Staphylococcus aureus Isolates Recovered from Moscow Clinics ... Moscow clinics and compare various methods of molecular typing (multiplex PCR, SNP ...
ISSN 08914168, Molecular Genetics, Microbiology and Virology, 2010, Vol. 25, No. 2, pp. 66–70. © Allerton Press, Inc., 2010. Original Russian Text © M.V. Afanas’ev, S.V. Karakashev, E.N. Il’ina, AlSalamiA.M. Salem, S.V. Sidorenko, V.M. Govorun, 2010, published in Molekulyarnaya Genetika, Mikrobiologiya i Virusologiya, 2010, No. 2, pp. 20–24.
EXPERIMENTAL WORKS
Molecular Genetic Characterization of MethicillinResistant Staphylococcus aureus Isolates Recovered from Moscow Clinics M. V. Afanas’eva, S. V. Karakasheva, E. N. Il’inaa, AlSalamiA.M. Salemb, S. V. Sidorenkob, and V. M. Govoruna aResearch
Institute for PhysicalChemical Medicine, Ministry of Public Health of Russian Federation, Moscow, Russia b National Research Center for Antibiotics, Moscow, Russia Received November 16, 2009
Abstract—Methicillinresistant Staphylococcus aureus (MRSA) is the causative agent of nosocomial infections observed worldwide. The goal of this work was to study the genetic variations in MRSA isolates recovered from Moscow clinics and compare various methods of molecular typing (multiplex PCR, SNP genotyping based on the determination of singlenucleotide polymorphisms). A total of 62 epidemiologically unrelated hospi talacquired MRSA isolates were studied. A previously described multiplex PCR assay was utilized for the molecular typing of staphylococcal cassette chromosome mec (SCCmec). SNP genotyping that targets the seven sequences in five housekeeping genes (arcC162, arcC210, aroE132, gmk123, tpi241, tpi243, and yqiL333) was employed. Primer extension was used to screen single nucleotide variants followed by matrix assisted laser desorption/ionization mass spectrometry (MALDIMS). Multilocus sequence typing (MLST) was used as a reference assay. Most MRSA isolates (93.6%) were assigned to the clonal complex (CC) 8 dis seminated worldwide. Three MRSA isolates (4.8%) proved to belong to CC1. The following correlation was established in this study between SCCmec cassette types and sequence types (STs): ST8MRSA carried SCCmec type IV and ST239MRSA carried typeIII a SCCmec. Four SNP groups associated with certain SCCmec types were also identified. The developed SNP genotyping assay aided by MALDIMS enables the rapid genotyping of S. aureus isolates according to their clonal types. Key words: MRSA, SCCmec typing, MLST, SNP typing, MALDITOF massspectrometry DOI: 10.3103/S0891416810020035
tion (up to 33.5%) [19]. However, epidemiological investigations for the detection of the target pathogen use primarily microbiological methods that are too laborious to be standardized, timeconsuming and have low sensitivity. Currently applied molecular genetic techniques, such as staphylococcal chromo some cassette mec typing (SCCmec typing), pulsed field gel electrophoresis (PFGE), multilocus sequence typing (MLST), and the typing of the variable tandem repeat region of protein A (spaA typing), do not have wide applications. Although the genetic diversity of hospitalacquired MRSA isolates has recently been reported [2], related studies are extremely rare due to the lack of national freeaccess databases that provide information for monitoring the epidemiological situ ation associated with MRSA infections. These data bases could also allow for the development, imple mentation, and evaluation of the efficiency of disease control programs. All these will contribute to pre venting hospital outbreaks of MRSAcaused infec tions. In May 2008, the international MLST database (http://saureus.mlst.net/) only had sequences depos ited only for three S. aureus isolates of Russian origin. The goal of this research was to study the molecular genetic variations among MRSA isolates recovered
Staphylococcus aureus isolates resistant to methicil lin (Methicillinresistant Staphylococcus aureus, MRSA) were first identified in the United Kingdom in 1961 [13] shortly after the introduction of methicillin into clinical practice. MRSA is one of the important causative agents of nosocomial infections, which cause severe adverse events in hospitalized patients; fatalities have also been reported. Nosocomial infec tion rates are increasing despite significant efforts to curb them [5]. The incidence of infections caused by MRSA is ris ing, as is the incidence of multiple drug resistances among MRSA isolates; the most effective strategy for eradicating MRSA is to trace the source of infection in a timely manner and prevent its further spread. As a result, a great deal of attention is devoted to molecular genetictyping techniques of S. aureus. Unlike con ventional microbiological methods, these techniques allow one to not only rapidly detect and evaluate anti biotic resistance, but also to determine the phyloge netic relationships among circulating field isolates [9, 17, 23]. Cases of MRSAinduced nosocomial infections have been frequently reported in the Russian Federa 66
MOLECULAR GENETIC CHARACTERIZATION OF METHICILLINRESISTANT ISOLATES
67
Table 1. Minisequencing primers for identifying singlenucleotide extension products based on mass added to primer Gene
Primer designation
arcC
arcC162F
GAACTGTAGGCACAATCGT, 5837
arcC210F
CACGATTCAATAACCCAAC, 5710
gmk
gmk129R
TGCGTTTGAAGCTTTAAT, 5520
tpi
tpi241R
AATGCACACATTTCATTTG, 5762
tpi243F
CATCAACATCTGAAGATGC, 5781
aroE
aro132F
ATCACAATTCCTCATAAAGA, 6053
yqiL
yqiL333F
GTCAACAACAGTCGCTT, 5155
Primer sequence (5'–3'), molecular weight (D)
from Moscow clinics. SCCmec typing and MLST were used as the techniques best suited for evaluating the molecular epidemiological properties of MRSA iso lates confined to a certain field [10]. Moreover, our research also concerned the assess ment of a new technique that is considered to be a less laborious and more costeffective alternative to MLST, i.e., singlenucleotide polymorphism typing (SNP) of housekeeping genes. MLST and SNP target the same gene fragments of housekeeping genes. Note that the genes are fully sequenced and short loci are internal to the following regions: arcC162, arcC210, aroE132, gmk123, tpi241, tpi243, and yqiL333 that have high discriminatory power [18]. Minisequencing followed by a matrixassisted laser des orption/ionization mass spectrometry (MALDI MS) detection system were used to detect single nucleotide
Minisequencing primers and their calculated molecular weight, D Primer + ddA Primer + ddC Primer + ddT Primer + ddG Primer + ddA Primer + ddC Primer + ddT Primer + ddG Primer + ddA Primer + ddC Primer + ddT Primer + ddG Primer + ddA Primer + ddC Primer + ddT Primer + ddG Primer + ddA Primer + ddC Primer + ddT Primer + ddG Primer + ddA Primer + ddC Primer + ddT Primer + ddG Primer + ddA Primer + ddC Primer + ddT Primer + ddG
6134 6110 6125 6150 6007 5983 5998 6023 5817 5793 5808 5833 6059 6035 6050 6075 6078 6054 6069 6094 6350 6326 6341 6366 5452 5428 5443 5468
polymorphisms in the obtained amplicons. SNP genotyping involves the extension of a primer immedi ately adjacent to the polymorphic site. Subsequent MALDI MS analysis permits us to identify singlenucle otide variants at the polymorphic position (Table 1). Our laboratory recently applied this procedure for geno typing the hepatitis C virus and identifying mutations in N. gonorrhoeae and M. tuberculosis that render these bacteria resistant to antibiotics [4, 12, 20]. MATERIALS AND METHODS Isolates. The study used 62 MRSA isolates recovered from surgery patients in 2002–2006. The isolation, identification, and evaluation of susceptibility to methicillin were performed using the previously described procedures [1, 3]. Strains S. aureus
MOLECULAR GENETICS, MICROBIOLOGY AND VIROLOGY
Vol. 25
No. 2
2010
68
AFANAS’EV et al.
Table 2. Resluts of SCCmec typing, SNP genotyping, and MLST Number type of isolates, % of SCCmec
SNP profile
MLST
51 (82.3)
IV
TATGTAC
ST8
3 (4.8)
IV
CATGCAC
ST1
1 (1.6)
mecA
CATGTAT
ST641
7 (11.3)
IIIa
TAAGTAC
ST239
ATCC43001 and S. aureus ATCC33591 were included as controls. DNA extraction. A Politub extraction kit was used to isolate S. aureus DNA (TU93984101725356797) (OOO NPF Litech, Russia) according to the manu facturer’s recommendations. SCCmec typing. The previously described multi plex PCR assay was used to identify SCCmec types [17]. MLST. MLST was conducted as described by M. Enright et al [9]. The Sanger method for DNA sequencing with modifications was used to sequence amplicons using ABI Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit and ABI Prism 3100 Genetic Analyzer (Applied Biosystems, United States; Hitachi, Japan) according to the manufac turer’s instructions. SNP genotyping. Primer extension reaction. Primer extension reaction as well as MLST used the same PCR products. To produce amplicons, the same primer sets and amplification conditions were applied as described below [9]. Five microliters of a mixture containing 10 mM trisHCl, pH 9.0, 50 mM KC1, 2 mM MgCl2, and 1 unit of shrimp alkaline phos phatase (Fermentas, Lithuania) were added to the reaction volume to remove 5'phosphate groups from NTPs after amplification. The resulting mixture was incubated for 20 min at 37°C, after which it was heated for 10 min at 85°C to inactivate the enzyme. Single nucleotide polymorphisms were identified in a primer extension, adding the obtained amplicons to a reac tion mixture containing 10 mM trisHCl pH 9.0, 50 mM KCl, 2 mM MgCl2, 0.2 mM of each dNTP, 20 pmol of each primer and 2 units of DNA poly merase TermiPol (Solis Biodyne, Estonia). The total volume was 10µl. The reaction was conducted in a thermal cycler DNA Engine Tetrad 2 (MJ Research, United States) under the following conditions: 70 cycles at 94°C for 20 s, 54°C for 20 s, 72°C for 20 s (for the arcC, gmk, and tpi genes) and 70 cycles at 94°C
for 20 s, 50°C for 20 s, 72°C for 20 s (for the aroE and yqiL genes). Purification of primerextension products was car ried out using ionexchange resin Clean Resin included in SpectroCLEAN Kit (Sequenom, United States). Eight milligrams of ionexchange resin was dissolved in 15µl of ultrapure water (Merck, Ger many). This suspension was mixed with purified primer extension products in a test tube, thoroughly shaken, and incubated at room temperature for 60 min. The eluant was centrifuged at 1000 rpm for 5 min. The supernatant was analyzed using mass spec trometry as previously described [4]. Peaks in mass spectra of primer extension products representing the molecular weight of ions of interest are used to identify the incorporated nucleotide. RESULTS AND DISCUSSION The study included 62 MRSA isolates recovered from Moscow clinics based on the results of testing the resistance to methicillin. The multiplex PCR assay allowed us to reveal the presence of typeIV SCCmec in 54 MRSA isolates (87.1%) and typeIIIa SCCmec in seven MRSA isolates (11.3%). One isolate proved to harbor the mecA gene; however, the cassette type (i.e. sequences adjacent to mecA) could not be determined with the previously described primer sets (Table 2). MLST assigned 51 MRSA isolates (82.3%) to ST8, 7 (11.3%) to ST239, 3 (4.8%) to ST1, and 1 (1.6%) to ST641. SNP genotyping enabled us to identify four differ ent SNP profiles among the tested MRSA isolates; nucleotide sequences correspond to the following polymorphisms: arc210, tpi243, arcl62, tpi241, yqiL333, aroE132, and gmk129 (Table 2). Despite S. aureus being the most widespread caus ative agent of nosocomial infections, the genetic diver sity of the pool of MRSA isolates circulating in the Russian Federation remains unknown, which can largely be attributed to the fact that the currently used techniques are expensive and laborintensive; addi tionally, largescale screening for nosocomial infec tions is lacking. Our study attempted to assess the molecular genetic diversity among a number of hospitalacquired MRSA isolates circulating in Russia, which allowed us to genetically characterize them for the first time. The studied MRSA isolates proved to be relatively homoge nous; 93.6% of isolates were assigned to two types of SCCmec, i.e., VI and IIIa. SCCmec VI, which corre sponds to ST8, included 51 (82.3%) isolates and the SCCmec IIIa corresponding to ST239 included seven (11.3%) isolates. Thus, the clonality of MRSA was dominated by ST8MRSASCCmec IV and ST239MRSASCC
MOLECULAR GENETICS, MICROBIOLOGY AND VIROLOGY
Vol. 25
No. 2
2010
MOLECULAR GENETIC CHARACTERIZATION OF METHICILLINRESISTANT ISOLATES
mec IIIa, also referred to as EMRSA2, 6 and EMRSA1, 4, 11, Por/Bra, Vienna, respectively. These types of clones are found worldwide [16]. This clonal structure of hospitalacquired MRSA isolates is similar to that found in the United States [15] and some European countries [7, 8, 11]. The prevalence of SASCCmec IIIa is more characteristic of Asia [14], Latin America [21], and Germany [22]. The group identified as ST1MRSASCCmec IV, which consists of three isolates (4.8%) and is also known as USA400 is of great interest. This type of clone has been strongly associated with nonhospital acquired MRSA isolates and has never been detected among hospitalacquired isolates [6]. This finding confirms the artificial classification and demonstrates the potential exchange of isolates between the hospital environment and outside environment. Unfortunately, our study, which is limited in sam ple size and lacks available information on the molec ular genetic diversity of hospitalacquired MRSA iso lates circulating in the Russian Federation, still pro vides sufficient data to draw a conclusion regarding the entire territory of Russia, but not about the epidemio logical patterns of infection with MRSA. Following on from the above, this area of research requires further studies. However, such work is impeded by high cost and laboriousness of the cur rently applied techniques for molecular genetic typ ing. We attempted to develop a more costeffective and less laborious typing technique that could be used for the primary large scale screening of molecular genetic diversity of MRSA isolates and studying of epidemiol ogy of MRSA infection in the Russian Federation. Instead of sequencing of seven housekeeping gene fragments as specified by the conventional MLST pro cedure, our technique involves the evaluation of seven single nucleotide sites located in these seven genes [18]. To identify single nucleotide polymorphisms, we used minisequencing followed by MALDI mass spectrome try. Thus, SNPs of each MRSA isolate were genotyped, which allowed us to detect four SNP profiles corre sponding to the obtained sequence types (Table 2). To assess the potential of the discovered SNPs for the rapid genotyping of hospitalacquired MRSA iso lates, ten housekeeping gene fragments of widespread hospitalacquired MRSA isolates were analyzed [5, 11, 14]. These ten clones were assigned to ten STs classified into five clonal complexes (CCs) as follows: CC5 (ST5 and ST228), CC8 (ST8, ST239; ST241, ST247, and ST254), CC22 (ST22), CC36 (ST36), and CC45 (ST45). The results are given in Table 3. It is obvious that SNP genotyping enables one to identify major clonal complexes in field MRSA isolates world wide. Although the discriminatory power of MALDI MS is weaker as than conventional MLST and this technique does not enable one to detect new types of
69
Table 3. Dominant clones of MRSA worldwide and corre sponding SNP profiles Clonal complex
ST
SNP profile
CC8/239
239
TAAGTAC
241 CC8
8
TATGTAC
254 247 CC5
5
AATGCAT
228 CC22
22
AGTGTGC
CC30
36
TGAGTGT
CC45
45
AGAGTGT
sequences, it can be used for the routine screening of the transmission of hospital MRSAinduced infec tions. The developed MALDI MS technique yields accuracy and reproducibility similar to conventional genotyping assays in terms of speed, high manufactur ability, and low cost. REFERENCES 1. Dekhnich, A.V., Klin. Mikrobiol. I Antimikrob. Khimioter, 1999, vol. 1, no. 2, pp. 89–91. 2. Dmitrenko, O.A., Extended Abstract of Doctoral (Med.) Dissertation, Moscow, 2008. 3. Ob uluchshenii meditsinskoi pomoshchi bol’nym s gnoinymi khirurgicheskimi zabolevaniyami i usilenii meropriyatii po bor’be s vnutribol’nichnoi infektsiei. Prikaz Ministerstva zdravookhraneniya SSSR ot 31 iyu lya 1978 g. № 720 (On Improvement of Medical Aid to Patients with Purulent Surgical Diseases and Enhance ment of Measures Aimed at Fighting against Intrahos pital Infections. Order of the Ministry of Health of the USSR No. 720 Issued July 31, 1978), Moscow, 1978. 4. Afanas’ev, M.V., Ikryannikova, L.N., Il’ina, E.N., et al., J. Antimicrob. Chemother., 2007, vol. 59, no. 6, pp. 1057–1064. 5. Ayliffe, G.A., Clin. Infect. Dis., 1997, vol. 24, pp. 74–79. 6. Bhattacharya, D., Carleton, H., Tsai, C.J., et al., J. Clin. Microbiol., 2007, vol. 45, pp. 1798–1803. 7. Cookson, B.D., Robinson, D.A., Monk, A.B., et al., J. Clin. Microbiol., 2007, vol. 45, pp. 1830–1837. 8. Deurenberg, R.H., Vink, C., Oudhuis, G.J., et al., Antimicrob. Agents Chemother., 2005, vol. 49, pp. 4263– 4271. 9. Enright, M.C., Day, N.P., Davies, C.E., et al., J. Clin. Microbiol., 2000, vol. 38, pp. 1008–1015. 10. Enright, M.C., Robinson, D.A., Randle, G., et al., Proc. Natl. Acad. Sci. USA, 2002, vol. 99, pp. 7687– 7692.
MOLECULAR GENETICS, MICROBIOLOGY AND VIROLOGY
Vol. 25
No. 2
2010
70
AFANAS’EV et al.
11. Hallin, M., Denis, O., Deplano, A., et al., J. Antimi crob. Chemother., 2007, vol. 59, pp. 465–472. 12. Il’ina, E.N., Malakhova, M.V., Generozov, E.V., et al., J. Clin. Microbiol., 2005, vol. 43, no. 6, pp. 2810–2815. 13. Jevons, M.P., Br. Med. J., 1961, vol. 1, pp. 124–125. 14. Ko, K.S., Lee, J.Y., Suh, J.Y., et al., J. Clin. Microbiol., 2005, vol. 43, pp. 421–426. 15. Liao, M.R.S., Storch, G.A., Buller, R.S., et al., J. Clin. Microbiol., 2006, vol. 44, pp. 2254–2257. 16. Nimmo, G.R., Coombs, G.W., Pearson, J.C., et al., Med. J. Aust., 2006, vol. 184, no. 8, pp. 384–388. 17. Oliviera, D.C. and Lencastre, H., Antimicrob. Agents Chemother., 2002, vol. 46, pp. 2155–2161.
18. Stephens, A.J., Huygens, F., InmanBamber, J., et al., J. Med. Microbiol., 2006, vol. 55, pp. 43–51. 19. Stratchounski, L.S., Dekhnich, A.V., Kretchikov, V.A., et al., J. Chemother., 2005, vol. 17, pp. 54–60. 20. Vereshchagin, V.A., Il’ina, E.N., Zubkov, M.M., et al., J. Antimicrob. Chemother., 2005, vol. 56, no. 4, pp. 624– 632. 21. Vivoni, A.M., Diep, B.A., Magalhaes, A.C.G., et al., J. Clin. Microbiol., 2006, vol. 44, pp. 1686–1691. 22. Wisplinghoff, H., Ewertz, B., Wisplinghoff, S., et al., J. Clin. Microbiol., 2005, vol. 43, pp. 5445–5451. 23. Zhang, K., McClure, J.A., Elsayed, S., et al., J. Clin. Microbiol., 2005, vol. 43, pp. 5026–5033.
MOLECULAR GENETICS, MICROBIOLOGY AND VIROLOGY
Vol. 25
No. 2
2010
