Molecular Cloning of the Genes Encoding Two Chaperone Proteins of ...

3 downloads 45 Views 3MB Size Report
Zea mays hsp70-2 protein. 47/66. 46/64. 89/92. 43. Consensus. 51/67. 55/67. 75/82 .... ing the manuscript, Dr. Carl Weitzmann for providing a probe for 23.

THEJOURNAL OF BIOLOGICAL CHEMISTRY

Vol. 266, No. 1. Issue of January 5, pp. 58-65, 1991 Printed in U.S.A.

Q 1991 by The American Society for Biochemistry and Molecular Biology, Inc

Molecular Cloningof the Genes EncodingTwo Chaperone Proteins of the Cyanobacterium Synechocystis sp. PCC 6803” (Received for publication, July 27, 1990)

Parag R. Chitnis and Nathan Nelson$ From the Roche Institute of Molecular Biology, Roche Research Center, Nutley, New Jersey 07110

Molecular chaperones help other proteins in their tural andfunctional similarities. They are involved in assemcorrectfoldingandassembly. We haveclonedthe bly of oligomers into multimeric structures (6, 7). Molecular genes, cpn60 and dnaK, which encode proteins belong-sequencing of genes encoding these chaperonins has revealed ing to the chaperonin-60 and the 70-kDa heat shock a high conservation in theamino acid sequences in chaperonprotein families from the transformable cyanobacter-ins from E. coli and higher plants. There are, however, some ium Synechocystis sp. PCC 6803. Thesegenes are differences between these two chaperonins. The groEL propresent in single copies in the genome, and themajor tein of E. coli is active as a functional complex with groES transcripts for each geneare monocistronic. Compar- protein (chaperonin-lo), while the existence of chaperoninison of deduced amino acid sequences reveals that cy- 10 in higher plants has yet to be demonstrated. The plant anobacterial chaperonin-60is equally homologous to bacterial and plant chaperonin-60 proteins while the chaperonin complex contains two distinct cpn6O subunits, a product of dnaK is more similar toits bacterial homo- and p. These two types are as divergent from each other as logues than to its eukaryotic counterparts. The DNA they are individually from groEL protein of E. coli. Two such fragments sequenced in these studies also contain five divergent types of cpn60 proteins are notfound in bacteria. Heat shock proteins with molecular masses of approxiother open reading frames. One of them, ORF60-5, mately 70 kDa (hsp70) have beenidentified and characterized encodes a protein whose deduced amino acid sequence from several organisms (8).It has been known for a long time shows remarkable similarity to those of a family of peripheral membrane proteins involved in metabolite that cellular concentrations of these highly conserved proteins transport in bacteria. The transcript levels of dnaK increase rapidly under stress conditions. Their role during and cpn60 of Synechocystis sp. PCC 6803 increase in normal growth conditions has only recently been realized. response tostress conditions suchas heat shock, ultra- They function as chaperones inthetransport of certain violet exposure, and oxidative stress. This is one of the secreted or mitochondrial proteins (9, 10). Members of hsp7O first examples of cyanobacterial gene expression being family have been shown to be present in mitochondria (11, regulated by environmental stresses. 12) and chloroplasts (13, 14). Cyanobacteria present a unique system for studying chaperones. Photosynthetic processes in cyanobacteria are functionally and structurally similar to those in chloroplasts of Molecular chaperones are afamily of proteins which assist higher plants. Therefore, cyanobacteria and plants may have inthe correct folding of other polypeptides and/ortheir similar mechanisms for assembling their photosynthetic proassembly into oligomeric structures but which are not com- tein complexes. Examining the role of molecular chaperones ponents of the final functional structures (1).Their function in cyanobacteria, which are amenable to techniques of molecis invaluable to several processes in prokaryotes and invarious ular genetics, should help to elucidate the function of these compartments of eukaryotic cells (2). Chaperonins are a dis- protein in plastids. Therefore, we have initiated a program to tinct group of chaperones which include subunits of a chlo- clone and characterize genes encoding important chaperones roplast protein complex involvedin the assembly of ribulose- from cyanobacteria. In this paper, we report characterization bisphosphate carboxylase/oxygenase (Rbu-Pp carboxylase)’ of two genes, dnuK and cpn60, encoding homologues of hsp7O (3), the 60-kDa heat shock protein (hsp60) of yeast (4), and and cpn60 proteins, respectively, from the cyanobacterium the proteins encoded by groESL operon in Escherichia coli Synechocystis sp. PCC 6803. (3). One type of chaperonins, called chaperonin-60 (cpn60), is homologousto groEL protein of E. coli (5) and has molecular EXPERIMENTALPROCEDURES weight(s) in the range 56,000-61,000. Chaperonin-60 from Materials-Cells of Synechocystis sp. PCC 6803 were grownin BG plastids of higher plants (Rbu-P2 carboxylase-binding pro- 11 medium buffered with 2 mM Tes-KOH (pH 8.0) under constant tein) and from bacteria (groEL proteins) share several struc- aeration at room temperature (approximately 27 “C)unless otherwise mentioned. Radioactive chemicals were purchased from Amersham Corp. The molecular biology reagents and enzymes were obtained the payment of page charges. This article must therefore be hereby from Bethesda Research Laboratories, New England Biolabs, Bevmarked “aduertbement” in accordance with 18 U.S.C. Section 1734 erly, MA, or Promega Biotech, Madison, WI. Reagents for oligonucleotide synthesis were from Applied Biosystems, Foster City, CA. solely to indicate this fact. The nucleotide sequence(s)reported in thispaper has been submitted The majority of other chemicals and antibiotics were purchased from to the GenBankTM/EMBLData Bunk with accession number($ J05707 Sigma. Genomic Library Screening-Oligonucleotide probes corresponding and 505708. to the most highly conserved regions ofcpn6O and hsp70 proteins To whom correspondence should be addressed. The abbreviations used are: Rbu-Pz carboxylase, ribulose-bis- were designed according to the codon preferences in Synechoystissp. phosphate carboxylase/oxygenase; cpn60, chaperonin-6% bp, base PCC 6803 (Table I). The oligonucleotides were synthesized on an pair(s); hsp, heat shock protein; Tes, 2-([2-hydroxy-l,l-bis(hydrox- Applied Biosystems DNA synthesizer (model 381A) and labeled with 32Pusing T4 polynucleotide kinase (15). These probes were used to ymethyl)ethyl]amino)ethanesulfonicacid.

* The costs of publication of this article were defrayed in part by

58

CyanobacterialGenes Encoding Molecular Chaperones

59

TABLEI Oligonucleotides used for screening of cpn60 and dnaK Number

cpn60 probes 425 426 427 dnaK probes 382 383 384

Oligonucleotide sequence

Conserved protein sequence

GCCAAACITGCCGGTGGTGTTGCCGTTAT GAAGATGCCAAAAATGCCACTTTTGCCGCCATTGAAGAAGG ACTCTTGGTCCTAAAGGTCGTAATGTTGT

AKLAGGVAVI EDAKNATFAAIEEG TLGPKGRW

ATTATTATGGAACCTACTGCCGCCGC

IIMEPTAAA GDTHLGGEDEFD PQIEVTFDIDA

GGTGATACTCATCTTGGTGGTGAAGATTTTGA

CCTCAAATTGAAGTTACTTITGATATTGATGC

150 bp screen a genomic library of Synechocystis sp. PCC 6803. Plasmid c1 DNA wasisolated from positive colonies by the alkaline lysis method, BcI I Kpn I BHBanllllS Srcl S B SH S EcoRV H H and further screening was performed by dot blot (15) and Southern S ..... I , ..... I , , I I 1 I I l j blots (16). 569+ -" 1065 165 1656 193 738 NucleotideSequencing-Two overlapping fragments containing and a 2640-bp the cpn60 gene,a 2422-bp StyI fragment, ORF60-3 cpn60SstI-EcoRV ORF60-5 ORF60-5a fragment were subcloned into pBluescript I1 SK(+) (Stratagene, La FIG. 1. Restrictionmap of genomic region containingcpn6O Jolla, CA). Overlapping deletions of these fragments were obtained of Synechocystis sp. PCC 6803. The open reading frames are by digestion with exonuclease 111 (17) and subsequently sequenced by shown by boxes. Their lengths and the distances between them are the dideoxy termination method (18). The nucleotide sequences were indicated below and between each box, respectively. All open reading aligned and analyzed using DNAstar software and UWGCG programs frames are in the forward direction. B, BstXI; H,HindIII; S, StyI. (19). A similar strategy was used to determine the sequence of three overlapping fragments that hybridized with oligonucleotide probes for dnaK, an 1180-bpEcoRI fragment and a 2040-bp XbaI fragment, polypeptide that is 551 amino acids in length and acidic in its and part of a 2400-bp CZuI-KpnI fragment. The complete nucleotide isoelectric point (4.9) and has amolecular mass of 57,828 Da. sequences will be deposited in GenBank. It shows remarkable identity in amino acid seqdence to varSouthern and Northern Analyses-Genomic Southern blottingwas ious members of the hsp60 family which are now termed performed using 2 pg of DNA from Synechocystis sp. PCC 6803 for chaperonin-60 proteins (Fig. 2) (2). Accordingly, this open each restriction digestion. A 680-bp HindIII-EcoRV fragment and a 280-bp HindIII fragment containing sequences of the cpn60 gene were reading frame is named cpn60. Comparison of the deduced labeled with [32P]dCTPby random priming and used as probes. amino acid sequence ofcpn6O from Synechocystis sp. PCC Similarly, an 1180-bp EcoRI fragment of dnaK gene was labeled and 6803 to those of other chaperonins revealed that cyanobacteused as a dmK-specificprobe. The same probes were used to identify rial cpn60 has 56-58% identity to other bacterial homologues cpn60 or dnaKtranscriptsinNorthern blots. A DNA fragment (Table 11). The similarity of cpn60 of Synechocystis sp. PCC containing a gene for ribosomal 23 S RNA of E. coli was labeled and 6803 to eukaryotic cpn60 varies; it more closely resembles used to quantitate 23 S RNA levels under different stress conditions. Total RNA from Synechocysti sp. PCC 6803 cells was isolated by Rbu-Ppcarboxylase binding proteins of chloroplasts (56-57% the cesium chloride gradient method described for Anabaena sp. (20). identity) than chaperonins from other eukaryotes (47% idenThe amounts of RNA obtained from cells that had been treated with tity). In contrast, thegroEL protein of E. coli is less homolodifferent stress conditions did not significantly vary. For Northern gous to eukaryotic cpn6O proteins (47-51% identity) than to blots 5 pgof RNA was electrophoresed on denaturing agarose gel their prokaryotic counterparts (58-59% identity). Thisdiffercontaining formaldehyde and then transferred to a nylon membrane ence may reflect the evolutionary relatedness of cyanobacteria filter which was hybridized with labeled probe. Slot blots were performed using 5 pg of total RNA. Levels of specific transcripts in total to chloroplasts. When the deduced amino acid sequence of RNA isolated from cells grown under different stress conditions were cpn60 of Synechocystis sp. PCC 6803 was used to search the quantitated by scanning autoradiograms of slot blots using an LKB data base of GenBank, homology wasalso found to a polypepUltroscan XL enhanced laser densitometer. The quantitative data tide encoded by an incompletely sequenced, unidentified open presented in this paper is averaged from at least two observations. reading frame near the operon containing genes for p and t

subunits of ATP synthatase of another cyanobacterium, Synechococcus 6301 (21). Isolation and Characterization of Genomic ClonesContaining The amino acid sequences deduced from the other reading cpn60 of Synechocystis sp. 6803-The amino acid sequences frames shown in Fig. 1were used to search the GenBank data of several cpn60 proteins, including the a subunits of Rbu-P2 base. The reading frame ORF60-5a extends beyond the secarboxylase binding proteins from wheat (3), the groEL pro- quenced region and encodes a polypeptide with more than 258 tein of E. coli (3), andthe hsp60 of yeast (4), are known from amino acids while ORF60-3 codes for a polypeptide containing the nucleotide sequences of the respective genes. These pro- 246 amino acids. The proteins encoded by these two reading teins are induced by heat shock and share many regions of frames are not similar to any polypeptide sequence in the data homology. Oligonucleotidescorresponding to three conserved base. The reading frame ORF60-5 encodes a protein homolregions of cpn60 proteins were used to screen a genomic ogous to several known peripheral, ATP-binding subunits of library (Table I), and several identical clones hybridizing to membrane-protein complexesinvolved in translocation of them were isolated. Hybridization of these oligonucleotides to metabolites. For example, the protein encoded by cysA gene the groEL gene in genome of E. coli was not significant enough of Anacystis nidulans is required for sulfate transport (22), to affect the signal to noise ratio duringscreening. Restriction while the product of pstB of E. coli is involved in transport of mapping and Southern analysis of these clones were used to phosphate (23). Fig. 3 shows two particularly conserved reidentify the region that contained the cpn60 gene. Two over- gions in these proteins. The reading frame ORF60-5 encodes lapping fragments, a StyI fragment (2422 bp) and a SstI- a protein whose features are similar to these proteins. The EcoRV fragment (2640 bp), were subcloned in pBluescript amino acid residues proposed to be involved in ATP binding SK(+).Both strands of these fragments were sequenced. are conserved in ORF60-5 product (Fig. 3). The hydropathy As shown in Fig. 1, there arefour large open reading frames profile of ORF60-5 protein lacks long hydrophobic segments in thesequenced region. The longest reading frame encodes a typical of integral membrane proteins (data notshown). Thus, RESULTS

60

Cyanobacterial Genes Encoding Molecular Chaperones TGCACRGTCATTTTTMGACTTTTCCCACCATGATCGACCGATC~TGCGTTTTCGATGTTACTTMTATTTAGTATATTTAGTGACTCGCGCTT~ 100 M R F R C Y L I F S I F S D S L L G A G C G G A T T T T T T C A G G G A G G ~ G A G C ~ T f f i T T G T G T ~ C T C C G A T C t C C G C T G A G G ~ t C C A C C G A T T C A f f i C C ~ T G T G G T G G A C T T200 GG

A

G

G

A

E

I

F

f

h

A

S

Q T

G

G

A

t

T

K

I

Y

K

R

C

R

A

A

T

M

A

V

A

G

A

F

V

S

T

P

C

T

A

C

N

Q

K

T

W

~

I

A

C

V

A

G

E

A

E

E

C

S

C

L

K

K

P

P

l

T

T

Q

A

G

G

C

T

P

L

S

I

A

V

A

S

G

G

R

G

N

T

V

T

V

E

T

W

C

T

G

A

A

T

Q

Q

G

E

T

F

G

T

T

L

L

G

K

P

I

300 L

TACTGGGTCCTMTGGCATAGCAGGTAAAACTACCCTGTTAA L

G

P

N

G

A

G

K

T

T

L

L

K

I

L

400

L

G

V

I

R

C G G C G A T C G C U I G R C T A C A A C R A C G G G T ~ T A C C T A C C G G ~ T ~ C T A C T T T T A T G A C T T T T T M C C O C T T ~ ~ T T T T T ~ ~ ~ A T T A ~ T C500 GGCAGT G D R Q T K Q R V G Y L P E N A Y F Y D F L T A W E f L D Y I G S CTGTTTCAARTTGGGACA~~C~~CGGCGCATTCTGGCTCATGTGTGACCTGGT~TTAGCCC~CC~~~GC~T TGCGAC 600

L

f

Q

I

G

K

Q

E

R

Q

R

R

I

L

A

M

C

D

L

V

G

L

A

Q

K

T

A

K

K

K

Q

L

R

Q

MTATTCCAGGTATGTTGCAAC~TGffiCArGGCCCAGGUITTGATT~CGATCCTG~GTCGTTTTCCTCGAT~CCCATGTCCffiTTTGGACCC7 0 0

Y

S

K

G

M

L

Q

R

V

G

~

A

Q

A

L

I

N

D

P

E

V

V

~

L

D

E

P

U

S

G

L

D

CTGGGGCGCTACCRAGTGCGGATTATTCTTTCCCTC~GG~~GGGC~CCATCTTTTTCA~CTCCCACATTTT~~~~ACGTTGG~CATT W G A T K C G K L F f P S R N R A K P S f S T P T F W R T L E O l

P

800

T G T G A C C ~ C A T T G C C A T T T T G G C G C G C G ~ ~ T T G C T G T G C A G T G G T T C ~ T T ~ G G M G T G T T A G G T ~ T G A C ~ G G C T A T G M G T G G T G C T C A A 900 ~~~ C D R I A I L A R G E L L C S G S L A E V L G N D E G Y E V V L K G G A G G A G A A G R A G A G G C G T T G T A h A T A T C T A G C C A A T T G E E E A L G K Y L A N L S Q E Q D V W H G H Y Q G D V Q A L V D

1000

T G C G T T A C C C R G T C T T R R T G C C C G T T T G A T C A G C A T G ~ C C I ~ C C G C C C T T C C C T G ~ G A T T A T T T C A T C C G C C ~ C T G C G A G ~ C ~ T A T ~ C C 1100 A L P S L N A R L I S M N L A R P S L E D Y F I R Q L R E R G I T A C C A G C C A G T G A G C R T T A C G T C C G T T A C T C ~ T C C A ~ G A T C t C ~ G C T C T ~ G A C C ~ C C ~ C C T T A C C T ~ C T T A1200 GCAC

FIG. 2. Nucleotide and deduced amino acid sequences of a part of genomic region shown in Fig. 1 containing cpn6O and ORF60-6of Synechocystie sp. PCC 6803. A region identical to the consensus sequence of -10 region of heat shock promoters of E. coli is underlined.

T

S

Q

T

C

C

. A

C

T

C

C

C

A

A

G

A

G

T

G

C

T

A

G

T

G

C

T

T

T

A

T

G

T

C

C

M

S

K

L

I

S

F

K

G

1300

GATGAATCCAGACGCTCTTTGGAAGCGGGGATTAATGCCCTGGCTGATGCGGTtCGGATTACCCTCGGCCC~GGTCGC~TGTTTTATTAG~GC 1400

D

E

S

R

R

S

L

E

A

G

I

N

A

L

A

D

A

V

R

I

T

L

G

P

K

G

R

N

V

L

L

E

K

Q

A G T A C G G T G C T C C C C A G A T T G T C A A C G A T G G C A T C A T C A C C G T A G C C ~ G A T T G M C T G T C C ~ C C C G G ~ G ~ T G C T G G A G C T ~ G C T ~ T C C A G G1500 A

Y

G

A

P

Q

I

V

N

D

G

I

T

V

A

K

E

I

E

L

S

N

P

E

E

N

A

G

A

K

L

I

Q

E

A G T T G C T T C C R A A A C C A A G G A T T G C T ~ A T G G C A C C A C U I C C G C C R C T A T T A T T G C T ~ t C T T T A G T ~ ~ ~ G G ~ C T G C O C ~ C G T C G C1600 CGCC

V

A

S

K

T

K

E

I

A

G

D

G

T

T

T

A

T

I

I

A

Q

A

L

V

R

E

G

L

R

N

V

A

A

~ ~ ~ T G C T M T C C C G T G G C T C T C C G T C O G G G C A T C G A A A A A G T T A C U I C T T T C C T C G T T C ~ G A T T G A G G C T G T ~ T ~ C C C G T ~ ~ ~ ~ T T C M ~ C G1700 A

G

A

N

P

V

R

L

R

R

G

I

E

K

V

T

T

F

TCGCCCMGTGGCCACCGTATCCTCCGGTACGAATCCCGAACGT A Q V A T V S S G T N P E V G

L

V

Q

E

I

E

A

V

A

K

P

V

E

G

S

A

I

A

M

D

K

V

T

K

D

G

V

I

T

V

1800 A

M

I

A

D

~~~AGGAGTCCATCCCTCAACRCCG~TTGG~GTGGTGG~GGGAT~CAGATCGACCOGGGCTATATTTCTCCCTACTT~TCACCGATAGC~TCGC

E

E

S

K

S

L

N

T

E

L

E

V

V

E

G

K

Q

I

D

R

G

Y

I

S

P

Y

F

I

T

D

S

D

1900

R

UIGTTGG~CAGTTTGATMTCCTTTAATCCTCATUICCGAT~TUIGT~CTTGC~TTGGTTCCCGTACTGG~GCTGTGGCCC~CG

Q

L

V

E

f

D

N

P

L

l

L

I

T

D

K

K

I

S

A

I

A

E

L

V

P

V

L

E

A

V

A

2000

R

A

G

GTCGTCCCCTGTTIUTCTTGCGGAAGACATT~GGCATAG~~CCCTT~CTACCCTAGTGGTC~TAOCCC~TGTACTC~CGTGGCCGCCTT~ 2100

R

P

L

L

I

I

A

E

D

I

E

G

E

A

L

A

T

L

V

V

N

K

A

R

G

V

L

N

V

A

A

I

K

A~CCCCCTTTM~CGATCGGCGTAGCTGTGTTGC~GATATCGCTATCCTCACCGGTGGTAGCGTCATTTCCG~GA~TTGGCTCTGAGCCTCGACACC 2200

A

P

f

G

D

R

R

K

A

V

L

Q

D

l

A

S

L

T

G

G

S

V

I

S

E

D

I

G

L

S

L

D

T

G T C A O C T T f f i A T C A h T T G C M G C C G T T A G C C A C T T r ~ ~ G A ~ C A C C A T C C T C G T C G C T G G ~ C C R ~ C G G C G T T C C G C T f f i A G T C2300 A

V

S

L

D

Q

L

G

Q

A

V

K

A

T

L

E

K

D

N

T

I

L

V

A

G

A

H

K

R

R

S

A

G

V

K

M G A O C G G A T T G A G C A G T T G C G G R A A G M T A T G C T G C T T C T G A T T C C G A T T A C G A ~ G ~ T C C ~ G A G C G C A T T G C C ~ C T n G C C G G T G G T2G4T0 0

E

R

A

I

G

A

C

V

E T

I

Q G

K

G

G

T

A

G

I

V

P

L T

V T

R G

G

T

G

K A

A

G

G

E T

A

T

T

T

G

Y T

E

C

T

A A

T

A h

T

S A

E

D G

L

S T

K

C

C

G

G

T

L

I

R

L

A

D C

D

G

Y G

R

G

G

K

T

K

G

D

E

K

I

Q

C

G

C

~

C

L

R

I

E

D

A

G

I

K

G

E

T

A

S

C

F

K

E f

R

I

A

K

L

A

G

i

A

C

C

G

A

A

f

L

N

C

C

T

A

A

Q

L

S

A

A

T

T

N

K

T

D

A

C

E

A

G

E

T

R

V T

V

G

V

C

T

E

E

I

h

C

A

A

C 2500

G

2600

D

ACATCATCGCCAGCCCTGGRAGCTCCCCTGCACCAGTTGGCCAGC~TGCTGGGGTAGAGGGTTCCGTCATTGTGG~GTT~G~GCTACTGG 2700

I

I

A

K

A

L

E

A

P

L

H

Q

L

A

S

N

A

G

V

E

G

S

V

I

V

E

K

V

K

E

A

T

G

U U L T C l V L G G T T A C A A C G T C T C A C T ~ T T G ~ G A C C T G A T A G C C t C T G G C A T C A T C G A C C C C G C T A G T G G T A C G T T C T G C T C T G C ~ T G C C 2800

N

Q

G

Y

N

V

I

T

G

K

I

E

D

L

I

A

A

G

I

I

D

P

A

K

V

V

R

S

A

L

Q

N

A

GCTTCCATTGCTOGGATGGTGTTGACCRCTG~GCTTTAGTAGTGG~CCT~CCT~TCCTCCC~TATGCCCGATAT~T~T ~CGG~ 2900

A

S

I

A

G

H

V

L

T

T

E

A

L

V

V

E

K

P

E

P

A

P

P

A

M

P

D

~

G

G

M

G

G

T G G G T G G T A T G G G C G G C A T G G G C A T G A T G T R A T C G T Z C C C T T T T

G

G

M

G

G

M

G

M

M

ORF60-5 protein seems to be a member of the family of peripheral proteins involved in metabolite transport. Since the amino acid conservation between ORF60-5 andother proteins(Table 111) is limited, it is possible that protein encoded by ORF60-5 belongs to a transport system not yet characterized at a sequence level. The number of cpn60 genes in the genome of Synechocystis sp. PCC 6803 was determined by genomic Southern analysis in which the blot was probed with labeled fragments specific for cpn60 genes (Fig.4).There were major DNA fragments of expected sizes hybridizing with this probe in each lane, demonstrating that there is no other gene in the genome that is highly homologous to the gene that has been cloned in this study. There is, however, one weakly hybridizing fragment in each lane (Fig. 4). Molecular cloning and partial sequencing

M 3000

*

of this fragment revealed that the weak homology observed in Southern analysis is not significant at thelevel of deduced amino acid sequence (data not shown). Molecular Cloning and Characterization of dnuK Gene of Synechocystis sp. PCC 6803-A number of genes homologous to d m K gene of E. coli have been cloned and sequenced (24). Three highly conserved regions of hsp70 proteins were chosen for designing oligonucleotide probes (Table I). They were labeled by phosphorylation with [y-32P]ATPand used to screen a genomic library of Synechocystis sp. PCC 6803 (25). A clone containing aBarnHI fragment was foundto hybridize with these oligonucleotide probes in dot blot and Southern analysis. A 1.18-kilobase EcoRI fragment of this clone was sequenced and was found to contain an open reading frame homologous to thecarboxyl-terminal region of hsp70 proteins.

UgPC

Cyanobacterial Genes

Encoding Molecular Chaperones

61

TABLE I1 Homo1og.v among some chaperonin-60 proteins Homology" Organism

Ref.

Protein

1

3

2

6

5

4

7

X identity/% similarity This paper Synechocystis sp. PCC 6803 cpn6O 3 E. coli groEL 56/77 38 65-kDa antigen 58/75 59/76 Mycobacterium tuberculosis 3 rsbah 56/74 47/71 49/71 Triticum 3 Ricinus rsbab 51/75 50/70 53/73 85/93 4 hsp60 50/70 54/72 48/69 43/66 46/68 Saccharomycescerevisiue 39 P1 protein 47/68 51/70 47/66 43/66 47/68 56/73 Homo sapiens 40 P1 Drotein 47/68 51/70 47/66 43/66 47/68 56/73 97/98 Chinese hamster 'Homology between two proteins is expressed as percent identity (proportion of identical residues shared by two protein sequences that have been optimally aligned) and percent similarity (proportion of identical residues and conserved amino acid replacements shared by two protein sequences when optimally aligned). Subunit (Y of Rbu-P, carboxylase-binding protein.

OW60-5

..QGbTFGLLG?NGAGKTTLLKILLGVIRASGG..

..YSKGMLQRVGMAQUIN

DPEWLDEPMSGLDPW..

no&

..AGECIGLLGPNGAGKSTITRMILGHTSPSVG..

..LSGGHKRRLTLAGUIN

DPQLLILDEPTTGLDPH..

cysA

..TGSLVUtCPSGSGKSTLIAGLEQPDSG..

..LSGQRQRVALARALAV

QPQVLLLDEPFGALDAK..

U9PC

..DGVFIVMrGPSGCGXST~GLERVl'EG..

..LSCGORQRVAMGXAIVR

DPAVFLTDEPLSNLDAK..

pstB

. . K N Q V T A F I G P S G C G K S T L ~ ~ L ~ E..LSGG99QRLCIXRGIAI ..

btuD

. . A G E I L H L V G P N G A G K S T L ~ ~ T S G K G S . . ..LSGGbWQR~WLQITPQANPAGQLLLLDEPHSLLDV..

Consensus

m...ll$iPnGaGKSILLU...Gme ....G

RPEVLLLDEPCSALDPI..

LSGGq.QRv..kal..

dPqylI'uEP.3.LDp

FIG. 3. Regions of homology among the deduced amino acid sequences of the prokaryotic proteins involved in metabolite transport and of ORF60-5 from Synechocystis sp. PCC 6803. Sources of sequences included in this figure are given in Table 111. The residues that have been proposed to be involved in ATP binding are underlined in the consensus sequence (35).

TABLE 111 Homology among some proteins involved in metabolite transport Homology"

Ref.

Organism

Synechovstis SP. PCC 6803 ORF60-5 Rhizobium leguminosarum nod1 A. nidulans cysA E. coli E. coli pstB E. coli btuD 'See footnote a to Table 11.

acidsamino 354 312 345 357 258 250

3

2

1

5

4

% identity/% similarity

29/53 26/52 27/53 24/47 25/49

30/53 27/50 26/47 31/51

39/62 32/55 30152

33/57 27/52

26/47

This paper 35 21 36 22 37

An adjacent, overlapping, 2.04-kilobase XbaI fragment was later sequenced. The 3,770-bp regionsequenced in this study contains three major open reading frames (Fig. 5). ORF70-5 is at least 300 amino acids in length and continues into the upstream region. ORF70-3 is more than 191 residues in length. Comparison of the amino acid sequences deduced from these reading frames with those in GenBank revealed that they are not similar to any protein sequence in the data base. The third reading frame codes for a polypeptide that is 636 amino acids in length, with an acidic isoelectric point of 4.6 and a 67,620-Da molecular mass (Fig. 6). This protein is highly homologousto -

"

e

2: % Z

FIG. 4. Southern blot of genomic DNA of Synechocystis sp. PCC 6803. Genomic DNA (2 pg)was completely digested with EcoRI ( l a n e I ) , BamHI (lane 2), EcoRV (lane 3 ) ,StuI (lane4 ) , Ssp1 (lane 5), NarI ( l a n e 6), or PstI (lane 7). The digested DNAwas electrophoresed on a 0.7% agarose gel, transferred to Genescreen Plus nylon membrane, and hybridized with labeled probes specific for cpn60.

.... ....

I

966+

ORF70-5

1W hp

-

"

I"

e xa 2 x

i,

I1

?m

;% i)

i I

1911

dnok

1 IIX

s73+

..... .....

ORF70-3

FIG. 5. Restriction map of the genomic region containing dnuK of Synechocystis sp. PCC 6803. The open reading frames are shown byboxes; those on the top of the line are in a forward direction. Their lengths and thedistances between them are indicated below the line.

62

Cyanobacterial Genes Encoding Molecular Chaperones GTGTGRRCGTGTCGG~T~~~ATTGGARCCATGGCTTTTCGG~GTGTCTTATATTCTTACTTGTT~CGGGAGTT ~TT~TT 100 ATGGGAAARGTTGTTGGGATTGRCCTCGGTACCTCGGTACTACC~TTCCTGTGTGGCTGT~TGG~GGGGG~~CCCACTGTTATC~C~T~~GGTTTTC 200

M

G

K

V

V

G

I

D

L

G

T

T

N

S

C

V

A

V

M

E

G

G

K

P

T

V

I

A

N

A

E

G

F

R 300

G C A C G A C C C C A T C G G T G G T T G G T T A T G C C A A A A A T G G C G A

T

T

P

S

V

V

G

Y

A

K

N

G

D

R

L

V

G

Q

I

A

K

R

Q

A

V

M

N

P

G

N

T

F

Y

T T C T G T C A R A C G A T T C A T T G G T C G T A A A T T T T G A T G A A A T G G C C A A T T A C C ~ T G ~ G C C A C C G ~ G T T G C C T A C A G C G T A G T T A A A T G G4C0C0A A G A C ~ ~ C G ~ ~ T G T S V K R F I G R K F D E I T N E A T E V A Y S V V K D G N G N V K C T A G R T T G C C C A G C C C A R G G A A A R C A G T T T G C C C C G G ~ G ~ T T T C T G C C C ~ G T ~ T G C G G ~ T T G G T ~ C G A T ~ C A G ~ G T A C C T A500 ~AGA L D C P A Q G K Q F A P E E I S A Q V L R K L V D D A S K Y L G E T C C G T T A C C C A A G C C G T C A T C A C C G T T C C T G C C T A C Z T T A C T T T ~ C G A C T C C ~ C G G ~ G C ~ C C ~ G A T G C G G G T ~ T C G C C G G G A T C G ~ G T C600 CTGAG

V

T

Q

A

V

I

T

V

P

A

Y

F

N

D

S

Q

R

Q

A

T

K

D

A

G

K

I

A

G

I

E

V

L

R

AATTATTAACGAGCCCACCGCTGCCTCCCTAGCCTACGGTCTGGATAAAAAG~T~CG~CCATTCTGGTGTTTGACCTA~GGTACTTTTGAC 700 I I N E P T A A S L A Y G L D K K D N E T I L V F D L G G G T F D

G T C T C C A T C C T C G A R G T A G G G G A R G G G G T A T T T G A A G T A T T A G C C A C C T C T ~ G A T A C C C A T C T G ~ ~ A C G A C T T C G A ~ T T G T C G A 000 TT V S I L E V G E G V F E V L A T S G D T H L G G D D F D K K I V D F

FIG.6. Nucleotide and deduced amino acid sequences of a portion of the gen;omic region shown in Fig. 1 containing dnaK of Synechocystis sp. PCC 6803. Regions similar t o the consensus sequence of -10 region of heat shockpromoters of E. coli are u d e r lined.

T C C T G G C C G G T G A A T T C C A G ~ G G C C G A G G G C A T C G A C C T C C G T ~ G G A T ~ ~ G C T C ~ A C ~ C G G T T A A C C G ~ G C ~ C 900 G~GC~~CGA L A G E F Q K A E G I D L R K D K Q A L Q R L T E A A E K A K I E A C T T T C C G G C G T G A G C C A A A C G G A M T T A A C C T G C C T G C C C T T ~ T C A C T G C C A C C C A G G A T G G G C C T ~ ~ T C T A ~ ~ C ~ C C C T G T C C C ~1000 ~GTTT L S G v 5 Q T E I N L P F I T A T Q D G P K H L D T T L S R A K F G A R G A A A T T T G C T C C G A C C T G A T T G A T C G T T G T G G T A T T C C C G T G G A A A R T ~ C A T T C G G G A T G C C ~ T C ~ T ~ T C T ~ C C T ~ T G ~ T 1100 CG~TC E E I C S D L I D R C G I P V E N A I R D A K I D K S A L D E I V L T T G T T G G C G G T T C C A C C C G G A T T C C C G C C G T G C A A G A A G T G G T A A A T G G C C A A G ~ T T C T T ~ C ~ G A T C C C ~ C C ~ G G A G T T ~ C C C C1200 GATG~GTAGT~

v

G

s

G

I P

R

T

v

A

Q

v v

E

L

I

K

K

K

G

D

Q

N

P

v

G

N

D

P

v v

E

A

c G T c G G A G c T G c T A T c c A R G G G G G T G T A C T T T C T G G G G R A

V

G

A

A

I

Q

G

G

V

L

S

G

E

V

K

D

I

L

L

L

D

V

S

P

L

S

L

G

V

E

T

L

1300

G

1400 GGCGTCATGACCAAARTCATTCCCCGCRRCACCACCATCCCCACC~TCTG~CCTTCTCCACCGCTGTG~CGGT~GC~CGTGGAAATGGCCAATCC G

V

M

T

K

I

I

P

R

N

T

T

I

P

T

K

K

S

E

T

F

S

T

A

V

D

G

Q

S

N

V

E

I

H

A T G T G C T C C A A G G G G A A C G G G A A A T G G C C A A T G G C C ~ T G A C ~ T ~ G A G C T T G G G ~ C C T T C C G C T T A ~ T G G T A T C C C C C C T G C T C C C C ~ G T A C C1500 T~T V L Q G E R E M A N D N K S L G T F R L D G I P P A P R G V P Q I C G A R G T T A C T T T C G A T A T T G A T G C C R A C G G T A T T T T G A A T T T C C

E

V

T

F

D

I

D

A

N

G

I

L

N

V

T

A

K

D

R

G

T

G

K

E

Q

S

I

S

I

T

G

A

1600

S

A C C C T G C C T G A T A C G G A A G T A G A C C f f i A T G G T G R A G G A A G

T

L

P

D

T

E

V

D

R

H

V

K

E

A

E

S

N

A

A

A

D

K

E

R

R

E

K

I

D

R

K

N

Q

1700

A

C G G A T T C C C T C G T T T A C C A R G C G G A R A A A C R R A T C A C C G A G T T ~ C G A T ~ G T G C C C G C C ~ T G A T ~ T C A A A T G G C C A A ~ G G ~ ~ T T T ~1800 T~~CCT

D G

S

L

R

G

R

K

E

A

V

Y

G

A

V

A

Q A

A

E

C

T

G

Q

E

D

K

Q

G

T

D

A

I A

T

G

K

C

I

E

L

C

~

G

T

V

Q

G

D G

M

K A

V

P

G

A

R

P

E

A T

L

A G

Q

D A

Q

T

V

K

I

G

C

L

Y

K

A

C

A

S

I

E A

G

L

A

T

C

N

M

A

G

S

I

K C

D A

Y

L

C

Q

A

G 1900

Q

G C T G G A G C A G A G G C T G G G G T A G G C G C T C C C G G T G C T G G C C zoo0 A G A E A G V G A P G A G P E A G T S S G G G D D V I D A E F S E P C

G

E

G

K

A

~

T

A

G

G

T

C

T

G

G

G

T

T

T

T

A

A

A

A

C

C

T

G

T

A

T

T

G

A

R

A

G

T

T

T 2100

*

the hsp7O proteins of eukaryotes and dnaK proteinof E. coli. Accordingly, this genewas designated as dnaK. Table IV shows amino acid sequence identity and similarity values for hsp7O homologues from Synechocystis sp. PCC 6803, E. coli, maize, petunia, and a consensus sequence derived for hsp70 proteins. The products of dnaK of Synechocystis sp. PCC 6803 and E. coli are remarkably conserved (57% identity) and are slightly less homologous to hsp70 proteins of higher plants (46-49% identity). In Southern analysis, genomic DNA of Synechocystis sp. PCC 6803 was digested to completion with different. restriction endonucleases and separated on 0.7% agarose gel. After transfer to nylon membrane, the DNA was probed with labeled fragments specific for dnaK genes (Fig. 7). In each lane, DNA fragments of expected sizes hybridized with this probe, demonstrating that there isa single dnaK gene in the genome of Synechocystis sp. PCC 6803. Expression of cpn60 and dmK-In Northern analysis, an RNA species of 2.0 kilobases hybridized with the radioactive probe specific for cpn60 (Fig. 8). Considering the sizes of coding regions of cpn60 (1659 bp) andthe neighboring reading frames (984 and 738 bp), it is unlikely that the major transcript species for cpn60 is polycistronic. The radioactive probe for dnaK mainly hybridized with a RNA species about 2.2 kilobases in length (Fig. 8). The coding region of dnaK is 1911 bp in length. Therefore, the major RNA species for dnaK is monocistronic. Another band, longer in size, wasalso observed in Northern analysis. The probe hybridized to this RNA species couldnot be washed awayby high stringency washing (80 "C, 40mM sodium phosphate, 0.5% sodium dodecyl sul-

fate, 0.05% bovineserum albumin). The presence of two RNA species raises two possibilities. First,there could be two different promoters and/or terminators,thus transcribing two RNA species. Second, the RNA is originally transcribed as a polycistronic message and then rapidly processed. A computer-assisted search for potential factor-independent prokaryotic transcriptional terminator sites (26) in the sequence of the region shown in Fig. 6 revealed a sequence 59 bp downstream from the stop codon of dnaK that has a stretch of thymine residues and a preceding dyad symmetry and can act as a strong transcriptional terminator. However, there was no such site in the 5"flanking region of the dnaK gene, suggesting that the longer transcripts seen in Northern blot are derived from the promoter of ORF70-5. The upstream regions of both cpn60 and d m K genes contain sequences similar to the consensus sequences of heat shock promoters of E. coli (33). A sequence (CCCCATTTA) found 144bp upstream from the startof the cpn60 region is identica1to the consensus -10 region of heat shock promoters of E. coli (CCCCATtTa) (Fig. 2). Similar but less conserved sequences (CCCATCGE and CCCCAGGCA) are also present 50 and 84 bp upstream from the initiation ATG of dnaK of Synechocystis sp. PCC 6803 (Fig. 6). Sequences similar to the consensus for the -35 region of heat shock promoters of E. coli (TNtCNCcCTTGAA) are not observed in the upstream regions of cpn60 and dnaKgenes of Synechocystis sp. PCC 6803. Accordingly, the mechanism of heat shock induction in Synechocystis sp. PCC 6803 may be similar but not indentical to that in E. coli. Efiect of Heat Shock and Other Stress Conditions on Tran-

Cyanobacterial Genes

Molecular Encoding Chaperones

63

TABLE IV Homology among some dnaK homologues Homology"

Protein

Organism

2

1

Ref. 3

4

% identity/% similarity

Synechocystis sp.This PCC 6803 dnaK E.coli dnaK Petunia hsp70R protein Zea mays hsp70-2 protein Consensus See footnote a to Table 11.

57/75 49/68 47/66 51/67

49/67 46/64 55/67

89/92 75/82

paper 41 42 43 44

71/78

-

100

rpnm

23130 6557 4361

I

FIG.7. Southern blot of genomic DNA of Synechocystis sp. PCC 6803. Genomic DNA (2 pg) was completely digested with EcoRI (lane I ) , BamHI (lane 2), Hind111 (lane 3 ) , SmaI (lane 4 ) , NcoI (lane 5),or AuaI (lane 6 ) . The digested DNA was electrophoresed on a 0.7% agarose gel, transferred to a Genescreen Plus nylon membrane, and hybridized with labeled probes specific for d m K . con 60

dna K 20 42 41

P= 20 42 41 IC temp.

.

t 0

l

l

.

60

'

"

120

.

'

.

180

'

.

s

240

1

' 300

Time (min)

FIG.9. Expression of cpn6O and dnaK under heat shock conditions. The transcript levels of cpn60, d m K , psaD, and 23 S RNA were quantitated by slot blot analysis of total RNA obtained from cells a t different times after shifting the cultures grown a t 20 "C to 42 "C.

tem I, a sharp single band was observed in each lane (Fig. 8). Thus, degradation was characteristic of cpn60 and dnaK transcripts anddid not reflect on the overall quality of RNA. The quantitations of levels of specific RNA species were performed by slot blot analysis. Fig. 9 shows levels of cpn60 and dnaK RNAs at different time intervals after transferring cells of Synechocystis sp. PCC 6803 to 42 "C. It took approximately 10 min for the temperature of the culture to rise from 20 to 42 "C, and by that time the level of cpn60 RNA had already increased by 8-fold. The maximal level (30 times that of control RNA) was reached after 90 min at 42 "C. Then the proportion of cpn60 tranFIG.8. Northern analysis of total RNA isolated from cul- scripts decreased gradually during the next couple of hours tures of Synechocystis sp. PCC 6803 under different heat (Fig. 9). Heat shock also resulted in elevated amounts of dnaK shock conditions. 5 pgof total RNA was electrophorsed in 1% transcripts. The relative increase of dnaK RNA was 25-fold agarose gel containing formaldehyde, transferred to a Genescreen nylon membrane, and hybridized with probes specific to cpn60, d m K , after 90 min at 42 "C. The levels of dnuK RNA then declined or psaD. Lanes containing RNA from cultures grown a t 20 "C were rapidly and reached basal level in the next 90 min. This sharp exposed twice as long to x-ray film as those with RNA from cultures decrease is consistent with the extensive degradation of dnaK that had been subjected to heat shock. RNA observed in the Northern analysis (Fig. 8). Levels of message for psaD, a representative of nonchaperone genes, script Levels of cpn60 and dnaK Genes-Cells of Synechocystis were measured during this experiment and were found to sp. PCC 6803 were grown at 20 "C with constant aeration. decrease immediately following the heat shock (Fig. 9). This They were subjected to heat shock by transferring them to a RNA species came back to normal levels after 5 h at the water bath maintained at higher temperatures. Total RNA elevated temperature. The levels of 23 S RNA in the total isolated from these cells was used for Northern analysis (Fig. RNAs remained unchanged during heat shock. In addition to elevated temperature, several other stress 8).Heat shock at 42 or 47 "Cresulted in highly elevated levels of RNA for cpn60 as well as dnaK. However, extensive deg- conditions are also known to induce expression of dnaK and radation of these transcripts was evident from the smear groESL of E. coli (27). We tested four stress conditions, observed in these blots. When the same filter was reprobed namely ethanol, nalidixic acid, hydrogen peroxide, and ultrawith labeled psaD gene whichencodes subunit I1 of photosys- violet radiation, for their ability to affect levels of transcripts

CyanobacterialGenes Encc?dingMolecular Chaperones

64 100

cpn6O is an exception, as the percentage of identical residues shared by this protein and CY subunit of Rbu-Pz carboxylasednaK binding protein from higher plants is as high as when compared with the cpn6O protein of bacteria. This may reflect a closer evolutionary relationship between cyanobacteria and chloroplasts. The dnaK protein of cyanobacteria, however, is slightly morehomologous to its counterpart from E. coli. Thus, the greater similarity between cpn60 of cyanobacteria and plants may be due to their functional resemblance such as Rbu-Pzcarboxylase binding. Therefore, a more appropriate way to group these sequences would be according to their site of function. The mitochondrial cpn6O from yeast, human, and hamster have higher homologies to each other while the chloroplast-destined Rbu-P2 carboxylase-binding protein of wheat and castorbean, as well as cpn60 of the photosynthetic cyanobacterium, are more similar to each other. 1 5 10 0.1 0.2 0.5 11 22 110 0.5 There aresome important differences between homologous Ethanol (%) Nalidixic uv (J) Hydrogen chaperones of Synechocystis sp. PCC 6803 and E. coli. First, acid (mM) peroxide (mM) the organization of genes in the genome is different. The FIG. 10. Expression of cpn6O and dnaK under various stress conditions. Changes in the levels of RNA transcribed from cpn60, genes from E. coli exist in operons andare expressed as d m K , and psaD and of 23 S RNA in cells of Synechocystis sp. PCC bicistronic RNAs. The groES gene is present 43 bp upstream of groEL, while the d n d gene is located 88 bp downstream of 6803 under various stress conditions were quantitated by slot blot analysis of total RNA. The cells were incubated with ethanol, nali- dnaK. In contrast, the neighboring regions of cpn60 or dnaK dixic acid, or hydrogen peroxide for 30 min or were exposed to 0.5 J genes in Synechocystis sp.PCC 6803 donot contain groES or of ultraviolet light, dnaJ genes, respectively. Northern blots shown in Fig. 8 strongly suggest that themajor RNA species for each gene is for cpn60, dnaK, and psaD in Synechocystis sp. PCC 6803 monocistronic. Second, the effects of various stress conditions (Fig. 10). These agents were added to the culture growing at of these genes are not the same in Synechocystis on expression 20 "C and incubated at the same temperature for 30 min. sp. PCC 6803 and in E. coli. For example, hydrogen peroxide Ultraviolet irradiation was administered to 100 ml of cells in groEL protein in E. coli (27) but does not induce synthesis of an open glass dish (20-cm diameter) in UV Sratalinker 1800 (Stratagene, CA). After the treatments, the cells were har- results in elevated levels of cpn60 transcripts in Synechocystis vested and RNA was extracted. Ethanol increased levels of sp. PCC6803(Fig. 10). These differences could be better RNA for cpn60 and dnaK, as well as psaD, to varying degrees. understood by identifying and characterizing promoters asIn contrast, the other reagents tested resulted in elvated levels sociated with cpn60 and dnaKof Synechocystis sp. PCC6803. The results presented in this paperprovide one of the first of RNA for cpn60 and dnaK but notfor psaD. Moreover, the levels of psaD transcripts decreased by as much as 50%. On examples of inducing expression of specific cyanobacterial an average, these stress conditions had less effect on the levels genes by stress conditions. The effect of heat shock on protein of cpn60 RNA (maximum increase of 17 times) than those of synthesis inthe cyanobacterium Synechococcus sp. PCC 6301 dnaK RNA (maximum increase of 25 times). Both cpn60 and has been previously demonstrated (34). Upon heat shock, the dnaK genes were induced less by nalidixic acid than by the growth rate of cells decreases and certain proteins are prefother reagents. The proportion of 23 S RNA in the total RNA erentially synthesized. The molecular characterization of these events has not yet been unraveled. Figs. 8, 9, and 10 remained approximately the same in all treatments. clearly demonstrate induction of cpn60 and dnuK of Synechocystis sp. PCC 6803 as aresponse to various stress conditions. DISCUSSION Cyanobacteria have photosynthetic processes that arefunc- Similar patternsof induction of these genes and theexistence tionally and structurally similar to those in chloroplasts of of sequences homologous to the consensus sequence of the higher plants. On account of their smaller and simpler genome heat shock promoters of E. coli in the upstream regions of and their capacity for homologous recombination following both of these genes suggest that dnaK andcpn60 are part of natural transformation, theseorganisms, especially Synecho- a regulon. A rise in temperature resultsin a huge but transient cystis sp. PCC 6803, have been used extensively for mutational increase in the transcription of these genes (Fig. 9). After 2 analysis of photosynthetic processes (25, 28-31). In light of h, the amount of RNA specific to these genes decreases to the phylogenetic relationship (23) and functional resemblance prestress levels, apparently due to massive and specific deg(32) of cyanobacteria to chloroplasts of higher plants, it radation of dnuK and cpn60 transcripts as well as a rapid of synthesis. The transient nature of heat appears that the mechanisms of assembling their photosyn- decline in their rate thetic complexes should be similar. Accordingly, we initiated shock response correlates with the growth pattern of the a project of cloning and characterizing genes of Synechocystis bacteria under stress conditions. The growth of Synechocystis sp. PCC 6803 that encode proteins involved in assembly and sp. PCC 6803 stops immediately following a heat shock and translocation of other proteins. In this paper, we report the is resumed after about 6-8 h of lag period (data not shown). Similar trends in expression have been observed in other cloning of two molecular chaperones. The deduced amino acid sequences of the cpn60 and dnaK organisms (8, 24). It has been suggested that the heat shock proteins of Synechocystis sp. PCC 6803 are remarkably con- response in most organisms is transient at moderate temperserved when compared with the corresponding proteins from atures while sustained at higher temperatures (24). In Synother bacteria or eukaryotes (Tables I1 and IV). The cpn6O echocystis sp. PCC 6803, the response is transient when cells sequences compared in Table I1 can be classified into various are shifted to 42 or 47 "C. The promoters of dnaK and cpn60 groups. The bacterial cpn60 proteins are more homologousto can be used to transiently express other genes at a very high each other than to eukaryotic proteins. The cyanobacterial level. A 200-bp region upstream of dnaK gene has been found

8

cpn60

Cyanobacterial Molecular Chaperones Encoding Genes

65

Acad. Sci. U. S. A . 7 4 , 5463-5467 to impart heat shock-inducible expression to a “promoterless” geneencodingchloramphenicolacetyltransferase.*Further 19* Devereux, J., Haeberli, P., and Smithies, 0.(1984) Nucleic Acids Res. 12,387-395 characterizationof the promoters of both dnaK and cpn60 is 20. Golden, S. S., Brusslan, J., and Haselkorn, R. (1987) Methods in progress so that expression of specific genes can be precisely Enzymol. 153, 215-231 modulated through changes environmental in cues. 21. Cozens, A. L., and Walker, J. E. (1987) J. Mol. Biol. 194, 359Acknowledgments-We thank Dr. David Purvis for critically reading the manuscript, Dr. Carl Weitzmann for providing a probe for 23 S RNA, and Vaishali Parag Chitnis for technical help.

REFERENCES 1. Ellis, R. J. (1987) Nature 328,378-379 2. Ellis, R. J. (1990) Semin. Cell Biol. 1, 1-9 3. Hemmingsen, S. M., Woolford, C., van der Vies, S. M., Tilly, K., Dennis, D. T., Georgopoulos, C. P., Hendrix, R. W., and Ellis, R. J. (1988) Nature 333,330-334 4. Reading, D. S., Hallberg, R. L., and Myers, A. M. (1989) Nature 337,655-659 5. Goloubinoff, P., Christeller, J. T., Gatenby, A.A., and Lorimer, G. H. (1989) Nature 3 4 2 , 884-889 6. Van Dyk, T. K., Gatenby, A.A., and LaRossa, R.A. (1989) Nature 342,451-453 7. Ellis, R. J., and van der Vies, S. M. (1988) Photosynth. Res. 16, 101-115 8. Lindquist, S., and Craig, E. A. (1989) Annu. Rev. Genet. 22,631677 9. Deshaies, R. J., Koch, B. D., Werner-Washburne, M., Craig, E. A., and Schekman, R. (1988) Nature 332,800-805 10. Chirico, W. J., Waters, M. G., and Blobel, G. (1988) Nature 332, 805-810 11. Leustek, T., Dalie, B., Amir-Shapira, D., Brot, N., and Weissbach, H. (1989) Proc. Natl. Acad. Sci. U. S. A . 86,7805-7808 12. Craig, E. A., Kramer, J., Shilling, S., Werner-Washburne, M., Holmes, S., Kosic-Smithers, J., and Nicolet, C . M. (1989) Mol. Cell. Biol. 9, 3000-3008 13. Amir-Shapira, D., Leustek, T., Dalie, B., Weissbach, H., and Brot, N. (1990) Proc. Natl. Acad. Sci. U. S. A . 8 7 , 1749-1752 14. Marshall, J. S., DeRocher, A. E., Keegstra, K., and Vierling, E. (1990) Proc. Natl. Acad. Sci. U. S. A . 87,374-378 15. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular Cloning:A Laboratory Manual,Cold Spring HarborLaboratory, Cold Spring Harbor, NY 16. Southern, E. M. (1975) J. Mol. Biol. 98,503-517 17. Henikoff, S. (1984) Gene (Amst.) 2 8 , 351-359 18. Sanger, F., Nicklen, S., and Coulson, A.R. (1977) Proc. Natl.

P. R. Chitnis and N. Nelson, unpublished results.

383 22. Green, L. S., Laudenbach, D. E., and Grossman, A.R. (1989) Proc. Natl. Acad. Sci. U. S. A . 8 6 , 1949-1953 23. Surin, B. P., Rosenherg, H., and Cox, G. B. (1985) J. Bacteriol. 161,189-198 24. Lindquist, S. (1986) Annu. Rev. Biochem. 5 5 , 1151-1191 25. Chitnis, P. R., Reilly, P. A., Miedel, M. C., and Nelson, N. (1989) J.Bwl. Chem. 2 6 4 , 18374-18380 26. Brendel, V., and Trifonov, E. N. (1984) Nucleic Acids Res. 1 2 , 4411-4427 27. Van Bogelen, R. A., Kelley, P. M., and Neidhardt, F. C. (1987) J. Bacteriol. 1 6 9 , 26-32 28. Chitnis, P. R., Reilly, P. A., and Nelson, N. (1989) J. Biol. Chem. 264,18381-18385 29. Williams, J. G. K. (1988) Methods Enzymol. 167, 766-778 30. Vermaas, W. F. J., Williams, J. G. K., Rutherford, A. W., Mathis, P., and Arntzen, C. J. (1986) Proc. Natl. Acad. Sci.U. S. A . 8 3 , 9474-9477 31. Debus, R. J., Barry, B.A. Babcock, G. T., and McIntosh, L. (1988) Proc. Natl. Acad. Sci. U. S. A . 8 5 , 427-430 32. Bryant, D. A. (1986) Can. Bull. Fish Aquat. Sci. 214,423-500 33. Cowing, D. W., Bardwell, J. C.A., Craig, E. A., Woolford, C., Hendrix, R. W., and Gross, C. A. (1985) Proc. Natl. Acad. Sci. U. S. A . 82,2679-2683 34. Borbely, G., and Suranyi, G. (1888) Methods Enzymol. 167,622629 35. Evans, I. J., and Downie, J. A. (1986) Gene (Amst.) 43,95-101 36. Overduin, P., Boos, W.,andTommassen, J. (1988) Mol. Microbiol. 2 , 767-775 37. Friedrich, M. J., DeVeaux, L. C., and Kadner, R. J. (1986) J. Bacteriol. 167, 928-934 38. Shinnick, T. M. (1987) J. Bacterwl. 169, 1080-1088 39. Jindal, S., Dudani, A. K., Singh, B., Harley, C. B., and Gupta, R. S. (1989) Mol. Cell. Biol. 9 , 2279-2283 40. Picketts, D., Mayanil, C. S. K., and Gupta, R. S. (1989) J. Bwl. Chem. 264,12001-12008 41. Bardwell, J. C. A., and Craig, E. A. (1984) Proc. Natl. Acad. Sci. U. S. A . 81,848-852 42. Winter, J., Wright, R., Duck, N., Gasser, C., Fraley, R., and Shah, D. (1988) Mol. Gen. Genet. 211,315-319 43. Rochester, D. E., Winer, J. A., and Shah, D. M. (1986) EMBO J. 5,451-458 44. Nicholson, R. C., Williams, D. B., and Moran, L. A. (1990) Proc. Natl. Acad. Sci. U. S. A . 8 7 , 1159-1163

Suggest Documents