants; lane 4, IP of wild-type W303. Heavy and light chains of Cox2p antibody are indicated. (B) In vitro interactions of Sco2p. GST (lanes 2, 4 and 6) as well as the respective GST fusion proteins (GST–Cox2p(C): lane 1, GST–Sco2p(C): lane 3, GST–Sco1p(C): lane 5) were bound to GSH-sepharose beads and incubated with mt lysate prepared from yeast strain AR2 expressing Sco2p–3HA. Bound proteins were subjected to SDS–PAGE, transferred to PVDF membrane and the Western blot was probed with HA antibody

Western blot analysis using HA antibody. In a control experiment, the identical procedure was performed with mt lysate of wild-type strain W303, lacking Sco2p–3HA. As can be seen in Figure 5A, a protein of the expected size of about 33 kDa was detected with HA antibody in the immunoprecipitate of Sco2p–3HA expressing AR1-transformants (lane 3), but not in the control (lane 4). The heavy and light chain of the Cox2p antibody which are also recognized by the secondary antimouse antibody, as well as an additional band Copyright  2002 John Wiley & Sons, Ltd.

A. Lode et al.

of about 37 kDa, which could represent a heavy chain degradation product, are detected in both the Sco2p–3HA containing and the control lysate. The specific precipitation of Cox2p in both cases was confirmed by Western blot analysis with an antibody directed against Cox2p (data not shown). The result of this experiment shows that Sco2p can be detected in a complex with Cox2p in vivo. In a previous study we demonstrated by affinity chromatography that Sco1p interacts with the C-terminal portion of Cox2p, which contains the CuA -centre and is exposed to the mt intermembrane space (Lode et al., 2000). We examined whether this part of Cox2p is also involved in the interaction with Sco2p. The fusion protein GST–Cox2p(C), consisting of GST and the C-terminal portion of Cox2p (aa 108–251) and, as a negative control, GST alone, were expressed in E. coli strain BL21, immobilized on GSH-sepharose beads and incubated with mt lysate of the sco1/sco2 double null mutant strain AR2 expressing Sco2p–3HA. Western blot analysis of bound proteins with an antibody directed against the HA-epitope revealed specific binding of Sco2p by GST–Cox2p(C) (Figure 5B, lanes 1 and 2). The interaction of Sco2p and Cox2p is independent of Sco1p, because the latter protein is absent in the mt lysate used in this experiment. Neither the presence of the copper chelator Bathocuproinedisulphonic acid (BCS) nor the substitution of the cysteine residues C154 and C158 in the putative Cu-binding motif CXXXC affected the association of Sco2p with GST–Cox2p(C) in the in vitro binding assay (data not shown), suggesting that the interaction does not require copper ions.

Homomerization of Sco2p To test whether Sco2p forms homomeric complexes similar to Sco1p we performed an in vitro binding assay with GST–Sco2p(C). This fusion protein contains the C-terminal portion of Sco2p (aa 101–301, including the CXXXC-motif), which is thought to protrude into the mt intermembrane space. GST–Sco2p(C) was expressed in E. coli strain BL21, bound to GSH-sepharose and incubated with mt lysate prepared from the sco1/sco2 double null mutant strain AR2 expressing Sco2p–3HA. Western blot analysis of bound proteins using HA antibody demonstrates binding of Sco2p-3HA to GST-Sco2p(C), but not to GST (Figure 5B, lanes 3 and 4). This result shows that Yeast 2002; 19: 909–922.

Saccharomyces cerevisiae Sco2p

Sco2p is able to homomerize. Sco2p-homomer formation is not dependent on copper ions, since binding is also observed in the presence of the copper chelator BCS (data not shown).

Formation of heteromeric complexes between Sco1p and Sco2p Both our data on Sco1p/Sco2p chimeric proteins (this work) and the observation of allele-specific suppression of sco1 mutations by SCO2 (Glerum et al., 1996; Lode, unpublished results) suggest that both Sco-homologues may form a heteromeric complex. To investigate this, an in vitro binding assay was carried out. GST–Sco1p(C) consisting of GST and the C-terminal portion of Sco1p (aa 93–295), was isolated from yeast, coupled to GSH-sepharose and incubated with mt lysate of the sco1/sco2 double null mutant strain AR2 expressing Sco2p–3HA. Western blot analysis of bound proteins with an antibody directed against the HA epitope revealed binding of Sco2p–3HA to GST–Sco1p(C), whereas no association with GST alone was observed (Figure 5B, lanes 5 and 6). The result shows that Sco1p and Sco2p can form heteromeric complexes. This interaction is also observed in the presence of the copper chelator BCS (data not shown), indicating that heteromer formation is not dependent on copper ions.

Discussion The S. cerevisiae proteins Sco1p and Sco2p display a high degree of identity and a similar hydrophobicity pattern. Both proteins have been described as components of the mt membrane. In the case of Sco1p it was shown that membrane anchoring is mediated by a single hydrophobic stretch. The data provided in this paper document a similar situation in the case of Sco2p: removal of a stretch of 17 hydrophobic aa in the N-terminal third renders the protein soluble, suggesting that membrane anchoring is primarily mediated by these aa. On the basis of the available data the topology of Sco1p and Sco2p seems to be identical. Both proteins possess a tripartite structure with a major C-terminal part exposed to the intermembrane space and an N-terminal part, which is orientated to the mt matrix. A stretch of about 17 aa separating Copyright  2002 John Wiley & Sons, Ltd.

919

both parts acts as TM segment. In both proteins the TM region is immediately followed by a cluster of charged aa. Such an arrangement is present in a variety of mt inner membrane proteins. In the case of D-lactate dehydrogenase, which attains a similar Nin –Cout orientation in the inner membrane, it was shown that the TM segment and the following cluster of charged aa act as a bipartite sorting signal (Rojo et al., 1998). It was suggested that Sco1p and Sco2p may have partially overlapping functions (Glerum et al., 1996). In favour of this idea was our recent finding of a functional chimeric protein consisting in part of sequences derived from Sco1p and Sco2p, respectively (Rentzsch et al., 1999). The data reported in this paper show that almost every aa stretch of Sco1p can be replaced by the homologous stretch of Sco2p without loss of function. A chimeric protein composed of the N-terminal part of Sco2p and the residual parts derived from Sco1p is able to functionally replace Sco1p as is a chimera, in which the TM segment stems from Sco2p. Most of the C-terminal part can also be provided by Sco2p, but chimeras with the complete C-terminal part derived from Sco2p are nonfunctional. A small stretch of 13 aa, in which three aa differ between Sco1p and Sco2p, seems to be crucial for Sco1p function, at least if the residual C-terminal part stems from Sco2p. Two possible explanations can be envisaged: either this critical stretch is essential for protein–protein interactions, or it is required to ensure a specific threedimensional orientation of the C-terminal part. We favour the second explanation for the following reasons: 1. Introduction of the three differing aa into the original Sco1p sequence does not affect Sco1p function. This result shows that the aa composition of the stretch is only critical, when the adjacent C-terminal part is derived from Sco2p. 2. Introduction of the Sco1p-specific aa in the Sco2p-derived part renders the resulting chimeric proteins partially active. This is especially obvious in the case of construct ch 5(99-L), in which a leucine residue was deleted. This observation suggests that an exact spatial orientation of the protein is essential for function, perhaps by positioning those aa, which are involved in copper binding and/or in the transfer of copper to Cox2p. Yeast 2002; 19: 909–922.

920

3. The puzzling observation that chimeric proteins with either the complete N-terminal part [Sco2p(1–81)/Sco1p(76–295)] or most of the C-terminal part derived from Sco2p [Sco1p(1–105)/Sco2p(112–301)] are functional, but chimera Sco2p(1–81)/Sco1p(76–105)/ Sco2p(112–301), in which both the N- and Cterminal parts stem from Sco2p is not (data not shown), may also hint at spatial constraints in this construct. Possibly the N-terminal part, although separated by the TM segment, affects the spatial orientation and/or tertiary structure of the C-terminal part. Jaksch et al. (2001b) reported the rescue of COX deficiency in human cells deficient in hSco2p by addition of copper. The authors favour the interpretation that another mt copper chaperone with partially overlapping function can substitute for hSco2p in the presence of a high copper concentration. This situation contrasts with the results obtained on yeast strains deleted for SCO1 : here increased copper is not able to suppress the pet phenotype, supporting the idea that copper loading of Cox2p by Sco2p is inefficient, even in the presence of high copper concentration (see below). A recent report of Paret et al. (2000), however, shows that specific sco1 mutant alleles can partially be suppressed by supplementation with copper. In the present paper we show that growth of sco1 transformants expressing the mutated forms of ch 5 [ch 5(E102Q); ch 5(99-L); ch 5(D106E)] on non-fermentable YPGly medium is also clearly improved after supplementation with CuSO4 . Enhanced copper concentrations may improve binding of copper ions and thus formation of the CuA centre. The observation of two homologous proteins with overlapping, but not identical function is not without precedent in S. cerevisiae. More than 800 duplicate gene pairs (i.e. genes exhibiting a significant BLASTP hit) are among the ca. 5800 genes of S. cerevisiae (Wolfe and Shields, 1997). It is discussed that the frequent presence of gene pairs reflects an ancient duplication of the whole genome. In some cases the function of the duplicated genes have diverged, e.g. in the case of CIT1 and CIT2, which encode mt and peroxisomal isozymes of citrate synthase. In many other cases, novel functions of duplicated genes are not obvious. Copyright  2002 John Wiley & Sons, Ltd.

A. Lode et al.

In the case of Sco2p, we and others were not able to find a growth condition which requires the function of Sco2p. Our finding that the steady state concentration of Cox2p is significantly lower in a sco1/sco2 double mutant compared to the sco1 single mutant hints at a participation of Sco2p in COX assembly. This idea is strongly supported by the detection of an interaction between Cox2p and Sco2p, highly reminiscent of the recently reported interaction between Cox2p and Sco1p (Lode et al., 2000). In both cases complex formation was observed by in vitro binding assays in the absence of the respective homologue as well as in vivo by immunoprecipitation in the presence of the respective homologue. This latter result shows that the interaction between Cox2p and Sco1p and Sco2p, respectively, is not mutually exclusive, but seems to occur simultaneously, possibly in form of a heteromeric Sco1p–Sco2p complex. Such a heteromeric complex is formed in vitro, when recombinant GSTSco1p(C) is incubated with a Sco2p–3HA containing mt lysate of a sco1/sco2 double mutant. Whether such a complex exists in vivo, remains to be investigated. It may well be that in vivo Sco2p preferentially forms homomeric complexes. Such complexes are detected, when recombinant GST–Sco2p(C) is incubated with mt lysate of the sco1/sco2 transformant in vitro. Copper transfer to the CuA centre of Cox2p mediated by Sco1p allows assembly of COX and formation of an intact respiratory chain. It does not rely on the presence of heteromeric Sco1p–Sco2por of homomeric Sco2p complexes, because deletion of Sco1p only, but not of Sco2p, results in respiratory deficiency. The residual level of Cox2p, which is detectable in the sco1 single mutant GR20 but not in the sco1/sco2 double mutant AR2, may result from an inefficient copper transfer to Cox2p mediated by Sco2p. As an alternative the interaction between Sco2p and Cox2p may stabilize the COX-subunit. Perhaps the combined action of Sco1p and Sco2p is advantageous when high quantities of COX are rapidly formed. For example, expression of nuclearly encoded COX subunits increases in the course of diauxic shift (DeRisi et al., 1997). In this situation the concerted action of Sco1p and Sco2p may be required to avoid that copper loading of COX subunits becomes a limiting factor in the formation of novel COX complexes. Yeast 2002; 19: 909–922.

Saccharomyces cerevisiae Sco2p

Acknowledgements This work was supported by the Deutsche Forschungsgemeinschaft (DFG RO 1299/2-3). We thank K. Barth and U. Krause-Buchholz for critical reading of the manuscript.

References Beers J, Glerum DM, Tzagoloff A. 1997. Purification, characterization, and localization of yeast Cox17p, a mitochondrial copper shuttle. J Biol Chem 272: 33 191–33 196. Buchwald P, Krummeck G, R¨odel G. 1991. Immunological identification of yeast SCO1 protein as a component of the inner mitochondrial membrane. Mol Gen Genet 229: 413–420. DeRisi JL, Iyer VR, Brown PO. 1997. Exploring the metabolic and genetic control of gene expression on a genomic scale. Science 278: 680–686. Fujiki Y, Hubbard AL, Fowler S, Lazarow PB. 1982. Isolation of intracellular membranes by means of sodium carbonate treatment: application to endoplasmic reticulum. J Cell Biol 93: 97–102. Glerum DM, Shtanko A, Tzagoloff A. 1996. SCO1 and SCO2 act as high copy suppressors of a mitochondrial copper recruitment defect in Saccharomyces cerevisiae. J Biol Chem 271: 20 531–20 535. Hill JE, Myers AM, Koerner TJ, Tzagoloff A. 1986. Yeast/E. coli shuttle vectors with multiple unique restriction sites. Yeast 2: 163–167. Jaksch M, Horvath R, Horn N, et al. 2001a. Homozygosity (E140K) in SCO2 causes delayed infantile onset of cardiomyopathy and neuropathy. Neurology 57: 1440–1446. Jaksch M, Ogilvie I, Yao J, et al. 2000. Mutations in SCO2 are associated with a distinct form of hypertrophic cardiomyopathy and cytochrome c oxidase deficiency. Hum Mol Genet 9: 795–801. Jaksch M, Paret C, Stucka R, et al. 2001b. Cytochrome c oxidase deficiency due to mutations in SCO2, encoding a mitochondrial copper-binding protein, is rescued by copper in human myoblasts. Hum Mol Genet 10: 3025–3035. Johnston JR (eds). 1994. Molecular Genetics of Yeast. Oxford University Press: New York. Kaiser C, Michaelis S, Mitchell A (eds). 1994. Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press: New York. Krummeck G. 1992. Das mitochondriale SCO1 Protein von Saccharomyces cerevisiae: Untersuchungen zur Expression, Topologie und Funktion. PhD Thesis, Ludwig-MaximiliansUniversit¨at, M¨unchen. Krummeck G, R¨odel G. 1990. Yeast SCO1 protein is required for a post-translational step in the accumulation of mitochondrial cytochrome c oxidase subunits I and II. Curr Genet 18: 13–15. Laemmli UK. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680–685. Lode A, Kuschel M, Paret C, R¨odel G. 2000. Mitochondrial copper metabolism in yeast: interaction between Sco1p and Cox2p. FEBS Lett 485: 19–24. McEwen JE, Ko C, Kloeckner-Gruissem B, Poyton RO. 1986. Nuclear functions required for cytochrome c oxidase biogenesis in Saccharomyces cerevisiae. Characterization of mutants in 34 complementation groups. J Biol Chem 261: 11 872–11 879. Copyright  2002 John Wiley & Sons, Ltd.

921

Muroff I, Tzagoloff A. 1990. CBP7 codes for a co-factor required in conjunction with a mitochondrial maturase for splicing of its cognate intervening sequence. EMBO J 9: 2765–2773. Nijtmans LG, de Jong L, Artal Sanz M, et al. 2000. Prohibitins act as a membrane-bound chaperone for the stabilization of mitochondrial proteins. EMBO J 19: 2444–2451. Nittis T, George GN, Winge DR. 2001. Yeast Sco1, a protein essential for cytochrome c oxidase function is a Cu(I)-binding protein. J Biol Chem 276: 42 520–42 526. Ostermeier C, Iwata S, Michel H. 1996. Cytochrome c oxidase. Curr Opin Struct Biol 6: 460–466. Papadopoulou LC, Sue CM, Davidson MM, et al. 1999. Fatal infantile cardioencephalomyopathy with COX deficiency and mutations in SCO2, a COX assembly gene. Nature Genet 23: 333–337. Paret C, Lode A, Krause-Buchholz U, R¨odel G. 2000. The P(174)L mutation in the human hSCO1 gene affects the assembly of cytochrome c oxidase. Biochem Biophys Res Commun 279: 341–347. Paret C, Ostermann K, Krause-Buchholz U, Rentzsch A, R¨odel G. 1999. Human members of the SCO1 gene family: complementation analysis in yeast and intracellular localization. FEBS Lett 447: 65–70. Petruzzella V, Tiranti V, Fernandez P, Ianna P, Carrozzo R, Zeviani M. 1998. Identification and characterization of human cDNAs specific to BCS1, PET112, SCO1, COX15 and COX11, five genes involved in the formation and function of the mitochondrial respiratory chain. Genomics 54: 494–504. Pogulis RJ, Vallejo AN, Pease LR. 1996. In vitro recombination and mutagenesis by overlap extension PCR. Methods Mol Biol 57: 167–176. Rentzsch A, Krummeck-Weiss G, Hofer A, Bartuschka A, Ostermann K, R¨odel G. 1999. Mitochondrial copper metabolism in yeast: mutational analysis of Sco1p involved in the biogenesis of cytochrome c oxidase. Curr Genet 35: 103–108. Rojo EE, Guiard B, Neupert W, Stuart RA. 1998. Sorting of D-lactate dehydrogenase to the inner membrane of mitochondria. Analysis of topogenic signal and energetic requirements. J Biol Chem 273: 8040–8047. Rothstein RJ. 1983. One-step gene disruption in yeast. Methods Enzymol 101: 202–211. Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory Press: New York. Sanger F, Nicklen S, Coulson AR. 1977. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74: 5463–5467. Schiestl RH, Gietz RD. 1989. High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier. Curr Genet 16: 339–346. Schulze M, R¨odel G. 1988. SCO1, a yeast nuclear gene essential for accumulation of mitochondrial cytochrome c oxidase subunit II. Mol Gen Genet 211: 492–498. Schulze M, R¨odel G. 1989. Accumulation of the cytochrome c oxidase subunits I and II in yeast requires a mitochondrial membrane-associated protein, encoded by the nuclear SCO1 gene. Mol Gen Genet 216: 37–43. Sikorski RS, Hieter P. 1989. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122: 19–27.

Yeast 2002; 19: 909–922.

922

Smits PH, De Haan M, Maat C, Grivell LA. 1994. The complete sequence of a 33 kb fragment on the right arm of chromosome II from Saccharomyces cerevisiae reveals 16 open reading frames, including 10 new open reading frames, five previously identified genes and a homologue of the SCO1 gene. Yeast 10(suppl A): S75–80. Studier FW, Moffatt BA. 1986. Use of bacteriophage T7 RNA polymerase to direct selective high-level expression of cloned genes. J Mol Biol 189: 113–130. Tzagoloff A, Dieckmann CL. 1990. PET genes of Saccharomyces cerevisiae. Microbiol Rev 54: 211–225.

Copyright  2002 John Wiley & Sons, Ltd.

A. Lode et al.

Valnot I, Osmond S, Gigarel N. 2000. Mutations of the SCO1 gene in mitochondrial cytochrome c oxidase deficiency with neonatal-onset hepatic failure and encephalopathy. Am J Hum Genet 67: 1104–1109. Wach A, Brachat A, Alberti-Segui C, Rebischung C, Philippsen P. 1997. Heterologous HIS3 marker and GFP reporter modules for PCR-targeting in Saccharomyces cerevisiae. Yeast 13: 1065–1075. Wolfe KH, Shields DC. 1997. Molecular evidence for an ancient duplication of the entire yeast genome. Nature 387: 708–713.

Yeast 2002; 19: 909–922.

Suggest Documents