ISSN 08914168, Molecular Genetics, Microbiology and Virology, 2012, Vol. 27, No. 4, pp. 154–159. © Allerton Press, Inc., 2012. Original Russian Text © A.V. Popova, V.P. Myakinina, M.E. Platonov, N.V. Volozhantsev, 2012, published in Molekulyarnaya Genetika, Mikrobiologiya i Virusologiya, 2012, No. 4, pp. 18–22.
EXPERIMENTAL WORKS
Molecular Genetic Characterization of MultidrugResistant Acinetobacter baumannii Strains and Assessment of their Sensitivity to Phage AP22 A. V. Popova, V. P. Myakinina, M. E. Platonov, and N. V. Volozhantsev State Research Center for Applied Microbiology and Biotechnology, Obolensk, Moscow oblast, 142279 Russia email:
[email protected],
[email protected],
[email protected] Received February 28, 2012
Abstract—Molecular genetic analysis of 130 multidrugresistant nosocomial Acinetobacter baumannii strains was performed. The strains were obtained from patients admitted to different hospitals in large Russian cities (Chelyabinsk, Moscow, Nizhny Novgorod, and St. Petersburg) in 2005–2010. Species identification was per formed by the amplified 16S rRNA gene restriction analysis and by determining the blaOXA51like genes intrin sic for A. baumannii using PCR. Genetic typing of the strains was performed by RAPDPCR. All strains fell into two clusters, A and B, with the dominant RAPD groups A1 and B1, respectively, including 82% (107 out of 130) of all strains under study. Susceptibility of the strains to bacteriophage AP22 was determined. The phage was shown to infect specifically and to lyse 69% of 130 strains and 82% (88 out of 107) of A. baumannii strains from the dominant RAPD groups. The ability of bacteriophage AP22 to lyse a broad range of clinically relevant A. baumannii strains makes it an attractive candidate for designing phage cocktails intended to con trol the A. baumanniiassociated nosocomial infections. Moreover, the phage can be used for identifying A. baumannii in the bacteriological tests of clinical samples. Keywords: Acinetobacter baumannii, species identification, genotyping, bacteriophage DOI: 10.3103/S0891416812040064
Acinetobacter baumannii is one of the most signifi cant pathogens of nosocomial infections among non fermenting Gramnegative aerobic microorganisms. In emergency resuscitation and intensivecare units (ICUs) and in burn units, A. baumannii is often iso lated from patients with hospitalacquired pneumo nia, wound infections (including thermal injuries), catheterassociated urinary tract infections, postoper ative complications, and sepsis [13, 15]. The high level and broad range of the natural and acquired resistance of A. baumannii to antimicrobial drugs of different functional classes is currently noted worldwide [1, 12]. Other clinically significant features of this microor ganism are as follows: resistance to disinfectants, dry ing, UV radiation, and tolerance to detergents [18, 19]. The high rate of survival on environmental objects and the ability to persist for a long period of time within a hospital [7] enhance the risk that this microbe will be transmitted through medical staff and utensils. On the background of active application of broadspectrum antibiotics, it results in the rapid spread of A. baumannii in the inpatient departments of hospitals, especially ICUs. In this respect, the timely detection of A. bauman nii in the inpatient departments of hospitals, rapid identification of this microorganism and, which is no less important, development of novel antibacterial
drugs against A. baumanniiassociated infections are highly relevant. One possible way to solve the latter problem is the use of lytic phages. The phages specifically infecting the clinical strains of A. baumannii are characterized in a few articles that have been published in the past 2 years [10, 11, 22]. At the same time, there is not a single article in the domestic literature that would characterize the phages active against this microorganism. In addition, it should be noted that, at present, there are no commer cial bacteriophage preparations for controlling noso comial infections caused by A. baumannii, which is due primarily to the absence of collections of promis ing phages that could be used for their development. The goal of this work was molecular genetic char acterization of antibioticresistant A. baumannii strains isolated from patients admitted to different hospitals of large Russian cities (Chelyabinsk, Mos cow, Nizhny Novgorod, and St. Petersburg) in 2005– 2010 and assessment of their sensitivity to the bacte riophage AP22. MATERIALS AND METHODS Bacterial strains. The following microorganisms were used in this work: antibioticresistant strains of A. baumannii isolated from clinical samples (wound
154
MOLECULAR GENETIC CHARACTERIZATION
effluent, biopsy samples, sputum, bronchoalveolar lavage, pleural fluid, urea, bile, blood, contents of drainage, intravenous catheters) at bacteriological lab oratories of different hospitals in Chelyabinsk, Mos cow, Nizhny Novgorod, and St. Petersburg; the bacteria of other genomospecies of Acinetobacter: A. genomospe cies 3, A. genomospecies 10, A. johnsonii, A. shindleri, A. lwoffii, A. anitratus, and A. calcoaceticus, as well as the bacteria of other genera and families: Pseudomonas aeruginosa, Escherichia coli, Yersinia pseudotuberculo sis, Yersinia enterocolitica, Klebsiella pneumonia, Kleb siella oxytoca, Enterobacter cloacae, Pasteurella multo cida, and Salmonella Enteritidis. Luria–Bertani (LB) broth and Nutrient agar (Himedia Laboratories Pvt., India) were used for bac terial culture growth. Genomic DNA isolation. The bacterial genomic DNA to be used as a matrix in amplification reaction was obtained as follows: 0.5 mL of overnight culture grown in the LB broth was transferred into a 1.7mL tube and centrifuged for 5 min at 5000 g. The superna tant was removed, and the cells were washed with saline solution; the precipitate was resuspended in 180 μL of TE buffer (10 mM TrisHCl, pH 7.5; 1 mM EDTA, pH 8.0) additionally containing 5–10 mM EDTA, followed by the addition of 20 μL of lysozyme solution (10 mg/mL) and RNAse free from DNAse to a final concentration of 20 μg/mL and incubation for 30 min at 37°C. Upon addition of 400 μL of guanidine isothiocyanatebased lysis buffer, the incubation was performed for 15–30 min at 56°C. The resultant mix ture was supplemented with 500 μL of chloroform : isoamyl alcohol solution (24 : 1) and mixed; the phases were separated by centrifugation for 5 min at 20000 g. Extraction was performed several times. The upper (water) phase was carefully taken and transferred into a new test tube. Isopropanol (700 μL) was added to the supernatant. Centrifugation was performed for 5 min at 20000 g; the precipitate was washed twice with 70% ethyl alcohol and once with 96% ethyl alcohol, dried, dissolved in 200 μL of deionized water or TE buffer, and stored in a frozen state at –20°C. The isolated DNA quantity and quality was controlled by electro phoresis in 0.5% agarose gel and spectrophotometry. Identification of the strains. The species identifica tion of A. baumannii strains was performed by the method of restriction fragment length polymorphism analysis of amplification products (PCRRFLP) of the 16S rRNA gene with the following primers: SP2 16S (5'GATCATGGCTCAGATTGAACGC3') and ASP216S (5'GCTACCTTGTTACGACTTCACCC3') developed on the basis of sequence analysis of the 16S rRNA gene of A. baumannii deposited in GenBank (CP000863.1, CP000521.1, CP001172.1, CU459141.1, and CP001182.1) and restriction endonuclease AluI. The PCR reaction mixture (30 μL) contained: 10 mM of TrisHCl (pH 8.8 at 15°C), 50 mM of KCl, 0.08% Nonidet P40, 1.5 mM of KCl; 0.5 μM of the
155
direct and reverse primers; 150 μM of each dNTP; 1 unit of TaqDNA polymerase; and 10–50 ng of matrix bacterial DNA. Amplification reaction was performed as follows: 95°C for 5 min (95°C, 30 s; 55°C, 30 s; 72°C, 30 s) during 30 cycles. Reaction products were separated by electrophoresis in 1.5% agarose gel in Trisborate (TBE) buffer followed by staining with ethidium bromide solution (5 μg/mL). The reaction mixture for the cleavage of amplicons by the restriction endonuclease AluI, containing 0.2 μg of DNA (5 μL of PCR product), was incubated in accordance with the manufacturer’s instructions (Fer mentas, Lithuania). Electrophoresis was performed in 2% agarose gel in TBE. The sizes of AluI fragments deter mined with PhotoCaptMw Version 99.04 were com pared in silico [4] with the sizes of the respective AluI frag ments of the 16S rRNA gene of A. baumannii strains with the identified nucleotide sequences deposited in GenBank (CP000863.1, CP000521.1, CP001172.1, CU459141.1, and CP001182.1). In addition, the strains were identified by deter mining the genes of speciesspecific OXA51 βlacta mases and related enzymes (the blaOXA51like genes) by the method of PCR with the primers described previ ously [21]. Genotyping. Genetic typing of A. baumannii strains was performed by the method of PCR with arbitrary primers (RAPD): Wil2 (5'TCACGATGCA3') [20] and 1247 (5'AAGAGCCCGT3') [3]. PCR was per formed in 25 μL of reaction mixture containing 75 mM of TrisHCl (pH 8.8 at 25°C), 20 mM of (NH4)2SO4, 0.01% Tween 20, 2 mM of MgCl2, 0.4 μM of the primer, 200 μM of each dNTP, 1 unit of Taq DNA polymerase, and 10–50 ng of bacterial DNA. Amplification reaction was performed as follows: 94.5°C for 3 min (94°C, 1 min; 35°C, 1 min; 72°C, 2 min) for 5 cycles; (94°C, 30 s; 35°C, 30 s; 72°C, 2 min) for 40 cycles; 72°C, 10 min. Amplification products were detected by electrophoresis in 1.5% agarose gel in the TBE buffer. Cluster analysis of RAPD profiles was performed with Bionumerics 5.1 (Applied Math NV, Belgium) using the Ward algo rithm and Cosine coefficient. Bacteriophage reproduction, concentration, and purification. The strain A. baumannii 1053 isolated from wound effluent of a patient from the Chelyabinsk Burn Center was used as a host strain of bacteriophage AP22. The pure phage preparation was obtained from a single plaque after three successive passages on the bacterial lawn. Phage lysate was obtained as follows: an overnight culture of A. baumannii 1053 was inoculated in 200 mL of the LB broth, grown at 37°C with aeration to OD600 = 0.3–0.4, infected with the bacteriophage so that the multiplicity of infection was one bacterioph age per ten bacterial cells, and incubated until notice able lysis of liquid culture.
MOLECULAR GENETICS, MICROBIOLOGY AND VIROLOGY
Vol. 27
No. 4
2012
156
POPOVA et al. (a) 1
2
3
(b) L
4
5
bp
bp 500 400 300
bp 500 400 300 200
200 100
100
Fig. 1. Identification of A. baumannii strains by the PCRRFLP method. (a) Electrophoregram of the products of hydrolysis of the amplified 16S rRNA gene fragments of clinical strains. The amplicon obtained by PCR with primers for the 16S rRNA gene of one of the A. baumannii strains (1490 bp) (1); the products of amplicon hydrolysis by restriction endonuclease AluI (2–5); the Gene RulerTM 100bp DNA Ladder Plus marker (L); (b) analysis in silico (http://insilico.ehu.es/). Distribution of AluI frag ments within the analyzed amplicons typical of the A. baumannii genomes represented in GenBank (by the example of the strain A. baumannii ACICU, CP000861.1).
Phage lysate was purified by differential centrifuga tion. Cell debris was precipitated in the lowspeed mode (7000 g, 30 min); the phage lysate was concentrated by ultracentrifugation for 2 h at 4°C and 25000 rpm (Beck man centrifuge, rotor SW28). The precipitate was carefully suspended in SM buffer (TrisHCl, 10 mM, pH 7.5; MgSO4 ⋅ 7H2O, 10 mM; NaCl, 150 mM) and centrifuged at 13000 g; the supernatant was treated with DNAse (1 μg/mL) and RNAse (1 μg/mL) at 37°C. Nucleases were removed with chloroform. The lytic spectrum of the bacteriophage. The speci ficity and the spectrum of antibacterial action of the bacteriophage were determined by the method of spot testing and standard doublelayer technique. During spot testing, 0.3 mL of broth bacterial cultures (~108– 109 CFU/mL) was mixed with 4 mL of soft agar (LB with 0.6% agarose and 400 μg/mL of potassium chlo ride) at 45°C and spread over the surface of M9 mini mal medium [14]. After solidification of the upper agar layer, 10 μL of the bacteriophage (~108 PFU/mL) was applied to the surface and incubated at 37°C for 18–24 h. Visual observation of the plates with sensitive A. baumannii cultures showed no growth of the bacte rial lawn in the places of bacteriophage introduction (a clear spot of lysis). In the case of the standard double layer method, the required dilution of the bacterioph age was added to the bacterial culture of a sensitive strain, mixed with soft agar, and applied to the surface of the nutrient medium.
RESULTS AND DISCUSSION The main objects of research were multiply resis tant A. baumannii strains isolated from patients of burns units, selective and emergency surgery units, therapeutics departments, resuscitation and intensive care units, and urology department in 2005–2011. The strains were isolated from wound effluent (45%), sputum (18%), drainage effluent (13%), washouts from hospital objects (5%), etc. Since at present there are no standard biochemical test kits for unambiguous identification of even the most widespread species within the genus Acineto bacter [6, 8, 12], the affiliation of isolated bacterial cultures with A. baumannii (genomospecies 2) has been determined in the present work by molecular genetic methods. One of them, the analysis of restric tion fragment length polymorphism of the 16S rRNA gene amplification products (PCRRFLP), is a well reproducible molecular genetic reference method for intraspecies identification of acinetobacteria [12]. The size of amplicons obtained in PCR with the primers to the 16S rRNA gene of A. baumannii is 1490 bp. The cleavage of amplicons by restriction endonuclease AluI results in formation of fragments with sizes abso lutely corresponding to AluIfragments of the known 16S rRNA genes of A. baumannii strains determined in silico (Fig. 1). The findings confirm the affiliation of the analyzed clinical strains to genomospecies 2. In the course of research, a total of 130 A. baumannii strains were identified by the PCRRFLP method.
MOLECULAR GENETICS, MICROBIOLOGY AND VIROLOGY
Vol. 27
No. 4
2012
MOLECULAR GENETIC CHARACTERIZATION 1
2
3
4
5
6
7
L
8
9
10
11
157 12
13
100
Fig. 2. Analysis of Acinetobacter strains by the method of PCR with the primers for speciesspecific blaOXA51like genes (1.5% agarose gel). (1, 2) Acinetobacter genomospecies 3, (3) A. johnsonii, (4) A. shindleri, (5, 6) A. lwoffii, (7) Acinetobacter geno mospecies 10 (7), (8–11) A. baumannii, (12) Pseudomonas aeruginosa, and (13) H2O; the Gene RulerTM 100bp DNA Ladder Plus marker (Fermentas, Lithuania) (L).
RAPD profile
(a)
(b)
1
2
3
4
A1 A2 A3 A4 A5 A6 B1 B2 B3 B4
62 1 9 1 5 1 45 3 2 1
Ch, M, SP Ch Ch, NN, M, SP Ch NN SP Ch, NN, M, SP Ch Ch Ch
43 (69%) 0 1 (11%) 0 0 0 45 (100%) 0 0 0
Fig. 3. Dendrogram of clustering of A. baumannii strains. Each genotype (RAPD group) is marked with the RAPD profile of the representative strain; (1) genotype lettering; (2) total number of strains comprising the genotype; (3) place of strain isolation: Chelyabinsk (Ch), Nizhny Novgorod (NN), Moscow (M), and St. Petersburg (SP); and (4) number of strains within the genotype lysed by bacteriophage AP22 (%).
It is known that A. baumanii is characterized by the speciesspecific blaOXA51like genes localized in the chromosome, which unite the group of closely related variants responsible for the synthesis of oxacillin hydrolyzing βlactamases of class D: OXA51, 64, 65, 66, 67, 68, 69, 70, 71, 75, 76, 77, 83, 84, 86, 87, 88, 89, 91, 92, 94, and 95 [5, 9, 12, 16]. The phenotype of car bapenem resistance is ensured by hyperproduction of the blaOXA51like genes, which is determined by the presence of an upstream insertion sequence ISAba1 providing a promoter for these genes [17]. To date, it is still an open question whether blaOXA51like genes are present in all A. baumannii isolates and whether they
occur in other species of microorganisms. In this con text, it seemed advisable to detect them in the identi fied strains of A. baumannii by the method of PCR with oligonucleotide primers complementary to the conservative nucleotide sequences of the blaOXA51like genes [21]. Analysis showed that all of the strains under study (n = 130) contained the blaOXA51like gene sequences. At the same time, no blaOXA51like genes were found in the acinetobacteria A. johnsonii, A. shindleri, and A. lwoffii, as well as in the Acinetobacter strains of genomospecies 3 and 10 (Fig. 2). The method of RAPDPCR was used for further genetic typing of A. baumannii strains. Although this
MOLECULAR GENETICS, MICROBIOLOGY AND VIROLOGY
Vol. 27
No. 4
2012
158
POPOVA et al.
Fig. 4. Morphology of plaques of bacteriophage AP22 on the culture of the strain A. baumannii 1053 (the lower layer is M9 minimal medium; the upper layer is LB brothbased semisolid agar).
PCR variant is characterized by low interlaboratory reproducibility, it is still a rather convenient and quick method of analyzing a particular collection of strains Specificity of bacteriophage AP22 (spot testing) Presence (+) or absence (–) of lysis
Microbial species Acinetobacter baumannii (130)* A. genomospecies 3 (2) A. genomospecies 10 (2) A. johnsonii (1) A. shindleri (1) Acinetobacter lwoffii (6) Acinetobacter calcoaceticus (2) Acinetobacter anitratus (4) Pseudomonas aeruginosa (5) Escherichia coli (3) Yersinia pseudotuberulosis (3) Yersinia enterocolitica (3) Klebsiella pneumoniae (3) Klebsiella oxytocae (3) Enterobacter cloacae (3) Pasteurella multocida (3) Salmonella Enteritidis (3)
+ (89) –(41) – – – – – – – – – – – – – – – –
Note: the number of strains of this species used during testing is given in brackets (*).
isolated in one or several hospitals and is undoubtedly valuable in terms of epidemiology. The dendrogram reflecting the degree of genetic relationships among strains under study was con structed on the basis of cluster analysis of RAPD pro files of 130 A. baumannii strains (Fig. 3). This dendro gram shows that the strains comprise two clusters con ventionally designated as A and B, with a degree of homology over 90%. Cluster A (61% of the tested clin ical strains of A. baumannii) is represented by six gen otypes or clonal groups, while cluster B (39% strains) combines four genotypes. Each cluster contains one dominating group, i.e., the group with the maximum number of strains having identical RAPD profiles (similar genotypes): group A1 in cluster A, including 48% of all strains under study, and group B1 in cluster B (35% of strains), as well as the minor groups repre sented by single unique strains different in genotype from the members of other RAPD groups: groups A2, A4, and A6 (cluster A) and group B4 (cluster B). Thus, there are two main genetic groups of A. bau mannii strains that have been circulating for several years under hospitalacquired conditions in the in patient departments in different cities of Russia. The identified A. baumannii strains were character ized by high resistance to most antibiotics, with the exception of inhibitorprotected cephalosporin (sulp erason) and carbapenems (imipenem and mero penem). Multidrug resistance to antibacterial agents is a typical feature of nearly all nosocomial strains of A. baumannii, making it difficult to treat A. bauman niiassociated infections and to eliminate the patho gen from inpatient departments of medical institu tions. The application of lytic bacteriophages may be a promising approach for limiting the spread of antibi oticresistant A. baumannii strains. One of the tasks of our research was to assess the lytic activity of bacteriophage AP22 [2] against A. bau mannii strains from different genetic groups. Bacteriophage AP22 was isolated from the clinical material obtained in the Burn Center of the N.V. Skli fosovsky Research Institute of Emergency Medicine (Moscow) and deposited in the collection of microor ganisms of the State Research Center for Applied Microbiology and Biotechnology (number Ph42). The bacteriophage forms round clear plaques about 2–3 mm in diameter with a halo on the bacterial cul ture of sensitive A. baumannii strains (Fig. 4). The halo diameter varies from several millimeters to several centimeters and increases with time. Plaques are formed on the plates already after 4 h of incubation at 37°C. The titer of the bacteriophage during its repro duction in liquid culture is about 1010 PFU/mL. The experimental series has demonstrated that bac teriophage AP22 lyses a total of 69% (89 out of 130) antibioticresistant clinical strains of A. baumannii and has no lytic activity against representatives of other genomospecies of Acinetobacter, as well as bacteria
MOLECULAR GENETICS, MICROBIOLOGY AND VIROLOGY
Vol. 27
No. 4
2012
MOLECULAR GENETIC CHARACTERIZATION
from other genera and families (see table). Thus, the bacteriophage is characterized by specificity and, in contrast to other known phages of A. baumannii, rather broad spectrum of lytic activity. Thus, phage AB1 [22] isolated from marine sediment sample lyses only one of the five strains selected for the study. Another described bacteriophage ϕAB2 [11] isolated from hospital wastewater samples shows the lytic activity against 25 out of 125 polyresistant strains of A. baumannii. The recently characterized phage Abp53 lyses 27% of the A. baumannii strains under study [10]. It should be noted that bacteriophage AP22 has a more pronounced lytic activity against representatives of the predominant RAPD groups A1 and B1 wide spread in a few large hospitals of Russia, lysing 82% (88 out of 107) of these A. baumannii strains (see Fig. 3). Thus, the marked species specificity and the broad spectrum of lytic activity of bacteriophage AP22 make it possible to consider it as a potential component of combined therapeutic phage preparation for control ling A. baumannii infections, as well as to use bacte riophage AP22 for A. baumannii identification during bacteriological analysis of clinical samples. ACKNOWLEDGMENTS The work was carried out under the Sectoral Appli cations Research Program “Scientific Research and Development for Insurance of Sanitary–Epidemio logical WellBeing and Reduction of Infectious Mor bidity in the Russian Federation” for 2011–2015; state registration number 01201172662 (topic no. 045). We are deeply grateful to M.A. Popova (Municipal Clinical Hospital no. 6, Chelyabinsk), T.G. Spiri donova (Sklifosovsky Research Institute of Emer gency Medicine, Moscow), N.A. Gordinskaya (Research Institute of Traumatology and Orthopedics, Ministry of Health and Social Development of the Rus sian Federation, Nizhny Novgorod), A.E. Goncharov (Mechnikov State Medical Academy, St. Petersburg), N.K. Fursova (State Research Center for Applied Microbiology and Biotechnology, Obolensk), and M.V. Edelshtein (Research Institute of Antimicrobial Chemotherapy, Smolensk) for providing bacterial strains, clinical isolates, and samples for investigation. REFERENCES 1. Martinovich, A.A., Klin. Mikrobiol. Antimirob. Khimioter., 2010, vol. 12, pp. 96–105.
159
2. Bacteriophage Acinetobacter baumannii Strain AP22 for Identification of Bacterium Acinetobacter bauman nii in Bacteriological Analysis of Clinical Material and Obtaining a Preparation to Combat with Hospital Infections Induced by A. baumannii, RF Patent No. 2 439 151, 2012. 3. Akopyanz, N., Bukanov, N.O., Westblom, T.U., et al., Nucleic Acids Res., 1992, vol. 20, pp. 5137–5142. 4. Bikandi, J., San Millan, R., Rementeria, A., and Garaizar, J., Bioinformatics, 2004, vol. 20, pp. 798–799. 5. Brown, S., Young, H.K., and Amyes, S.G., Clin. Micro biol. Infect., 2005, vol. 11, pp. 15–23. 6. Chang, H.C., Wei, Y.F., Dijkshoorn, L., et al., J. Clin. Microbiol., 2005, vol. 43, pp. 1632–1639. 7. de Oliveira, A.C. and Damasceno, Q.S., Rev. Esp. Enferm., 2010, vol. 44, pp. 1118–1123. 8. Ehrenstein, B., Bernards, A.T., Dijkshoorn, L., et al., J. Clin. Microbiol., 1996, vol. 34, pp. 2414–2420. 9. Héritier, C., Poirel, L., Founier, P.E., et al., Antimicrob. Agents Chemother., 2005, vol. 49, pp. 4174–4179. 10. Lee, C.N., Tseng, T.T., Lin, J.W., et al., Appl. Environ. Microbiol., 2011, vol. 77, pp. 6755–6762. 11. Lin, N.T., Chiou, P.Y., Chang, K.C., et al., Res. Micro biol., 2010, vol. 161, pp. 308–314. 12. Peleg, A.Y., Seifert, H., and Paterson, D.L., Clin. Microbiol. Rev., 2008, vol. 21, pp. 538–582. 13. Perez, F., Hujer, A.M., Hujer, K.M., et al., Antimicrob. Agents Chemother., 2007, vol. 51, pp. 3471–3484. 14. Sambrook, J., Fritsch, E.F., and Maniatis, T., Molecu lar Cloning: A Laboratory Manual, Cold Spring Harbor, New York: Cold Spring Harbor Lab. Press, 1989. 15. Towner, K.J., J. Hosp. Infect., 2009, vol. 73, pp. 355– 363. 16. Turton, J.F., Woodford, N., Glover, J., et al., J. Clin. Microbiol., 2006, vol. 44, pp. 2974–2976. 17. Turton, J.F., Ward, M.E., Woodford, N., et al., FEMS Microbiol. Letts., 2006, vol. 258, pp. 72–77. 18. Webster, C.A., Crow, M., Humphreys, H., and Towner, K.S., Eur. J. Clin. Microbiol. Infect. Dis., 1998, vol. 17, pp. 171–176. 19. Wendt, C., Dietz, B., Dietz, E., and Ruden, H., J. Clin. Microbiol., 1997, vol. 35, pp. 1394–1397. 20. Williams, J.C., Hanafey, M.K., Ragalski, J.A., and Tingey, S.V., Methods Enzymol., 1993, vol. 218, pp. 704–740. 21. Woodford, N., Ellington, M.J., and Coetlho, J.M., Int. J. Antimicrob. Agents, 2006, vol. 27, pp. 351–353. 22. Yang, H., Liang, L., Lin, S., and Jia, S.S., BMC Micro biol., 2010, vol. 10, p. 131.
MOLECULAR GENETICS, MICROBIOLOGY AND VIROLOGY
Vol. 27
No. 4
2012
