Protein P59Nc and Its Genetic Relationship to the snowflake Locus of ... Z do not represent translocations of cfp; and (iii) the snowflake mutants possesses.
Copyright 0 1992 by the Genetics Society of America
Molecular Cloningof a Gene (cfp) Encoding the Cytoplasmic Filament Protein P59Nc and Its Genetic Relationship to thesnowflake Locus of Neurospora crassa Sergio D. Haedo, Esteban D. Temporini, Maria E. Alvarez, Hugo J. F. Maccioni and Alberto L. Rosa' CZQUZBIC-CONICET, Departamento de Quimica Biolo'gica, Facultad de Ciencias Quimicas, Universidad Nacional de Co'rdoba, Ciudad Universitaria, 5016-Co'rdoba, Argentina Manuscript received February 24, I992 Accepted for publication March 2, 1992 ABSTRACT P59Nc is a 59-kD polypeptide associatedwith8-10-nm diameter cellular filaments in normal Neurospora crassa strains. Abnormally sized and shaped bundles of these structures are present in N . crassa strains carrying mutations at the locus sn (snowflake).By using molecular cloning and restriction fragment length polymorphism (RFLP) segregation analysis strategies we show here that sn is not the genetic locus of P59Nc. Several P59Nc cDNAs were cloned from a N. crassa XGTll library after immunoscreening withspecificpolyclonal anti-P59Nc antibodies. Additional longer cDNAs were obtained from a N. crassa cDNA-XZAP library. When used as probes in Southern blots of total DNA from wild-type strains, multicent-2 (a multiple mutant strain), and snowflake mutants, the P59Nc cDNAs revealed comparable patterns of hybridizing bands for all of the restriction enzymes tested. Analysis of segregation of BclI and ClaI RFLPs, detected in the genomic region of the P59Nc gene (locus cfp: cellularjlament polypeptide), among aset ofstrains designed for RFLP mapping, or among selected progeny of crosses involving a snowflake parent, respectively, indicate that (i) there is in N. crassa a single cfp locus positioned on the right arm of linkage group VI1 between the locusfor and the proximal breakpoint of the translocation T(VIZ * I)5936; (ii) the sn mutations in the centromere region of chromosome Z do not represent translocations of cfp; and (iii) the snowflake mutants possesses a normal copy of the P59Nc gene on their chromosomes VIZ. Taken together theresults indicate that the aberrantin vivo arrangement of the P59Nc 8-10-nm filaments occurring in snowflake mutants are not due to alterations in the P59Nc gene.
M
ICROTUBULES (20-25 nm in diameter) and microfilaments (5-7 nm in diameter) are the most clearly defined elements from the filamentous and HEATH fungi cellular matrix (MCKERRACHER 1987). Other filamentous cytoplasmic structures observed in electron microscope studies of filamentous fungi cells remain poorly characterized (see ROSA, PERALTA-SOLER and MACCIONI 1990). Recently, the isolation and characterization of bundles of 8-10-nm diameter filaments in the fungus N. crassa were described (ROSA et al. 1990). Similar filament bundles were first observed in electron microscope studies of N . crassa wild type, in the morphological mutant snowflake (ALLEN, LOWRY and SUSSMAN 1974), andin and ZACCHARIAN other filamentous fungi (ANDERSON 1974; GULL1975; HOCHand HOWARD1980). However, their biochemical nature remains unsettled (see ROSA,PERALTA-SOLER and MACCIONI 1990). The N. crassa 8-10-nm filaments are constituted of a polypeptide of 59 kD ("P59Nc"; ROSAet a2. 1990), are profusely distributed in the cytoplasmic and nuclear
' To whom correspondence should be addressed Genetics 131: 575-580 (July, 1992)
compartments of the cell in either young or old mycelia (ROSA, PERALTA-SOLER and MACCIONI 1990), and are abnormal in size and shape in the N. crussa snowJake mutant (ALLEN, LOWRY and SUSSMAN 1974). ROSA, ALVAREZ and M A L D ~ N A (1990) D ~ proposed that the locus sn (snowfluke) may be the genetic locus for the P59Nc gene or for a gene whose product is involved in the in vivo assembly of the 8-1 0-nm filaments. We report here the molecular cloning of the P59Nc gene. Besides, by performing genomic Southern blot and RFLP segregation analyses, we have studiedboth (i) if the locus sn onthecentromere region of chromosome I includes the P59Nc geneand (ii) if the snowflake mutants possess alterations in the gp locus. MATERIALS AND METHODS Strains, growth conditions and crosses: Escherichia coli K802 (RALEIGHand WILSON 1986), Y1089 and Y 1090 (YOUNGand DAVIS1983a), and BB4 (SHORTet al. 1988) were used for plasmid, XGTl1and hZAP propagation, respectively. N . crassa strains used in this work are listed in Table 1. The "Set1 include 38 (FGSC 4450-87) progeny individuals selected from the cross un-2; arg-5; thi-4; pyr-Z;
S. D. Haedo et al.
576
TABLE 1 Genotypes andorigins of N. crassa strains
~~~~
~
~
~~~~~
Wild-type 74-OR23-IA Mauriceville-l-c - A snC136 - a snJL3Ol- a T(VII+ 1)5936 - a un-2;arg-5;thi-4;pyr-l;lys1;inl; nic-3;ars- I-a Set 1 (01-38) Set 2 (RTOI-RTIO)
~~~
“Oak Ridge” “Exotic” snowflake snowflake Translocation VI1 ”-f I Multiple mutant strain
987 4416 947 4338 2105 4488
FGSC FGSC FGSC FGSC FGSC FGSC
RFLP mapping RFLP mapping
4450-4487
FGSC This work
~~
3
a 1, Fungal Genetics Stock Center (FGSC) Catalog, Ed. 3 (1990); 2, METZENBERG et al. (1985); 3, METZENBERGet al. (1984); and 4, PERKINS et al. (1982).
m E
SLOP
L
-
E
E
l
1
I
’E‘
pET2
’E’
1
pBE4
250 bp -
FIGURE1 .-Molecular cloning of P59Nc-cDNAs. The short horizontal line (pBE4) represents the first P59Nc-cDNA (250 bp) characterized. The upper line (pET2) represents a P59Nc-cDNA of about 2.0 kb obtained from the XZAPcDNA library. Position of the initiation codon (AUG) is indicated. The probable end of the P59Nc open reading frame is indicated by stop. Restriction enzyme sites are: C, ClaI and E, EcoRI. “E” indicates EcoRI linkers.
lys-1; inl; nic-3, ars-l-a (“multicent-2-a”; FGSC 4488) X Mauriceville-lc-A (FGSC 4416) (METZENBERG et al. 1984). The set was designed for restriction fragment length polymorphism (RFLP) mapping in N. crassa (METZENBERGet al. 1984, 1985). These strains were generously supplied by C. WILSONfrom the Fungal Genetics Stock Center. All of the stocks were maintained at 4” in silica gel tubes (DAVISand DE SERRES 1970). Working stocks were grown in agar slants of Vogel’s minimal medium (DAVISand DE SERRES1970) supplemented with 2% (w/v) sucrose and nutritional requirements when necessary. Liquid cultures were grown in an orbital shaker at 100-1 20 rpm at 25” or 30”.“Duplication coverage” genetic mapping, by studying the presence of heterozygous RFLPs in partially duplicated strains, was performed as described (METZENBERGet al. 1985; PERKINS 1986). Crosses were performed at 25” in the dark using a synthetic crossing medium (DAVIS and DE SERRES 1970) with 2% (w/v) sucrose as the carbon source. Strains carrying a duplication of a large fragment from therightarm of chromosome VZZ were constructed and characterized by the “barren” phenotype as indicated (PERKINS 1986). N. crassa cDNA libraries: N . crassa XGTl 1 and XZAP cDNA libraries were prepared by SACHSet al. (1986) and ORBACH, SACHSand YANOFSKY(1990), respectively. Methods for immunological screening of XGTll libraries have been described (YOUNG and DAVIS1983b). A rabbit antiP59Nc serum (ROSA,PERALTA-SOLER and MACCIONI1990) wasused after dilution 1:40 in 3% (w/v) bovine serum albumin in a buffer containing 50 mM Tris-HC1 (pH 8.0), 150 mM NaCl and 0.02% (w/v) NaNs. lz5I-1abeledprotein A from Staphyloccocus aureus (CUATRECASAS 1973) was used as secondary ligand. Phage from each primary positive signal
were eluted in 10 mM Tris-HC1 (pH 7.5) with 10 mM MgCIz and about 500 plaque-forming units were spotted on alawn of E. coli Y 1090 tocharacterize phages’producing a foreign protein that strongly binds anti-P59Nc antibodies. Small (1 X 1 cm) isopropyl-1-thio-8-D-galactopyranoside-saturated (10 mM) nitrocellulose squares were used to induce and fix the antigen produced by the clones. The filters were used as solidsupports to affinity-purifyepitope-specific antibodies from the anti-P59Nc serum. The antibodies were used in Western blot analyses (TOWBIN,STAEHELIN and GORDON 1979) of total N. crassa proteins (ROSAet al. 1990). Construction of XGTl 1 lysogens, purification of X DNA from induced lysogens and phage plaque hybridization screening (BENTON and DAVIS1977) of the XZAP library were performed as indicated (SAMBROOK, FRITSCHand MANIATIS 1989). DNA manipulations:Total N. crassa DNA was obtained from frozen and powdered mycelia using either the proceet al. (1987). dure of RAEDER and BRODA(1985) or OAKLEY Restriction of the DNA was performed overnight in a final volume of 200 PI (3-6 r g of total DNA) with 5-10 units of the appropriate restriction enzyme per Pg of DNA. Conditions for Southern blot transfer of DNA to nitrocellulose or nylon solid supports (Hybond C and N, respectively, from Amersham) were as described (SAMBROOK, FRITSCHand MANIATIS 1989). Probes were labeled with ”P b oli olabeling (FEINBERG and VOGELSTEIN 1983) using [a- PIdATP (3000 mCi/mmol) from Du Pont. Hybridization was at 62” in 6 X SSC for 24-48 hr; washing steps were in 6 X SSC with 0.1 % (w/v) sodium dodecyl sufate at 62”.
,x
RESULTS
Molecular cloning of P59Nc-cDNAs: A rabbit anti-P59Nc polyclonal antibody(ROSAet al. 1990) was used for immunoscreening of about 30,000 XGTl 1 clones (80% recombinants as judged from the percentage of Lac- phages in X-Gal plates) (not shown) of a mycelial cDNA N. crassa library (SACHSet al. 1986). Six positive signals were obtained in the primary screening (XNclto 6; see MATERIALS AND METHODS). A 250-bp cDNA present inXNc4 was subcloned into the plasmid Bluescript M13(+)to construct the plasmid pBE4 (Figure1) and usedas a probe to obtain several longer P59Nc cDNAs from a mycelial specific XZAP N. crassa library (ORBACH, SACHSand YANOFSKY 1990). This, and further additional screening of
577
The cfp Locus in Neurospora
B
A EY" E1 " -X I M
O
M
O
M
CI O
M
B I O
M
O
M
0
01 02 0 3 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18,
."
19,-20v
I
a U
M 0
U
U
M
M
21 22 23 24 25
u
M
M
26
u
u
u
M
U
V
M
27 282930
w
M
U
31 32
~
u
U
U
O
O
O
O
O
33 34 35 36 37 38
~
r
n
u
~
FIGURE2.-RFLPs in the genomic region of the .fp locus. (A) Southern blot analysesof total DNAs from Mauriceville-l-c(M) or multicent2 (0)strains digested with EcoRV (EV), EcoRI (EI), XbaI (XI), ClaI (CI), and Bcl (BI), and hybridized withthe 2.0 kb (pET2) P59NccDNA probe. The short horizontal linesat the left indicate the position of molecular size standards (XDNA, Hind111digested). RFLPs are detected for the Bcfl. ClaI, EccoRI and XbaI enzymes. (B) Southern blot showing the segregation of the BclI RFLP (indicated by arrows andrepresented as M or 0 below the photographs)among 38 individuals (OI,0.2, 03, .38, indicated above the photographs) of a selected progeny from the cross Mauriceville-lc (M) X multicent-2 (0)(METZENBERCet al. 1984). For details see text.
.. .
absent in the purified polypeptide. Analyses of additional sequence data are in progress (M. E. ALVAREZ, H. J. F. MACCIONIand A. L. ROSA, E. TEMPORINI, unpublished). The 2.0-kbcDNA, representing the entire coding region of the P59Nc gene, was used in the experiments reported below. Characterization of genomic RFLPsin the region of the P59Nc gene and RFLP mapping of the cfp locus: The search for RFLPs in the genomic region of the cfp locus was carried out in twoN. crussa strains having large differences in nucleotide sequences scattered in the genome. The strains are designed M (Mauriceville-l-c) and 0 (multicent-2)(Table 1; METZLys-Phe-Thr-Val-GIy-Asp-Tyr-Leu-Ala-Glu-Arg-Leu- ENBERC et al. 1984, 1985). RFLPs for BclI, ClaI and other enzymes weredetected with the 2.0-kb P59NcAla-Gln-Val-Glv-Val-ArR. The sequence was posicDNA (Figure 1) as probe (see Figure 2A; five examtioned on the followingcDNA sequence: 5'-ATG ples among the enzymes tested are shown). The pat(start codon; Figure 1) GTA GCC CAA CAA CAA tern of segregation of the BclI RFLP was studied GGAAAGTTCACGGTGGGCGACTACCTC among the genomes of 38 selected individuals (numGCCGAGCGTCTTGCTCAGGTCGGCGTC bered in this work as 01-38) from the progeny of the CGC-3'. Although the cDNA sequence predicts the cross M X 0 (Table 1, "Set 1"; METZENBERCet al. residues Met and Val at the N terminus, they were
a total of ca. 30,000 phages from the XZAP library, using some of the isolated cDNAs as probes, yielded a total of eight positive P59Nc-cDNA XZAP clones (XET 1-8). Figure 1 shows the position of the pBE4cDNA insert relative to a selected, nearly full length P59Nc cDNA of 2.0 kb (pET2) obtained from the XZAP library. The coding strand and the startcodon corresponding to theP59Nc open reading frame (Figure 1) were defined by partial protein and cDNA sequencing. Microsequencing of 23 N-terminal amino acid residues of the purified native P59Nc polypeptide rendered the following sequence: Ala-Gln-Gln-Gln-Gly-
~
578
A
S. D. Haedo et al.
altered form of the P59Nc gene to the centromere of chromosome I? T h e simplest interpretation of the ars-1 et available genetic data about the sn locus (PERKINS Irq, for aZ. 1982 and references cited therein; E. TEMPORINI and A. L. ROSA,unpublished results) is that the two CfP mutant sn alleles isolated do not represent gross chrocat-2 mosomal rearrangements, and correspond to a gene naturally resident on the centromeric region of linkage group I. Even so, experiments were carried out to study the formalgenetic possibility thatthe sn B alleles represent the translocation to the centromere I of altered forms and/or abnormallyexpressing versions of the P59Nc gene. I Figure 4A shows the Southern blot analyses of ClaI frq ars-1 for T(5936) ( c a t - 2 ) I I I I digests of total DNAs from the standardwild-type 74I LG VllR OR23-1A (“Oak Ridge” genetic background), MaurCfP iceville-l-c, multicent-2 and snowflake C136 and FIGURE3.-The cfp locus is linked to the locifrq andfor on N . JL301 strains (Table l), by using the 2.0-kb P59Nccrassa linkage group VII. (A) The horizontal rows show the segregation pattern ( M or 0)of several N. crassa genetic markers (indicDNA as a probe. Identical patterns of hybridizing cated at the left column) among 38 individuals from a selected fragments were observed among the DNAs from wild progeny of the cross Mauriceville-l-c X multicent-2. By considering type, Mauriceville-l-c, and C136, or multicent-2 and the patterns M and 0 in a vertical sense it is possible to detect JL301 strains (Figure 4A); no aberrant bands were genetic intervals in the chromosome VII of each individual where detected in the snowflake mutants. The finding of the cross over (X)has taken place. The sign (-) indicates that this information is not available. Data were taken from Figure 2B (for ClaI RFLP difference in the region of the cfp locus cfp) and from METZENBERGand GROTELUESCHEN (1989). (B) Putabetween snowfluke strains C136 and JL301 (compare tive linkage relationships of the cfp locus (indicated below the map) lanes C136 and JL301 in Figure 4A) shows that they with classical genetic markers in the right arm of linkage group do not possess an identical genetic background. C 136 VII. The circle at the left indicates the centromere. T(5936)marks is essentially “Oak Ridge” (comparelines Wild type and the proximal breakpoint of the translocation T(VII + 1)59;36 and C136 in Figure 4A) and JL301 and multicent-2 “Not the chromosomal fragment involved. Oak Ridge” (compare lines JL301 and multicent-2 in 1984). The segregation pattern (Figure 2B), comFigure 4A). This interpretation was supported and pared with that of about 100 genes and anonymous extended by analyses of several P59Nc RFLP types DNA fragments followed in the same cross (METZEN(Table 2) and additional RFLPs in the chromosome I BERG and GROTELUESCHEN 1989), indicates that the of these strains (S. HAEDO,M. MAUTINO and A. L. cf, locus was on linkage group VII, probably at the ROSA,unpublished results). right of the loci frq and for (see Figure 3A). From these experiments it was not possible to elimT o better position the cfp locus we analysed whether inate the presence of two copies of the P59Nc gene the P59Nc-ClaI RFLP (see Figure 2A), and a BamHI in the snowflake genomes which render similar restricRFLP detected by the pET2 probe (not shown), were tion fragment patterns. Figure4B shows the segregapresent in a heterozygous form in N . crassa strains tion pattern of the P59Nc ClaI RFLP (Figures 1 and carrying a duplicated ( M / O ) fragment of the chro4A) among 10 progenyindividuals, 5 morphologically mosome VZZ distal to the loci for and frq (Figure 3B; wild type and 5 snowflake, selected at random from see MATERIALS AND METHODS section). The expected the cross Mauriceville-l-c X snowflake (allele JL301). forms of the P59Nc RFLPs were present among the T h e result shows that (i) there is a unilocus segregation DNAs of the parental strains ( M and 0) but only the pattern of the ClaI RFLP, and (ii) the pattern correM form was present in the five duplicated progeny sponds to a hybridizing ClaI DNA fragment notlinked strains analyzed (not shown). This result indicates that to the sn locus. Besides, as theP59Ncgene is on the cfp locus is not included in the translocated fraglinkage group VI1 in the Mauriceville-l-c strain (see ment T(VZZ Z)5936. above), and no CZaI-heterozygous progeny were isoTaken together the results suggest that a single cfp lated, we conclude that the P59Nc gene of the snowlocus is positioned between the for locus andthe fluke parental strain is also on linkage group VII. proximal breakpoint of the translocation T(VIZ += Z)5936. Figure 3B shows the putative linkage relationDISCUSSION ship of the cfp locus with the mentioned additional The recent isolation and characterization of P59Nc, genetic markers on the right arm of linkage group the polypeptide of 59-kD constituent of the 8-1 O-nm VII. diameter cytoplasmic filaments in N . crassa cells (ROSA Does snowflake representatranslocation of an
The CJp Locus in Neurospora
579
sn
wt 1
2
3
4
5
6
7
8
9
1
0
B
A
B
FIGURE4.-(A) P59Nc-ClaI RFLP types in DNAs from wild-type 74-OR23-1A ("Oak Ridge"), Mauriceville-lc, multicent-2, or snowfake C136 and JL301, N. crassa strains. DNAs were digested with ClaI and hybridized, after Southern blotting, with the P59Nc-2.0-kb probe (pET2; see Figure 1). The arrows at theleft indicate ClaI hybrydizing fragments of 2.26,O.g 1 and 0.59 kb, from top tobottom, respectively. (B) Southern blot showing the segregation of the P59Nc-ClaI RFLP among morphologically wild type (wt, 1-3) and snowfake (sn, 6-10) progeny strains selected at random from the cross Mauriceville-lc X snowfake JL301. TABLE 2 P59Nc- RFLP types in N. crass0 strains RFLPfor the restrlctlon enzyme Wild type multicent-2
Barn HIb Cla IC Eco RId I Pvu IIC
I
I 1 I I
Strain RFLP and
type"
Mauriceville-1-c snC136 snJL301
I I1I I1 I
I I11 1 I 1
I I
I1 I1
RFLP types are arbitrarily defined as I ("Oak Ridge"), I1 ("No Oak Ridge"), and I11 ("exotic"). RFLP types = -1": 4.48 kbp; "111": 3.98 kbp. RFLP types = "I": 0.59 kbp; "11": 0.91 kbp. RFLP types = "I": 1.03 kbp; "11": 3.75 kbp. RFLP type = "I": 3.44 kbp.
al. 1990; ROSA,PERALTA-SOLER and MACCIONI 1990), opened the question about the cellular role(s) of these structures. Interestingly, it was found that the N . crassa morphological mutants snowflake showed a dramatic alteration in the in vivo array of the P59Nc 8-1 0-nm filaments (ROSA, ALVAREZ and MALDONADO 1990). We hypothesized that (i) the defect in snowflake could be related to a mutation in the P59Nc gene which modifies the properties of the polypeptide for in vivo supramolecular assembly, or (ii) the abnormal bundles of filaments observed in snowflake could be due to a mutation in a different gene whose product modifies the in vivo assemblydisassembly properties ALVAREZ and of the P59Nc 8-1 0-nm filaments (ROSA, MALDONADO1990). T o distinguish between these possibilities we first et
cloned the P59Nc gene. In a second step, by using RFLP segregation analyses(BOTSTEIN et al. 1980; METZENBERCet al. 1985), we mapped the cf, locus in wild-type and sn mutant strains. The study of the segregation of a BclI RFLP showed that the cfj locus is on the right arm of chromosome VZZ. Analysis of P59Nc ClaI and BamHI RFLPs, in strains partially duplicated for a distal fragment of the right arm of chromosome VZZ, indicated that the cfp locus is positioned at the left of the proximal breakpoint of the translocation T(VZZ +Z)5936 roughly at about 5 map units of the locusfor. The mapping of the P59Nc gene to the linkage group VI1 strongly supported the notion thatthe snowflake locus (sn), on thecentromere region of linkage group I, is not the genetic locus of P59Nc. RFLP mapping studies demonstrate that sn mutations did not represent a translocation of the P59Nc gene. Besides, the experiments indicate that the snowflake mutants possess a single, apparently normal, copy of the 'P59Nc gene at its normal locus on linkage group VII. Taken together our results indicate that the aberrant bundles of 8-10-nm filaments observed in the snowflake mutants are not produced by alterations in the primary sequence of the P59Nc polypeptide. The possibility that the putative product of the sn locus is a post-translational modifier of the P59Nc polypeptide and/or of the in vivo properties of the P59Nc filaments to form bundles still remains.
S. D. Haedo et al.
580
We thank A. KORNBLIHTT and H. N. TORRES for the XGTll and XZAP mycelial libraries; C. YANOFSKYfor the E . coZi strain K802; F. TERENZI for the initial help with N . crassa crosses; M. MAUTINO for stimulating discussion along the course of this work and for sharing with us their unpublished results; CRAIGWILSON from the FGSC is acknowledged for his efforts to send strains and information relative to them. This work was supported by CONICET (Consejo Nacional de Investigaciones Cientificas y Tecnicas), CONICOR (Consejo de Investigaciones Cientificas y Tecnicas de Cordoba) and FUNDACION ANTORCHAS.
LITERATURE CITED ALLEN, E. D., R. J. LOWRY and A. S. SUSSMAN, 1974 Accumulation of microfilaments in a colonial mutant of Neurospora crassa. J. Ultrastruct. Res. 48: 455-464. ANDERSON, R. H., and K. ZACHARIAH, 1974 On the structure, function, and distribution of filament bundles in Apotheciat cells of the fungus Ascobolus stercorarius. J. Ultrastruct. Res. 46: 375-392. BENTON, W. D., and R.W. DAVIS,1977 Screening Xgt recombinant clones by hybridization to single plaques in situ. Science 1 9 6 180-184. and R. W. DAVIS, BOTSTEIN,D.,R.L. WHITE, M. SKOLNICK 1980 Construction of a genetic linkage in man using restriction fragment length polimorphism. Am. J. Hum. Genet. 32: 314-331. CUATRECASAS, P., 1973 Interaction of Vibriocholera enterotoxin with cell membranes. Biochemistry 12: 3547-3558. DAVIS,R. H., and F. J. DE SERRES, 1970 Genetic and microbiological research techniques for Neurosporacrassa. Methods Enzymol. 17A: 79-143. FEINBERG, A. P., and B.VOGELSTEIN, 1983 A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 1 3 2 6-13. GULL,K., 1975 Cytoplasmic microfilament organization intwo basidiomycete fungi. J. Ultrastruct. Res. 50: 226-232. HOCH,H. C., and R. J. HOWARD, 1980 Ultrastructure of freezesubstituted hyphae of the basidiomycete Laetisaria arualis. Protoplasma 103: 281-297. MCKERRACHER, L. J., and I. B. HEATH,1987 Cytoplasmic migration and intracellular organelle movement during tip growth of fungal hyphae. Exp. Mycoi. 11: 79-100. METZENBERG, R.L., and J. GROTELUESCHEN, 1989 Restriction polymorphism maps of Neurospora crassa: update. Fungal Genet. Newsl. 3 6 51-57. E. U. SELKERand E. MORZYCKAMETZENBERG, R. L.,J. N. STEVENS, WROBLEWSKA, 1984 A method for finding the genetic map position of cloned DNA fragments. Neurospora Newsl. 31: 3539. METZENBERG, R. L., J. N. STEVENS, E. U. SELKER and E. MORZYCKA-
WROBLEWSKA, 1985 Identification and chromosomal distribution of 5 s rRNA genes in Neurosporacrassa. Proc. Natl. Acad. Sci. USA 82: 2067-207 1. OAKLEY,C. E., C. F. WEIL, P. L. KRETZ and B. R. OAKLEY, 1987 Cloning of the riboB locus of Aspergillus nidulans. Gene 53: 293-298. 1990 The Neurospora ORBACH, M., M. SACHSand C. YANOFSKY, crassa arg-2 locus. J. Biol. Chem. 2 6 5 10981-10987. PERKINS,D. D., 1986 Determining the order of genes, centromeres, and rearrangement breakpoints in Neurospora by test of duplication coverage. J. Genet. 65: 121-144. PERKINS, D.D.,A. RADFORD, D. NEWMEYER and M. BJORKMAN, 1982 Cromosomal loci of Neurospora crassa. Microbiol. Rev. 46: 426-569. RAEDER,U., and P. BRODA,1985 Rapid preparation of DNA from filamentous fungi. Lett. Appl. Microbiol. 1: 17-20. RALEIGH,E. A., and C . WILSON,1986 Escherichia coli restrict DNA containing 5’-methylcytosine. Proc. Natl. Acad. Sci. USA 83: 9070-9074. ROSA,A. L., M. E. ALVAREZ and C. MALDONADO, 1990 Abnormal cytoplasmic bundles of filaments in the Neurospora crassa snowflake colonial mutant contain P59Nc. Exp. Mycol. 1 4 372380. ROSA, A. L., A. PERALTA-SOLER and H. J. F. MACCIONI, 1990 Purification of P59Nc and immunocytochemicalstudies of the 8- to IO-nmcytoplasmic filaments from Neurospora crassa. Exp. Mycol. 1 4 360-371. ROSA, A. L., M. E. ALVAREZ, D. LAWSONand H. J. F. MACCIONI, 1990 A polypeptide of 59 kDal is associated with bundles of cytoplasmic filaments in Neurospora crassa. Biochem. J. 2 6 8 649-655. SACHS,M. S., M. DAVID,S. WERNERand U. L. RAJBHANDARY, 1986 Nuclear genes for the cytochrome c oxidase subunits of Neurospora crassa. J. Biol. Chem. 261: 869-873. J., E.F. FRITSCHand T. MANIATIS,1989 Molecular SAMBROOK, Cloning: A Laboratoy Manual.Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. SHORT,J. M., J. M. FERNANDEZ, J. A. SORGEand W.D. HUSE, 1988 XZAP: a bacteriophage X expression vector with in vivo excision properties. Nucleic Acids Res. 16: 7583-7600. TOWBIN,H., T . STAEHELIN and J. GORDON, 1979 Electrophoretic transfer of proteins from polyacrilamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 7 6 4350-4354. YOUNG, R. A,, andR. W. DAVIS,1983a Efficient isolation ofgenes by usingantibody probes. Proc. Natl. Acad. Sci.USA 80: 11941198. YOUNG, R.A., and R. W. DAVIS,1983b Yeast RNA polymerase I1 genes: isolation with antibody probes. Science 222: 778782. Communicating editor: R. H. DAVIS
